Gene PRKCD Variant 1
DNA : 31.34 KbNT_022517
mRNA : 2662 bp NM_006254
CDS : 2031 bp NP_006245
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  230 bp
gatgcgaagagggccaggcagggcagagggaccgggagactcggtgtcccgcgcaggcag
aggcggagggacgctgtccccgattgcagctggcggggcgaggcctggcagggcgaggcc
tggcgggggcggggcctggcgggggcggggccggcggcacctgggtgaggtcgctcggcc
CCGCCCCCTCGCACTTCCGTGTGCCGCGGCGCCGGAGCCCGAGGCGGCTGTAGCCCACAT
CTCCCGAGCGACCCCCGGCGCCCGCCCGCCGCGCGGAGGCCCGGGCCACACCTCACTGGC
CGCTTGGCCCATCCCAGTCAGCGCCGCGCCGAACCCCGTCCGCGCGCGCCGGGGAGCGGC
GCCCCCGCCGCTGCCGCCGCGACCCTTGGCGCCTGCCCCTGCAACGGGAG
gtaagtgagggccgggtccgggcgcgggatcggggctaccccgagggcgcggcgcccttc
cttcccccttcccgccccagttcccgtttccgaaactgagaaactgagccgcggtcagcg
aaagtcccgccgcgccgagacctgccggtgactccgtccccctgtccgtctgtgtgtccc
EXON 2  112 bp
cccaggaaaagttgggcccaacaccacatttcaaggaagggaaagccacatccagagaga
cccgaggttttaggtccaggagagactgaactgggcccgtcagccatgctgggactggta
gacggggagagcctgtttggcggtgcctcccggctcagctgtttcctcctgttcctacag
GTCTGCAGGGAACTGGCCAGGCAAGGGGGCAGGCCCGTTTCTCCTGGTGGTTGGTGCGTT
GTAGCAGCAGCGGGAGCCAGGACTAAGGACAAGCAGGAGCTGGGAGCCCCAG
gtaggactgagttctcttaggcagatggatggtgcaccggtgtagccttcctctctggcc
tctttgtcctttgctgtggaactggatggggttgggcatgcatgcagagtccttgatctg
gttgtgggccctgtgtgcccaggggccgcagctgtttgccctgtctatgaggggctctct
EXON 3  134 bp
cactgcgcctggcaaacctctcagtttttaacactggcaactgagactagtgtgtgtgtg
catcatgtgggccaaacccaatcatagcagagccctgggggagcgggtccctgagtgctg
cccgtgactgttcccgctggtcccgcccggccgcctggcctcacccctctgtgtgcacag
CCCCACTGCAGGCCCCACCATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCT
GGGCTCCCTGCAGGCCGAGGACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGA
GGCGCTCAGCACAG
gtaggcctggaggctggaccctggagaggggctgggaatctgggcccagctggaaggact
ggagggggcctggccttgttccctgcaacctctgaaggattctgctcttcctcatccttg
actccctgccccactcagctatgaaggcagaggccactgagtcgctatagggctgcaaac
EXON 4  200 bp
tggagggaggacctagcagggtgcccaaggtagttctgtgctctagaggacactggggaa
ccacagcaggccctcaaggcaggagagtcgggcagattctgccaggggaaggccgtggag
gtctacgagggagggacagaggggccatggcccaaccttctctgcctggccttgttgcag
AGCGTGGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGT
TCGATGCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGG
AGCCAGTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACA
ATGGCAAGGCTGAGTTCTGG
gtaaggggcgcacgagccgtgccgtgtgtgtgtgtgtgtgtgtctgtgtgtgtgtgcatg
cgtgcatgtgtgtgcgtgcacacacgcgggcttggtcagtgagcacagctgaagagcacc
gggccctgtgctggccaccagtccagccctgtggccaacatgtcctgggtgtgaatcctg
EXON 5  61 bp
tggggctcaggagtggggctcaggcggggccctgcccacactgggcagacaagtgtctgg
ctaggccttggggggctgccttggccttgggggaccagccatgggggtgggttctgagtt
tggcctggcccaggctgccctcactgaccttgttctcccctggcctctggcccccaacag
CTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTATTTCCTGGAGGACGTG
G
gtaagaactccctgggggtggagggctcccttgccgggttcagaggcagagccagcactg
aggtgtagggaagctgctcccttcggcagagctgtccaggaccaccctgggagggactgt
aggggtgccaccccttccagataccagggctgacttccctactccatggtcaccagattg
EXON 6  163 bp
gtgggtaagaactccctgggggtggagggctcccttgccgggttcagaggcagagccagc
actgaggtgtagggaagctgctcccttcggcagagctgtccaggaccaccctgggaggga
ctgtaggggtgccaccccttccagataccagggctgacttccctactccatggtcaccag
ATTGCAAACAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCG
GAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCT
TTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTTGTCTG
gtgagaaccggccatgcccactggtggtggtgcagggtagtgggggccgatcccggtccc
cgctcactcactttgcctgggttttgcctttcaggggcctcaacaagcaaggctacaaat
gcaggcgtaagtgtctccacaggccagtttgtacgtatgtacccatgtgtgctcacgtgt
EXON 7  32 bp
aaaatccactacatcaagaaccatgagtttatcgccaccttctttgggcaacccaccttc
tgttctgtgtgcaaagactttgtctggtgagaaccggccatgcccactggtggtggtgca
gggtagtgggggccgatcccggtccccgctcactcactttgcctgggttttgcctttcag
GGGCCTCAACAAGCAAGGCTACAAATGCAGGC
gtaagtgtctccacaggccagtttgtacgtatgtacccatgtgtgctcacgtgtgccagt
gcctgtgtgtatgccagtgcctgtgtgcgctcagagagtgtatgcacgtgagttttccca
gtgtagatacagcagctgagttcagtgagtgctggggctggcttgctgctgctctggaaa
EXON 8  86 bp
ctccttcgagggctggcaggaggaagactcaagcgctgggcctctgcggggtgagggtgt
gggcggtcaggagaacggtggctttgtgtagagggctagactggtcggcaggcaccagct
catagactctgcccctcccggtgctttcccttccccctcctgggcctgtgcctcttcaag
AATGTAACGCTGCCATCCACAAGAAATGCATCGACAAGATCATCGGCAGATGCACTGGCA
CCGCGGCCAACAGCCGGGACACTATA
gtgagcctgggtccggggcagggctggggatctggggggcttggccagatgggagggatt
tgcaccctctccccaccctccctggggagcttaccctccctccccatttttcttagtctt
tccttgcctctcccagtggagctctcttgggatgttgttgtgcccagggttgggggagag
EXON 9  130 bp
cctctccccaccctccctggggagcttaccctccctccccatttttcttagtctttcctt
gcctctcccagtggagctctcttgggatgttgttgtgcccagggttgggggagagctagg
ggttgaagaagaggctggagctggcacgtgaccctcagcctgtgatacccccacctccag
TTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATG
AGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTA
AAGTGTGAAG
gtgcgtgccaccccgcccctgggctgcaggaggggcactcccagctggtgctgctgtgaa
ttccagccacctcacgccaccctcgcctcctcacctggagacgggcacctcattcaggga
cctgatgagggtgaggccttggtggaccctccccactggcctgactggctctgccactta
EXON 10  101 bp
gagagagagagagagatcgaagtatttatgatggcttcagatcaatgttttcctagaaac
tggaacccagcagaccccactgaagccctcctttctcttgctctcctgcgcctctcctac
actgccccctgcccttggctgagctctgagactgacagccccgcttctccctcaccccag
ACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGCGGCATCA
ACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAG
gtgggcaggtgccatggggaccctggacacagggcagtggggtcagggacagtcaaggct
tacagccactgctggggagccacagacagccaggatatatttagacccaggactctactt
cgggaagatgcaactcaagaatttaggcagcagagggaggggggctttttttcataagaa
EXON 11  97 bp
tctctgggctcctggaagagtgcgtgtgtgtacacgcagcccgagtagggggcctgggct
gtgcccctgttgtctcctcttggtgttaagggtggagttatacctgggagtcttccttct
gggctgggagttctgataatggtctgaccatctggccccccacctctgctccctccccag
AGAGCCTCCCGGAGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTC
GAGAAGAAGACCGGAGTTGCTGGGGAGGACATGCAAG
gtgaagctgggtccattgccccattacggtttttattccccctgaggccaaagaaagggg
actgtcctcccttccattgtcaagtgagacatggaaggaaccaccggtcctggggagcga
gccccttcctctctgaggccccttcccccagcctaccccaggccccgggggaggggagtt
EXON 12  101 bp
gccaaagaaaggggactgtcctcccttccattgtcaagtgagacatggaaggaaccaccg
gtcctggggagcgagccccttcctctctgaggccccttcccccagcctaccccaggcccc
gggggaggggagttgtgtagactgagaccccgatctgaggaggtgccatctctcgggcag
ACAACAGTGGGACCTACGGCAAGATCTGGGAGGGCAGCAGCAAGTGCAACATCAACAACT
TCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTCGGGAAG
gtgagggctgtgagccgggcacctgcttcccaccccaccctggcttcttcccgcttaggt
ggctgaggtgggagtctgtgaatcgggctgtggcccctgccccgtcctcacctgctcagc
acccgtgtctccccatcaggtgctgcttggagagctgaagggcagaggagagtactttgc
EXON 13  174 bp
tcatcttccacaaggtcctgggcaaaggcagcttcgggaaggtgagggctgtgagccggg
cacctgcttcccaccccaccctggcttcttcccgcttaggtggctgaggtgggagtctgt
gaatcgggctgtggcccctgccccgtcctcacctgctcagcacccgtgtctccccatcag
GTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCAAGGCCCTCAAGAAG
GATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTGCTGACA
CTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAG
gtgcccgggcctcctgccgtcaccaccccatgccacagccatgtcccacagctcctcagc
ccccctcagtcagggctgtgtctccccttcaggccacttaaggcagggccatgctttccc
ccctcatgcctcccagggcagagtcgtccacctcagccagggcctgtccctgctgtttcc
EXON 14  92 bp
ccccttcaggccacttaaggcagggccatgctttcccccctcatgcctcccagggcagag
tcgtccacctcagccagggcctgtccctgctgtttcctgttggggcttggccccagtggc
cctcagtgagggagcctcctgcctattcctcacccctgctcaccacccttcccaccccag
GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
GACAAAGGCCGCTTTGAACTCTACCGTGCCAC
gtacgtaagggccatggtggggaagggcccagtgtggaggaagggctactggctcagagc
ccacttccagtctgccctccatgccttcttccctctccctagaaaagccagcctgggcta
gagcggcaactggggagatgtgggggtagcctgggtcggcaccacacaggaagccatggg
EXON 15  63 bp
ctttctgcctgggctgccagcccccacttgcctgatacaagatgtacttgatcatgctca
ggtggtccatggagttatttgcagcatttcttgctcctggaagtggggttgagggcccga
ggagaagcagaggctgctcggcagagatcccggaacactttatccctctctcttgcccag
GTTTTATGCCGCTGAGATAATGTGTGGACTGCAGTTTCTACACAGCAAGGGCATCATTTA
CAG
gtgcgggggtgagggcagcgggggctcttgggaggggaggctccagccccatcatatctt
ctgaaatgctccaagcaggatccccccaactccagttccttctctgctggaaatcaatct
ttagctgggtatttgcctatgcctcccaccctggtgttagcattcctgtggccaccattt
EXON 16  139 bp
cttgcaagaagcacctgtttttaggatctctttctccttctgcttccttttctgtttctc
attcccttgtacccttggggacagtcctggactaatacggctgaaaattaggacatgggg
ggcagggttggaaggagaagaaatgtcccctgctgactcttacctgtcccctgtccttag
GGACCTCAAACTGGACAATGTGCTGCTGGACCGGGATGGCCACATCAAGATTGCCGACTT
TGGGATGTGCAAAGAGAACATATTCGGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCC
TGACTATATCGCCCCTGAG
gtgagccgatacccttccagccccccgctcagtcaggcaccttgcctccccacggtgggc
cagggaaggattcccaagggcagtgatgtccaagccaaagcccataggctgaggcggcct
ggctaggcttcgtgcccaggggcccctctcagcctcagcacctcagctcctgctgacctg
EXON 17  189 bp
gccccccgctcagtcaggcaccttgcctccccacggtgggccagggaaggattcccaagg
gcagtgatgtccaagccaaagcccataggctgaggcggcctggctaggcttcgtgcccag
gggcccctctcagcctcagcacctcagctcctgctgacctgctgctctccccaccgccag
ATCCTACAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTG
TACGAGATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAG
TCCATCCGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATC
CTGGAGAAG
gtggaggccctgggctgggctgggctggtctgggctgggctggggcaggggctggcagac
actgggctttgggtgaggagcttcctgtctctggaatggcagcctcagtggtgctgcagt
cctaacatacggggtattgctctctcaccatgttcccaggaactcctgtctgagtcctgt
EXON 18  129 bp
catctccgggggagctgggagcactgcaggccagagtggcctccctcagccccaccgttc
cccaggctgactggggctggggcaagcctggctttgcatccctgggcctgctggggattt
gctgaagctccaatttcccatggcccttgggtgctaaccagggtccctgctgggttgcag
CTCTTTGAAAGGGAACCAACCAAGAGGCTGGGAGTGACCGGAAACATCAAAATCCACCCC
TTCTTCAAGACCATAAACTGGACTCTGCTGGAAAAGCGGAGGTTGGAGCCACCTTTCAGG
CCCAAAGTG
gtatgtgatcctgccctgtgctgccttcaggctgagctactcctctcctgccctccctct
ctcctgcatcattcacacgctttccacctctcccttcttccagcaatctccatagcatgt
tcagtcacagccgctgcccttgtattctcatcctctccctcctgactcagtcattcagca
EXON 19  429 bp
cttggggaaatggcagcctccttcccatggggctcctttcaggctgctaggggaggctct
gtcttctgttctgggtgaggacagctctggcctggcccagccctgcagggactccagcct
ggggtgtctggagggccattccctaggtcctgttcgctcacccctgccctctgcttgtag
AAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAGAAGGCGCGCCTC
TCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTCGCTGGCTTCTCC
TTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTGAGGTTCCTGGACAGATCAGGCT
AGCCCTGCCCTCCACCCACACCTGCCCGCTCCCCACGATAAGCACCAGTGGGACTGTGGT
GACTTCTGCTGCTGGCCCCGCCCCTGCCCCCAGAGCGTCCTTGGCTGCCGTCTGGCCGGG
CTCTCATGGTACTTCCTCTGTGAACTGTGTGTGAATCTGCTTTTCCTCTGCCTTCGGAGG
GAAATTGTAAATCCTGTGTTTCATTACTTGAATGTAGTTATCTATTGAAAATATATATTA
TATACATAG
acatatatatatatataataggctgtatatattgctcagtagagaaaaaccatgggggac
tggtgatatgttgatctttttcaaaaaaatatatatatgacaaaaaaaaaaaaaaaggag
cacaagctgtttgaaccaccaggtttatttgtgtgtctaaataaacaccaaatagtacca