Gene PTPRG Variant 1
DNA : 732.45 KbNT_022517
mRNA : 5770 bp NM_002841
CDS : 4338 bp NP_002832
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  802 bp
gagcagagccgagggacccagcgcaaggcgggagccaagcgcggctgctttaagaacgcg
gagagcgcgcgcccgccgccagctggcccgggctgcgcgcccccgccgccaccgcgcgcc
ccctgttcgctcgctccttcgctcgccggctttaaagtctctgccaggatccatgctcac
ATGTTACTTCCTGTATGGAGGCATGGCCAGTTTCCAGCCCCGCGCTCTTCGTTCCTTCCC
AGCCTGCGCCGGAGCCACAACTTTCAGGAGCATGGACTGAAGGCGCCCTCGCCCCAGCGC
CCCTCTGAGATCCTTTGTGTTTTCCTCCGTTTCCTCCGGCCGTTTCTATTTTGGGGGGCT
CTCCGCTCCCCCTGCCTCTCCCCTCCCCTTCCCCTCTCGCAAACATGCCTCCTTCCTTCC
CGGGGCCCTGGAAGGAGCTGCCTGCCTGAAGCCCGGAGACGCCGCGCCGCGCTCAGCCCC
GCCGCCGCCCGCCGGCTCTCGGGCTGTGCTGCGCTGCCGACTCAAGTTGGGGATCCTCGG
CTGCTCGCCGCCGCCGCCCGCGGTCCCTGCCTGCCCCAGGCCCGGGGCATCGCCGCCGGC
CGCCGACTCCGCGCCCTGCCCGATCGGCTCTCTCCTTTTTAAACGGAAAGCAGCCTTTCT
CCGCCGAGAGGATCGTCCCCAGCGTGGCTCTGCGTTCCCGGTCACTTTTTGAGATTTTCC
GGGGGGCGCTCGGCGGCTTCCCGGATTCCAAGGGGACTCGGGCCGCCGAGCGCGGGGGGC
CCGTGGAGCGGGCGAGCCGGGGAAGCGCCCCGGCTTAGCGGAGGCTCGCACGGAGGCAAG
AACTTATTCAACAAGTTTACCTCCCTGCTTTCCTCTTTTCGATGTGCGTTTTCGGACATG
CGGAGGTTACTGGAACCGTGTTGGTGGATTTTGTTCCTGAAAATCACCAGTTCCGTGCTC
CATTATGTCGTGTGCTTCCCCG
gtgagtgccggccgccgaggggatgcggccccggccggcgcgcgttggggatgcggagtt
gtcgcctgggcgcggagctccggcgcccgtccgggagaccctggagagggtggagggtgg
cccggcgcccggataggagaaaaggattgctccgctggcttggatgatgtttagggaggc
EXON 2  105 bp
aataataatttgtctggactttcctatagttttttttttttttgtaaaataagttggttc
tagtcagtcatcctcaaggactatgattctacgaagtcacccaatggtgttcatttgaca
cccttcctgtatccagtggggtgctgcctttgtctcattgtgggttttcctctcttccag
CGTTGACAGAAGGCTACGTTGGGGCCCTGCACGAGAATAGACACGGCAGCGCAGTGCAGA
TCCGCAGGCGCAAGGCTTCAGGCGACCCGTACTGGGCCTACTCTG
gtaagtccagttgttctaatggagatcacacaggccagttaacatcccattcaactcact
tgaaagcacactttgaatcacttttatgcctgagttctgtttgctcaaatctttcgtagt
tcactaaaagttgaaatattcgagcctgtttttcctcaaggttataagcaccttaattta
EXON 3  180 bp
catcttttctgaaatcttcttgtcacatcaggccaatggctttgattcatagttttcagt
acattcacctctttggattggggacatgttgagagatgcagtgctcagcttcctaagatt
tattcatttcatccctgacccttgaaccatgaggattgaagtgttgtcttctttcaacag
GTGCCTATGGTCCTGAGCACTGGGTCACGTCTAGTGTCAGCTGTGGGGGCCGTCACCAGT
CTCCTATTGACATTTTAGACCAGTATGCGCGTGTTGGGGAAGAATACCAGGAACTGCAAC
TCGATGGCTTCGACAATGAGTCTTCTAACAAAACCTGGATGAAAAACACAGGGAAAACAG

gtagacaatggcttctttatttgtccacagagcaacaggaactatttttggatgtctctg
gtgttttccttaaccatgacttgctccttaaatagtgcacattgctgtggggagcctaaa
tcagtccttagtttcagaacaagttatgtaactcagtaaatcactctgtggctaatcacc
EXON 4  149 bp
cattctgcagctagaatgaactaatttattcaggcgggtgtgttcaacatattttttcat
aggtacatgaggacataattcatatcatggtaatggtgaactttattagaagtaacagaa
aaactccatttggttttgaaactcactttgttttcctctcttctcatttgtttcacacag
TCGCCATCCTTCTGAAAGACGACTATTTTGTCAGTGGAGCTGGTCTACCTGGCAGATTCA
AAGCTGAGAAGGTGGAATTTCACTGGGGCCACAGCAATGGCTCAGCGGGCTCTGAACACA
GCATCAATGGCAGGAGGTTTCCTGTTGAG
gtgagagaaagtcaagatctcaacgtgtagctgtgcttcggtctttatgttaatcagatg
ctgtgcccttaccctcagtcattttgcaaatcacagctgtacagtacctaacttcctctc
tctggaaaccctttatccatagtatggcaggtgggtatccatccttgtttctcacctttg
EXON 5  96 bp
gcgagaccttatctcaaaaaaaaaaaaaaaaaaagttagcaaaggaaaaatatgaacagg
tgaataaatttggcaaaatcttattagcaactggggaatatacatttatggtactattct
ctcaactttttatttatgtttgaaaattttcctaatacatttttttaattgttcttacag
ATGCAGATTTTCTTTTACAATCCAGATGACTTTGACAGCTTTCAAACCGCAATTTCTGAG
AACAGAATAATCGGAGCCATGGCCATATTTTTTCAA
gtaagttaacagtggctgaagtacttcaaagaattctttgagtattttttttaatttgcc
gaattgttccatgtttaatgaatgcatctgttttctagttcacacctgtccaaatgaaag
atatttcatattgtctaatgtgtgatttaaaatgtaaataagtatgtttagaaacataat
EXON 6  67 bp
ctcacttgattttatgatgtcataaatctcctgcatttggtgagagccatggtgtatgtg
agacctaagcagcttgctagataacattctattctcccccttctctttagaagattaaac
tgagactgttgtgcctgatgccagaatagatttaaccaatcatgtttcctttacatttag
GTCAGTCCGAGGGACAATTCTGCACTGGATCCTATTATCCACGGGTTGAAGGGTGTCGTA
CATCATG
gtaagtatgccacatacacttccttttgctgggatgtgaagggctcagatctctacctaa
aagaatcaggttatcttgcagaggacagagggtgacacctattcctcatcccctgatgtt
gaagggcattagagccattatatgatgggtaaagagcatgcccatttattacctgcaaat
EXON 7  158 bp
tgggaaatgctgctttgtttactgaggctctcccaccaccaaatgctagtgcttctcagg
atataaacaaacataaggcttgcgatgtggcaccagcatgccgagggtgttgactgtgtc
tgcggctcggaatggcatgacttaccattgtgcttttcttttccctttttccccaaacag
AGAAGGAGACCTTTCTGGATCCTTTCGTCCTCCGGGACCTCCTGCCTGCATCCCTGGGCA
GCTATTATCGGTACACAGGTTCCTTGACCACACCACCGTGTAGCGAAATAGTGGAGTGGA
TAGTCTTCCGGAGACCCGTCCCCATCTCTTACCATCAG
gtagatattcttcctcaagtggggtttctgtgtttacttgttttgtattgacttaacgat
ccagcatggctagagtataccactaaggaatttgttcttgatcctgtgcatatcattgat
tcctgcagtctttcccacaaacatgtttttgaacccaagaactgcaagcgatagaatgtg
EXON 8  193 bp
cagtgtttccagcaggcagcctcaggtcctgctgggtttagcagccctggcattgggcac
ttcctaccgtttcatgctcttatcaccttcacctgctttggaccaaatagcttttctaat
tgatgtgtgttttttgtgttgttttttttttccccctcccctctctggtcctctgttcag
CTTGAGGCTTTTTATTCCATCTTCACCACGGAGCAGCAAGACCATGTCAAGTCGGTGGAG
TATCTGAGAAATAACTTTCGACCACAGCAGCGTCTGCATGACAGGGTGGTGTCCAAGTCC
GCCGTCCGTGACTCCTGGAACCACGACATGACAGACTTCTTAGAAAACCCACTGGGGACA
GAAGCCTCTAAAG
gtatatttggcttaagtgccttgcccagaggaagattccttatcataaattactttaaat
taaaaggaattcaaagccagccaggaattgggacttggtgttaaatgcatatgtttctct
gctaaagggagcctgtctggctgaaaaataggagcaggtgtgggaatatattctgttaaa
EXON 9  185 bp
agggagaacaatgttctccctctctctctacacacacaatgttaagaggacccaggagaa
gggagcatgggtgcttcctgtattactctttcaactttttgaggctgcagtccttagggg
cacggattgaatggcgcattgttctgaaagctccctgagctgagccctgtgtatcttcag
TTTGCAGCTCTCCACCCATCCACATGAAGGTGCAGCCTCTGAACCAGACGGCACTGCAGG
TGTCCTGGAGCCAGCCGGAGACTATCTACCACCCACCCATCATGAACTACATGATCTCCT
ACAGCTGGACCAAGAATGAGGACGAGAAGGAGAAGACGTTTACAAAGGACAGCGACAAAG
ACTTG
gtatgaagcccctcctctgattcagggtacatgctgcagagagggactcctgctgcagct
ctctgccaggcactgcacagtgtgccagctctgtgtcatctgtcctcacactgtctggtg
aacatgggcactgccattgctgcgctgctcgagagtgccggggaggacagtggatggagc
EXON 10  109 bp
tcataaaaatagattcccaggcagggtccaagcggtctttccttccaaagtgagcctttg
gtcagcagggaagcatcacacctgtcaggcattgtcacggcactcaggtttggctttaga
atgcaaagtgtgccttggccttcaaaactaactcactgctttttccttctttacttacag
AAAGCCACCATTAGCCATGTCTCACCCGATAGCCTTTACCTGTTCCGAGTCCAGGCCGTG
TGTCGGAACGACATGCGCAGCGACTTTAGCCAGACGATGCTGTTTCAAG
gtgaggctggcttcccctcctgtggccggggtgcccctgagactccctcccaatgctttc
tgcttcttcctgctcaggtgctggggaaaaatacaaacaagcctggcagaagaatcagtg
tagggttttaaagcctatgcgggaagccctagtaatttaggtcttttaggttggaggttt
EXON 11  50 bp
tttttgtaggactcgtaagccaagaagggctttatatttttaaatggttggaaaaaatct
acagaataatattttgacatgtgaaaattatatgtaattcagatttgtgttcataaggaa
tatcttgttagagccacaaaaaaagttatattgcttaaatgtaatttctttgtttctcag
CTAATACCACTCGAATATTCCAAGGGACCAGAATAGTGAAAACAGGAGTG
gtaagtagagaatgggaaattgctttgtcgtggctggttgttaatttgcttgcagttaaa
actgtcaccacgaagtggcagtataatgttgttaaactgctcagtgtaaagcggttatag
tagagaaaaaattacattattcactttttataattcagtaccttatgaacacaagctgtg
EXON 12  778 bp
gatcacccatggaccacctaatgtcaactttatgccatacattggaaaactccatagcat
agatgagtaaaatcctcagagggtgacaaccagggcctcattcccaatctcaattactga
tgcttctctgctttttcttcttctgcctcttttccacccttgccgggtgaccctttccag
CCCACAGCGTCTCCTGCCTCTTCAGCCGACATGGCCCCCATCAGCTCGGGGTCTTCTACC
TGGACGTCCTCTGGCATCCCATTCTCATTTGTTTCCATGGCAACTGGGATGGGCCCCTCC
TCCAGTGGCAGCCAGGCCACAGTGGCCTCGGTGGTCACCAGCACGCTGCTCGCCGGCCTG
GGGTTCGGCGGTGGTGGCATCTCCTCTTTCCCCAGCACTGTGTGGCCCACGCGCCTCCCG
ACGGCCGCCTCAGCCAGCAAGCAGGCGGCTAGGCCAGTCCTAGCCACCACAGAGGCCTTG
GCTTCTCCAGGGCCCGATGGTGATTCGTCACCAACCAAGGACGGCGAGGGCACCGAGGAA
GGAGAGAAGGATGAGAAAAGCGAGAGTGAGGATGGGGAGCGGGAGCACGAGGAGGATGGA
GAGAAGGACTCCGAAAAGAAGGAGAAGAGTGGGGTGACCCACGCTGCCGAGGAGCGGAAT
CAGACGGAGCCCAGCCCCACACCCTCGTCTCCTAACAGGACTGCCGAGGGAGGGCATCAG
ACTATACCTGGGCATGAGCAGGATCACACTGCCGTCCCCACAGACCAGACGGGCGGAAGG
AGGGATGCCGGCCCAGGCCTGGACCCCGACATGGTCACCTCCACCCAAGTGCCCCCCACC
GCCACAGAGGAGCAGTATGCAGGGAGTGATCCCAAGAGGCCCGAAATGCCATCTAAAAAG
CCTATGTCCCGCGGGGACCGATTTTCTGAAGACAGCAGATTTATCACTGTTAATCCAG
gtaagtggtgcaggtcttcttcgagggttcctgctcctgtgaatagtcgtaccctttttc
aaaaaattgggagcagaaggtgaagcttcagaaggtacttaatattcttagaatcatata
tgtctgtcatagaaaaggtgcacacatgtgaaatgtgtatgtgtgtgtccctgttttact
EXON 13  133 bp
gggttgggatggggcaggaaatggtgagggctgcggattgcccctcctgtcatggggcag
ctcagagcaaatggcccagttcgccagaaaccacacaaaactggaacagaactctgcatc
aattctggctcccacctccactaacctctgtcctctaactgggatgatttctcttggcag
CGGAAAAAAACACCTCTGGAATGATAAGCCGCCCTGCTCCAGGGAGGATGGAGTGGATCA
TCCCTCTGATTGTGGTATCAGCCTTGACCTTCGTGTGCCTCATCCTTCTCATTGCTGTGC
TCGTTTACTGGAG
gtaagccaggcagcacctacagcgtagatttgggggccagatgctggccaggttttgctc
acgggaggggaatcccacggcctctgcattcaggaaggtgaggtagcttaagtgtttctg
gtcttgccacccggaaggccatcttgtctctgttagatgatggcagggccagatccactt
EXON 14  87 bp
aaagctcctcataagctcctttgtgcataagcatcctcttttgaaaatgtcacagatgag
gcctgatgacggggtctgtctgtgttagatgggaggggagggcatttgtatgcaactctt
ggtggccaattgaaaatactgtattctacacctgttctcttttgttttttgtccatttag
AGGGTGTAACAAAATAAAGTCCAAGGGCTTTCCCAGACGTTTCCGTGAAGTGCCTTCTTC
TGGGGAGAGAGGAGAGAAGGGGAGCAG
gtgaggggcggtcaagcttaagtggggggcgtcttgatggccgggactggcttgccaaat
ttttgttttgttgccatggggattgaagtcttgtagatggcacagtgctgaaactcacct
gctttacctgaattcccaaaagtaagacttgcaaatatcaattcagcttgtgggtagctg
EXON 15  92 bp
aattttgggcccctccaacaggctgaatgttgtccttgtatcttgttacttttacatgag
tttaccctcagtgctgtgtgatgtttaaagctgggaagatctataaaataagaattaaaa
gaagatgaactcaaataaagtatattctattattgacatgtttttctcttttctacacag
AAAATGTTTTCAGACTGCTCATTTCTATGTGGAAGACAGCAGTTCACCTCGAGTGGTCCC
TAATGAAAGTATCCCTATTATTCCTATTCCGG
gtaagtaagacactgctcttatttccaatgggctaattgtttttctcttttattctcagt
tttatgtgataaaacaacaaaatattttatagccttttaaagcttgcccagtataagaaa
ttctctttagaagaacaaataactgagttaatgtagtatacagtcataggcaggaaaggg
EXON 16  92 bp
tgagatcctaatgtaaaataaattctgagacttttcttcaggacatctattttgtgtgat
acaattattttgctctttgcaaaaatcaagtatttgtcttaaggatgctttgctttatca
gtgtaatttgttttatggaagtattctatgtaactttgaatattattttattccccccag
ATGACATGGAAGCCATTCCTGTCAAACAGTTTGTCAAACACATCGGTGAGCTCTATTCTA
ATAACCAGCATGGGTTCTCTGAGGATTTTGAG
gtatgtttcaaggctggaagttaacttccagaaacctaagtcttactttatgcagatttt
tgtaaacttgaactgaattcattccaagcataacaaaacagtaactacggaaagtggagt
ttttcttttcatctattattttaataggcattcttttccaaataaaatttaggtgaaagg
EXON 17  97 bp
acctttttcacattcttcataaactcgttataaatatatcaataattatatccgaagttg
ggattgagaaggtaacggtggctgtggccagggagtgagtaaatactttatgcctttaaa
tgtatatggtgttcctttgtttctaaactgtgtctataatcttgctgttttcttcactag
GAAGTCCAGCGCTGTACTGCTGATATGAACATCACTGCAGAGCATTCCAATCATCCAGAA
AACAAGCACAAAAACAGATACATCAACATTTTAGCAT
gtgagtaataagctttaaactaccttcaactgcgaggaaattaaattttcatgctgggta
taagctgaaagccaagcagtcagaagcaggatgccaagaaagaatgattcttgcaagcta
acctctcattagcccatcttcaacagtgtagaagttgggacattttcttcccccttagcc
EXON 18  83 bp
taggagtggctctgtattttgggatgggtttgaatgctctatttagttgttctgccaaaa
gttttctcagactaccttgggagatgtcatgttacctgattgccttgtgttgtgctttag
aatggtgctagtttctgaattatccattttatttctgtttttttttcttatcttctatag
ATGATCACAGTAGGGTGAAGTTAAGACCTTTACCAGGAAAAGACTCTAAGCACAGCGACT
ACATTAATGCAAACTATGTTGAT
gtaagtcagaactgttattataaacctgtttctagaaattgaagactgcagcagaaactg
tttaatatattttaatactgtacagagctttcactaaaaacaaagcccattcaatatgga
aggcatttgaattattgactggtcttctgtgataactgctttcatctcactttgtgctgt
EXON 19  135 bp
tgttattataaacctgtttctagaaattgaagactgcagcagaaactgtttaatatattt
taatactgtacagagctttcactaaaaacaaagcccattcaatatggaaggcatttgaat
tattgactggtcttctgtgataactgctttcatctcactttgtgctgtgtcattttgaag
GGTTACAACAAAGCAAAAGCCTACATTGCCACCCAAGGACCTTTGAAGTCTACATTTGAA
GATTTCTGGAGGATGATTTGGGAACAAAACACTGGAATCATTGTGATGATTACGAACCTT
GTGGAAAAAGGAAGA
gtaagagccttttgactcactatcttaataatgcaccttcattcaaaagatacttgtgga
gtacctgctttagggtaggaacttgacaaggtataaagagttacggaaatgaaaagtgtt
ctctctgctttatcttgcttatgattcagaaggaaagagagctaaggcattatgagagta
EXON 20  135 bp
caagccatcagccttgtcagaggtcacacctgcctttaagcagttaaactcacgtattcc
tttttcagtcaactaaatggcaatctcacctgtgttttaacattgtcgtttgaaattaca
ttatcaacagaattgtggcatagattgcagttatactttacaacttttttctttctgcag
CGAAAATGTGATCAGTATTGGCCAACAGAGAACAGTGAGGAATATGGAAACATTATTGTC
ACGCTGAAGAGCACAAAAATACATGCCTGCTACACTGTTCGTCGTTTTTCAATCAGAAAT
ACAAAAGTGAAAAAG
gtatggaaggaattgggtaggctgccagggcatcccctttttatacttgtatgaaaatta
ctgtacaaccaaggccaaatctcataaccaacttggtttttaaaaagtatttttaaaaca
ttttttcataactcttttgattgacatcagtgtatggtgtgaaaggtattggcaaagcat
EXON 21  173 bp
gcttggtaatgtctccaatttaatggcatgaaagttggctacaagggggaataacctagc
ctgggaacagtgattagggtgaatgtgatcagtggtcatgtgtcctgacacccttacatt
atttttttccagaatgtccacccccccgcttaaagacatcttttttcacttttctcacag
GGTCAGAAGGGAAATCCCAAGGGTCGTCAGAATGAAAGGGTAGTGATCCAGTATCACTAT
ACACAGTGGCCTGACATGGGAGTTCCCGAGTATGCCCTTCCAGTACTGACTTTCGTGAGG
AGATCCTCAGCAGCTCGGATGCCAGAAACGGGCCCTGTGTTGGTGCACTGCAG
gtagggtctaggattcaacatgtgaaatagatggggcaggggacttaggcctcagtgacc
ttggaccacaatgattgctactgctttcacttagaagctgaatcttccactggaaactgg
gatggataagacctatgatagtcttaaagaggctctattcctgtaacattaagaaatcat
EXON 22  136 bp
ggcggaggttgcagtgaaccgagattgcgccactgcactccagcctgggcaacagagtga
aactccatctcatctcagaaaaataataaaataaatggggtttagattggaatttttcga
atccaaagttaacagtatgataaaacaaaagtgccagttgagtgtcttcatttcttacag
TGCTGGTGTGGGCAGAACAGGCACCTATATTGTAATAGACAGCATGCTGCAACAGATAAA
AGACAAAAGCACAGTTAACGTCCTGGGATTCCTGAAGCATATCAGGACACAGCGTAACTA
CCTCGTCCAGACTGAG
gtaaggagtagctgccagcgtcctcacgacattctggcaaatgctgtaactgaaatttgt
taaatgataatgaagagacagattcattcttttagggcttgcagtaatttacaggtttgt
attagaagatattctgacaatgatcctattctacggatcacagttttccatttctgtatg
EXON 23  147 bp
accgtaaaataagttaagactgataaagtgagtattggagcaaatcacctagctgtaagt
gcttgaaggaaatcactgggaggtccctgttagcagcagaattaaactaaggtacacttc
atgaatgagtggctaacccttaacactccctcagtgactaccatgtattgtacctcttag
GAGCAGTACATTTTCATCCATGATGCCTTGTTGGAAGCCATTCTTGGAAAGGAGACTGAA
GTATCTTCAAATCAGCTGCACAGCTATGTTAACAGCATCCTTATACCAGGAGTAGGAGGA
AAGACACGACTGGAAAAGCAATTCAAG
gtagtgctttgaaaaagtttctttggcataaagcaagaaaatgttttaaatgccttgagt
ttgggggttatgtcttctttgcattaatgtatacaccgaaatggattactatttgtactc
cttgtactccttaaatgtgatgaaaaagaaaatacggttttgacctatgtatgaattgtt
EXON 24  94 bp
caatcatgccactgcactccagcctgggcaagagagcaagaccctgtgtcttaaaaggtt
ctttgtggcacagaaatggtcttgtttatcagtaatctgattgggatttttgccaaagca
tcaagcaaatgctatcaattatatctttgaatgaagactaaaatgttttttctttttcag
CTGGTCACACAGTGTAATGCAAAATATGTGGAATGTTTCAGTGCTCAGAAAGAGTGTAAC
AAAGAAAAGAACAGAAACTCTTCAGTTGTGCCAT
gtaagactttaaaacagtttgttagtgatcttttatactggattgtatgttaggtacaga
ggcagccactactctgatgctattgatagcacccttcaattgtactgtacgtggccgtat
ggtagaaggttttgaaaatgtccttttagtaacctcattaatgtatgactttataccagc
EXON 25  77 bp
aaaatttcattttacattctgcctcagctgataacactttagcttgtttaaaaatataga
taagtcttagaaagggaagccaggaggatatgttattcatcaagcaaatctcagaaagag
ctgttggttctgtgtgtataataaggcaaatgtggtgtttttgttttttccatatgatag
CTGAGCGTGCTCGAGTGGGTCTTGCACCATTGCCTGGAATGAAAGGAACAGATTACATTA
ATGCTTCTTATATCATG
gtgagagtcaacagttaattataaataaagtcaactaaactgaaaggtgttaaagagcag
ataccacctgtgtgactgatgtcatttttgaaataatttctcaatgtgtaatatgaaaag
tatagagatttctgtatcttgaaacttttaacaaaagatacctaatcagtgctggtacaa
EXON 26  129 bp
attgtctgcacagtgctagcagaagtacatctaaaaattagccaaatgtaccgaatgcct
ttctcaattattttagtgtagtcaaaacagtgctatcttatttcatgaatatattttact
accacaaagttagaataaaacactcatattcactgattttttttgtcttcccaactgaag
GGCTATTATAGGAGCAATGAATTTATTATAACTCAGCATCCTCTGCCACATACTACGAAA
GATTTCTGGCGAATGATTTGGGATCATAACGCACAGATCATTGTCATGCTGCCAGACAAC
CAGAGCTTG
gtaagtaaagcacatctgctatatattaatgagcccatgaggctacaagcataaattact
ttgatactttgccatagggctatagtatccatatatgctagggagggaatttaaaatttt
taaattctcatcttgaagtctgtggagattcctttcatagtctcacaatactgtccctat
EXON 27  147 bp
ttacaatagaatacaataaccattcaacttggtgtagttcgatgggaacatataactctt
atgaattcagtttaaacgatggcttgagagggatgggaaatgacaaaatccgtatgcaag
aaatagaaaacaaatccttgacagaactgcagaggctttttttttttttggattccaaag
GCAGAAGATGAGTTTGTGTACTGGCCAAGTCGAGAAGAATCCATGAACTGTGAGGCCTTT
ACCGTCACCCTTATCAGCAAAGACAGACTGTGCCTCTCTAATGAAGAACAAATTATCATC
CATGACTTTATCCTTGAAGCTACACAG
gtaacctaaacctcagttcctcactaatagccatacctgggccctggatcatcattctaa
gtaataatgaaataatttaccaccctcaagccaggctcaggcatttgagtaagacttaat
tttaaatatgtacattttccgtttttcttccttcaaatatttgctttttccagctggcta
EXON 28  143 bp
aaaaaaacaaaaaaaaaaaaccttcctggtatttttcttctttccagctgtggtttggtt
aacacaacattgttgagagttacctataacacatggctttctcaggagcaagttctagtc
attagattgtagatatgtgaaataaaggaagggatttgacccatgttgtattggttacag
GATGACTATGTCTTAGAAGTTCGGCACTTTCAGTGTCCCAAATGGCCTAACCCAGATGCC
CCCATAAGTAGTACCTTTGAACTTATCAACGTCATCAAGGAAGAGGCCTTAACAAGGGAT
GGTCCCACCATTGTTCATGATGA
gtatgtatctgtttcttaattttaaaatgtagaccgtttttttgtttaatttcttgttga
aagcagtagaaaaggaagccagaattttaaaacctatcaacaacctcagcttgtgacaac
tccatgttatttctactgtggacatgtacaaagtgttgttgctctgtttacattttaata
EXON 29  136 bp
tctcacctttatgctagcttccaaatccctcccccaccagcatttcattcagtcgtgtct
ttagagtaaatgtcaaaacagtctacttagtttctatgaaaatacatgacagtaatttca
tttcaatatatttggtccctttgtacatctgaaatcgtatcttttttttttctcccccag
GTATGGAGCAGTTTCAGCAGGAATGTTATGTGCCCTTACCACCCTGTCCCAGCAACTGGA
GAATGAAAATGCTGTGGATGTTTTCCAGGTTGCAAAAATGATCAATCTTATGAGGCCTGG
AGTATTCACAGACATT
gtaagtagtttgcttatgtgtaaaacctgtactacatcagttgaaactcagactcacagt
ttagagcagtagttctcaattgggggtgattttgccccccaggggacatttggccatgtc
tggagacttttttgcttgtcacaactgcagatggatggcatctagaggatacaagccaga
EXON 30  862 bp
gtataggtcttgactataataaattcaaatgattttttttttagtttttttagataacat
ttatgctattgctgtttctctagtgtgtttttcacaattaccattttaattggtatttcc
accttatgtgaaatcactaaactgttctttggctcaaactgtcttcctcttgtttttcag
GAACAATACCAGTTCATCTATAAAGCAATGCTTAGCTTGGTCAGCACTAAAGAAAATGGA
AATGGTCCCATGACAGTAGACAAAAATGGTGCTGTTCTTATTGCAGATGAATCAGACCCT
GCTGAGAGCATGGAGTCCCTAGTGTGACTGGAATCCTGAAAGGGCACTTAATTTGTAAAC
TTCTGAAGACTGAGAACTTTTTTGAGGCCTTTTTTGCCAGACTCTAGGTTATACAATAAC
CCAGTTACTTTTTTACACTGATAAAAGTTTTGATATTTATTTTTTGCCATTTTATGTCTT
AATGGTATCCTACTGAGCATTTGCACCTCTGTTCATTTCACACAGTGAAACGCAATTTTA
CCTAGTTTGCACTATATGATCAGTGTTACTGCCTATAATCTTATACAACAGCAAACCCTG
ATGTGACATTCCATGACGACATACATGCTACTTTTTTTTAGTTCAATACAGTGAAGGTCT
TTGTTATGACAGTGAATATTGCTTTTATTATTATTATTGCTGAAGTGGTTGCATTCTACT
AGCAGGCAATGCTGTACTTTTCTTCAGTCCTCCTCTCCTTTTTATTTTAGGCACTGTTCA
ATACTGTATGCCTTCTGTATTTTAATGGAGTGGATAGCATTGTTTTCTTTTACAGACTAG
CAGGCTACTGGGACCTAAAAAGGTCTGTTAATGTCATGGCCTTGAAACAGTTCCATTTAT
GCTGGTTAAGAGATCCCTTAAGAAGTTAGAAGGCTTAAGAACTGCTTCATGTGAACATCC
CTTATTAGTTACAAAGTTATATTCACAGTTTTTTAAAAATGTGTCAAAATAAAGGATAAC
TCTGTATTACAGCTTTCACAGT
agctatgtggacaatgtgttatttccattttgactctctaaaatagctacatcctaaaat
cagggctatctttaacaatagcaagatagcaatattatatacaactcagttatgagaccc
tttagttattctccattaatgcttcttagtttgtaataccatacctcacagtaggtagaa