Gene PRICKLE2 Variant 1
DNA : 131.59 KbNT_022517
mRNA : 8305 bp XM_093799
CDS : 2535 bp XP_093799
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  546 bp
tccagcaaaggcttccttcccctctccctggcttggggattattgatttggaaggcaagg
ctaatttacatgtaaataaatctcagcactgggcagcaggatgggacgtccagatgccgt
gactgacttgctgacatcacagcttcattagcatgcggaggatgcaagcactgcaacagc
GACTTCTCAGGCACCACCAGCAGCGCCACCGAGAGTTATTATTATTTTTTGACCAAGCAG
CACATTTCCTGGTTCAGTGGCTTGAGCTCTGTGAGCAGCTGACTAGTCACCCCGGGTCTG
GCTCAGGATCAGCTGGTGACGCTGGGCTGGAGTCTATGACTTCTTCCTTCAGATTGTCAT
GAAGAAGGGGAGTTAAGAGGAAACTGGGGGTCCTCCGGAAGGCGATCTGAGCACTCAGGC
TGATCTAGAGGAAGAGTAGAAGTCATACTTTTTTTCTCTTGCTTGGTGAATTCCCCAGCA
GAGTCTGGATCCAGCAGTGCTGTTTTCCCTGAGGGAATGTGGAGCAGCTCGGCTTGAGTC
TGTTGCCAGCTTCAGGAAGGGTTCAGACTGAAAAGGGGGTTTGAGGAGAAGATGCTTTGG
CTGCCTGAGGTCCTGCTTGCGTTCTTAGAAGTCAGATCCAGGGAGAAAGTGAACTGGGAC
AATTGACAAGCTCCAAGGGTCTGGCAGAAGCTTCCTCCGAGACTGGGCATTTCATCCTCC
CTGGAG
gtgggtaagaaatttgctctaattcacaaattaaacagcagtatattttctaaggaggat
gagaaagccagatctagggcctttgcactgggggaggatattgggtcttcgttttcttgg
ccaggtagcatttttggtggccctgcgaccccttttgccttttctatgctgattagaaag
EXON 2  184 bp
gtaccacgccctctgcaaagacagtcatgttctggaacactgctcgcgatgcctttgccc
gatgcccattgccaaggaatgtgtttatggtttgggatccaggggctagtgactggcagg
ctcttggaaaaaaaaaaaggttttttcctctttctcaccttctacctttactgcctgcag
GAAGATCTGCCTGCACTGCAAGTGTCCCCAGGAGGAGCACATGGTGACAGTGATGCCGCT
GGAGATGGAGAAGACCATCAGCAAACTCATGTTTGACTTTCAGAGGAACTCGACCTCAGA
TGATGACTCAGGCTGTGCTTTGGAAGAGTATGCCTGGGTCCCGCCGGGTCTGAAGCCTGA
ACAG
gtaccattctggatgggagcatgctggtggtttgggtgtttcactttgccttactggtcc
ttcctcattccagttctgtaggaagagtagactttgctgattcagagaagtggtagggct
aaatatgttgaagatgccaggggccccagtggaaaatgaggaagggaaatgaaattgagc
EXON 3  114 bp
ttgctttaaggatgaatttctctgcttaccataggaaactcatctgctgttgactttcat
aaagagtcaggactgcagaagtcagttacatcctgctgggggaatcatcttcccagtaag
tgggaataggcacatggtttgagtaatgggcaagtcatctatatgctttctgtccttcag
GTACACCAGTACTATAGCTGTCTCCCAGAAGAGAAAGTCCCTTATGTCAACAGTCCTGGA
GAGAAACTGCGAATCAAGCAGCTACTACACCAGCTGCCGCCACATGACAATGAG
gtaaggggctagagggggcttatgcagaattttcttagtgccttctatgaattgttacct
ttttcataatctgccaccaatgaggtagccgaagaagaactctggcaatttattttaggt
tttagcttccttaattagggccaaaataaactggccaacaatttacttctagagagtatt
EXON 4  138 bp
agagactcaccttagtagagactcaccttaaatctctccaaggctgttgtggttaaagtt
caggcgagggctataaaaccaaatgagagtgtatttaacgagaaaactcagagtcatggg
cttcagaaatcttaaggagcaagggtgactttttccatgccattgtctgtgtctattcag
GTTCGATATTGCAACTCCCTGGATGAGGAAGAGAAGAGGGAGCTGAAGCTTTTCAGCAGC
CAGAGGAAACGCGAAAACTTGGGCCGCGGGAATGTCAGGCCTTTCCCAGTCACCATGACA
GGAGCTATTTGTGAACAG
gtaagcatggattcaggggagtgaagaggcattgttctggcatcttttcacccattcatt
catccaacaattgttttactgagtgcctactatgtgcctgagatacagtagtgaacaaaa
gacgggaaagtttcatcttgcccttctaaggagttggattctaggggaggaagtcagaca
EXON 5  204 bp
ggagagttcagggaggacaagaaaaacctgccctgctgcctgtgtaaagcaggaagcata
gtgactgctttgaacataagcactcagtagccagctaatggtggttgtcctttatcattt
atgcacagcactgggagatgggggctagtgtgactactgatgtttctgtttgcctcacag
TGCGGAGGCCAGATCAATGGTGGAGACATCGCTGTGTTTGCGTCACGCGCTGGCCACGGC
GTTTGCTGGCACCCGCCGTGCTTCGTATGCACTGTCTGCAATGAGCTCCTGGTGGATCTG
ATCTACTTTTACCAAGATGGGAAGATATACTGTGGCAGGCACCATGCTGAGTGCCTGAAG
CCGCGCTGTGCTGCCTGCGATGAG
gttagagcaaactccagcaggtttacctgcccatcaccccttcattgcaccatagccaac
acatggtcttctggctttctgcactgaagaaagccataggcaacttcattttcttgcatt
aacccttttgggagagaagccccacccatccctggtttctagaatgtctggggttgcggc
EXON 6  187 bp
tccatgtataggaactgatatacatacagaataaacatatccatatggatttttgtttaa
ttatttgtgagtaggatctgctttcttacccttctagttcaaggaccccatagctttctt
cctttaaaatatgttctggatgggttttacacactgaccatttggcttccccatctccag
ATCATCTTTGCAGATGAATGCACAGAAGCTGAGGGGCGACACTGGCACATGAAACACTTT
TGCTGCTTCGAGTGTGAGACAGTGCTGGGCGGCCAGCGCTACATCATGAAGGAGGGAAGA
CCCTACTGTTGCCACTGCTTCGAGTCCTTGTATGCAGAATATTGTGACACCTGTGCCCAA
CATATAG
gtgaggcaatatttggcagtcagcttggtccttctgtgatgcggtcacctttgttttggg
tgtagttaaagtatctttgattgcaagtgttagaaacccaactcatgctaacttaactga
aaaagggaatttcttgattcatgacactagaaaggccaagaagtatactagcttcagata
EXON 7  873 bp
caaggacttctcgtaataggacgtgaataccatttacataagggtctgattgttgattta
ttgacagtttatcctgccgcacctggaatcctgagacaaaccaaggtgctatgtgtttca
cgtcccagtgcagagctctgagcagctcatcagcctctccaatgtctctcatttttttag
GTATCGACCAAGGTCAAATGACCTATGATGGCCAACACTGGCATGCCACTGAGACCTGTT
TCTGCTGTGCTCACTGCAAGAAATCCCTCCTGGGGCGGCCATTCCTCCCGAAGCAGGGCC
AGATATTCTGCTCACGGGCCTGCAGTGCTGGGGAAGACCCCAATGGTTCTGACTCCTCTG
ATTCCGCCTTCCAGAACGCCAGGGCCAAGGAGTCCCGGCGCAGTGCCAAAATTGGCAAGA
ACAAGGGCAAGACGGAGGAGCCCATGCTGAACCAGCACAGCCAGCTGCAAGTGAGTTCTA
ACCGGCTGTCAGCCGACGTAGACCCCCTGTCACTGCAGATGGACATGCTCAGCCTGTCCA
GCCAGACACCCAGCCTCAACCGGGACCCCATCTGGAGGAGCCGGGAAGAGCCCTACCATT
ATGGGAACAAGATGGAGCAGAACCAGACCCAGAGCCCTCTGCAGCTCCTCAGCCAGTGCA
ACATCAGAACTTCCTACAGTCCAGGAGGGCAAGGGGCTGGGGCCCAGCCCGAAATGTGGG
GCAAGCACTTCAGCAACCCCAAAAGGAGCTCGTCACTGGCCATGACAGGACATGCTGGCA
GCTTCATCAAGGAATGCCGAGAAGACTATTACCCGGGGAGGCTGAGATCTCAGGAGAGCT
ACAGTGATATGTCTAGTCAGAGTTTCAGTGAGACCCGAGGCAGCATCCAAGTCCCCAAAT
ATGAGGAGGAAGAGGAAGAGGAAGGGGGCTTGTCCACTCAGCAGTGTCGGACCCGTCATC
CCATCAGTTCCCTGAAATACACAGAGGACATGACGCCCACAGAGCAGACCCCTCGGGGCT
CCATGGAATCCCTGGCCCTGTCTAATGCAACAG
gtaggttctgttcaccttgaaaacagatagaaagggggtagtctctgggtgactggatgc
tggtccccaggaattttttttttttttgaaatggagtctcgctctgtcccccaggctgga
gtgcagtggcacgatctccgctcactgcaagctccacctcccgggttcacgccattctcc
EXON 8  6059 bp
gacctactgtggagtggagagaaccccctcacaggcacatgtgccccctgagagggcctt
tgtgcagtacacaacttcacaacggtatataatgaccctagatagatgaccagcagtgac
agtgatacccattgctgcacatctgtattaatctctgtggtcccctcctctcttccccag
GCCTCTCTGCTGATGGTGGTGCCAAGCGCCAGGAGCACCTATCCCGATTTTCCATGCCTG
ACCTCAGCAAAGACTCTGGAATGAATGTGTCTGAGAAGCTGAGCAACATGGGCACTCTTA
ACTCGTCCATGCAGTTCCGGAGCGCAGAGTCAGTTCGCAGCCTGCTCTCTGCCCAGCAGT
ACCAGGAGATGGAGGGAAACCTCCACCAGCTCAGCAACCCCATTGGCTACAGAGACCTGC
AGTCCCACGGAAGGATGCATCAGAGCTTTGATTTTGATGGAGGGATGGCGGGCAGCAAGC
TGCCAGGGCAGGAGGGCGTGAGGATCCAGCCCATGAGTGAACGCACCCGGAGAAGAGCTA
CTTCACGCGACGACAACCGCCGTTTCCGACCTCACAGGTCCAGGCGTTCCCGACGCTCTC
GCTCCGACAACGCCCTCCACCTGGCCAGCGAACGCGAGGCCATCTCCCGGTTAAAAGATA
GGCCCCCTCTGAGAGCCAGGGAGGACTATGACCAATTTATGCGCCAGCGGAGCTTCCAGG
AGAGCATGGGGCATGGGTCCCGGAGGGACCTGTACGGCCAGTGCCCTAGGACTGTGTCGG
ACCTGGCTTTGCAGAATGCCTTTGGGGACCGCTGGGGACCCTACTTCGCCGAGTATGATT
GGTGTTCCACCTGCTCCTCCTCTTCAGAGTCTGACAACGAGGGCTATTTCCTAGGAGAAC
CCATCCCCCAGCCAGCGCGCCTGCGATACGTCACAAGCGATGAGCTGCTGCACAAATACA
GCTCCTACGGCCTCCCCAAATCTTCCACATTAGGTGGCAGAGGACAGTTGCACAGCAGGA
AAAGACAGAAGAGCAAAAACTGTATCATTTCTTAATATGATTGGGATCAGGGAATGGGAG
AAGATGGGAGCTAAGAATGTAAAGTCAGAAACTTGCACTGTTTTAAATGTTAAAGCGCTT
TTGGGGGTGGCTTATGGGGGAGAAAAGGGAAAATGCTGTCAGTAGATGGAGGCAAGGTTA
CAGGTTGACTCAATAGGTAGTCACAGTTCTTGGCATGTTGAATATTATTTGCACATTTCA
CTTTGGAAACACAGTAGACTCTATCGAGGCCAGGCTTGGTCACTTCCTTCCCATCAGTTC
TGTGTTGAGTTGCCATCTCTCAAGATGGTAAATTGTTTCCTGCTCGCTTTTATCCTCTCT
GGTTCTCTTACTTTTAGGACCCTTTTTTCAGTAAGTAATTTGTTTATTAGCCAGGACCCA
AGACTAAGTTATTTACATGTCCATTGTAAATGCAATGTAAATGAGAGTTCTGATAAAATA
TTTTTGTATTTTGTAATATCAAAGGAATTTCTATATCGTAGGACTCAGTGGGGACTTGCA
TGCACATCCACCATTGTCTCTGAGTAGTATTGAAATGTGGCCCGGTACCACCTTTTTTTT
TTTTTTTTTTTTTTCTATACAAATTTGTTACATGTCAGTGAGACCTTTTTCAAAGGAACA
TATTCAATTTGGCTTTTTGTGGCTGAAAAAACATAACTGTTAGACCCAAAGCATTTTATG
CTCCGTTCCATCTTAAGGAGCCATCCTTAAGTCTGCTCCCACCCTCAGTAGAATTTATTT
TCTACAAAGTGGTAGTAATTTTTTTTTAAATTGCAAATGTAATTTTTGCCAATTAGAGAA
ACCAACCGGTGTCAGTAAAATTCTGTGAGAAATGCCATCCCTGCTGGGAATGTTGAAGTT
ACTTAATGTTGATCTATCCCTTGGGGAAAGTAAAAGTGACTGTGAGTGGTGCCATTGTGT
GATGTCAGCATGACGTTGTTTTGAATGTGGCATTATGTTCTGGTGCTCATGTTTCCTGGA
TTGTATTATCTGCTTTCCTTTACCAAGGCAGACAGAACTGCTGCCTTAGCCTGACAACCG
GTTGTCCTCAAAGCAAATGAACTTAAGCATTTGGGATTGAGGGACAGAAGGATTCTGAGG
GGGCTCTGCGAGGGACGGTGTGTGACATGTCATGCCTGGAGAAGGAACAAGGCTATTTGA
AAACAGAAGGCAGGTCAAGGGTAGAAGTTAAAGGAGAATCTGAAGGCAGGTCAGGGAAAA
GAAGAACTGGAAATGAAACAGAGGACAGGTGACAACCACCTCGAAGAGCTCCCAGAGATT
GTAGAAAGAGTCCAGTGTAACCAGCTTAGTAACCAGAGTATCTGGATTACCCAGGAAGGT
TGAGCTGCTGAGATTTCAGTGGTGCAATGTCTTTAAAAAAACAGGCTTTGTTGGGAGGGT
ATTTCCATTTTGAACTTTGAGGACTGTTGGTCAGAAAATGGGCTCAAAAGTGAGTTTGCT
TAATGAAGACATTTAACGGTTGTGCTGTTTATAGTAAAATAAAACTCCCTACCTTGCTTC
AGTTAAAAATGAAGCACTTGGTTTCTTCCATCCTCCTCCTCCCCTTAATGGATTGTGGCA
GTTGAAATAATCCATCGGATGACCCACCTGTAGTGAGATGTACTGTCGATGTAGTGCCCG
GTGTATCTCAGTGGCCATCTGCCATGGTGAGGTGAGCGTGATCTCTTTTCAGTATAGTAG
TTAACATTTTCTAGTATTTTTTATGGAGAGAATGTCAAAAGTGGCATTTCAGACCCCGTC
CCAGATGGGTCTGAGGAAAGGAAGGCTGTAAAGGACATGGTAATGGCACTCCATTCGGGA
TGTATTAAAATAATTTGCTTTTCAGGTATTAATATGACATTTGTCATTGTCACTGATTTT
TTTAAAAAAGCAATGCACATGTTGGTTGTGGCTGTTTTCCGCATGCTATCTTCATATCTA
AATGCTTCATTAATTATCCGAGCCTCCGGAGAATTAACTCTATTACGTTTGTATAGTAAG
TTTGTAAACTGCTTGGCAAACTGATTAAGAAATAATTTGCAATACCGTGCTACTAAAGTG
GCAGGTTTCTGGTAGAAATTGTGCGAGTCCAATTTGGAGTTTTAAGTTCCTTGATTGATG
AAACTAAAAAGGCAATTTTGGAAAAAGAGAGGGGGAAAAGTAGATCACTTATCTTAGCAA
ACGGTTGAAAATATGTCTGTCCTCTGTGGCCCCAAATCCAGTGAAAGAAATTCTCCCAGT
AAAAGTTGCTTCCTAACTCTGTTTTTCTCAGAATACCTCTTACCTTTCTCAAAGAAAGCT
TCAACCACCATCATCAGAAAGAAGGTGGCCTAAAAACTGACACATGGCCAGTGCCCGGAG
GGGTCTGGAGGCATAAGTCTAGATGCCCAGAGAGCATCCAGGCACTGAACTGCTCAGAGC
TTGAGATGAAATGACATACAAGCTTCAGGGTAAAACTGTCTACTAGCAAGATTACCTCCC
TCAATTCTACCATTGCAGATTTCTTCTGACCCCAAATGCAACCTTACAGAGAATGCTGAA
TGAGGAAGGCCAATTCCTTACAATGATGGCAGAACCCCCAAGCGAATGCCCTATTGAGGA
GAAGGACATCACTGTATTTGGAATTCTGCCTGCTAGTGATAGCTCACACATCACATCCCA
GAATCCCACTCCCAATGCATTATTTCCTGAGGCAAGAACTTAAGGTCCTCACCTAATTCC
TCCATCACAACCATTAACTCTTATTGGACAAGCTCCTCCTGTGAGTAGGGCCTGTACTCA
CTTCCTCTTAGATCATAATTCCATCTTCAAGAGACTGATTTCCAGAATAGTAATCTTTTT
CCAGCGTTCTCTCTTCTCCAATGCCCTGGTTGTTATTTTTCCCACCTCTCCTAATATTGA
TCTTCTTGTCTTTTGGTTAGAACTGCAACTTCGGAGTTGAGTTCATTTCCTATTGCTGCT
CAATTCAGTAGCAACATAGCTGGCTTGTTCCCAGACCCAGGAAGTATAAGTCATTGACAG
TTTCCTGAGTGGCTCTGCCAATCCATACCACCCTTGGTACTGTGAAAAGGCTTCTTGGCA
GCCAGGTGGCATTGAGGATGGTATTCAGGGCGCTTTCCTTCTGTCATATAGTTGTGGGAT
CTCTACCAAGTGTGAAGGTGAATGAGGTAAGGGAGATCAGAACCATGCTTCCTGGTTTTT
CATACATCCAAGGAAGAAGTCCTGGTGTGGGTTGTTTGACACCTTCTTTCCACTTTCACC
TTTTATTTTTTATTCCTTCCTTTCTACCCCCAACCAGTCGAGCAAATGAGCAATTTTGTG
TTTCTAATACAGGATCTGGAAGTAGTGCTTTCTAATCCTCATTTCCTGTAGGATGTTCCT
GCACTATAACAAGATTATGTTTTCTTCCTTCTGCAGCAGCTTTCTGCTTCTTGGGTACTA
CTAGCTATTGTTCAATTCAGGTGAGGCCTGTGATGACATATATGTAGCATGTGCTCTGCG
CTCCCTGCAAGCTGAGCAGATACAACCAATGCATCACTGTATACTCTTGCTGAGAATGTG
GATGCAGCCTCACAGATCTTTGCAACACTCCAACCAGCCAGGACCAGTTGATCAGAACTG
ATCTTATTGGTCTGATAACCAATCTTATTTGTGAACTGATTCATATCTGTCTTTCCACTC
TTGGTTCTCTTGCCGTAGAACAAAAACAGTTTAGGAAGCATAATTACGAACATTTAGGAA
CCAATATGTATAAGTAATTCGGAGACTCCAATTCACCTGCCCCTCCCCCATCCCAGGTTG
TGGAGGCTCGAGGAAGCTGACTTCTTAGGCTAAAGGACAAAAAAATCTCTTTACCTCCTT
GGCCATTTTCATGTTCTCTGCCAATTACTATAGGCAGTCTTCATTTTGCAGAGGTGAGGT
AAGACTTCATCTTATTCTTCATGTAATCCCACCTTCTAACAAAAAATAAATAAATATTTA
AATTCCAAGGAGAAGTGTTCTTTGTGTATTTCTAGCAGAAAACAGATGCTTAAGCCTAAG
AAGGAAGATCCGTCCATGACAAAGGAAAGTGGAAAACTGAACCAGTTATCTGAATACTTC
ATGCCAGGACAGTTGCTATTAGCAACTGTTTTGCACCTTCAGGGCTTTAAAATGGGCTCT
GCAGACAGCATTTGCATATGCAAGACTCAGTAGCCAAGCCTCCACTGCCAATTGTTGAAG
GCAGTTTCAGATCGCCACCTTTTGAGGTACATTTCTTTAAGCACAAGAGAAGTAGAAATG
GCCTTTGCCTTGTCTCCAGTGGTTTGTCCCTCTGGTGCCTCAGCAGATACCAGAGCTTAT
TCTTATGACCATTTGGAAGTAGTCCTCAAAGTAAAGATCAAGAAAAAATTGGATTCTTTT
TCCATTTTCTCATAATAGTAGCCTAGTCAACACAAGACTCCCATAAAATATGACTCACTA
TTGGGAGCCATACTATTTTATAAGCTTACTTCCTGCTGACAAAACTAGCTTTCCTCAAGG
AAATATAAAGGAGGGGAAAGTCACATAGTGTTAGGAAAACATTCCTGTGTTTTGAATACG
ATGAATCCATAGGATAGAGAAAAATCTGCTTGTTCTATTCTGAGAGTTCTCTGAGATATC
CCTTCACTCTGCTTGGCATTTGGCCATTGATATTCAACAGGTCACTGACCAAGCTTTTCT
AAATTTTTCAGAGAGAGTTACTTACCAGTAAGGTCTGTTCTTAAACCTACCTAGTTGATT
TTCATATCTTTCCATAAAGTGTCATGATTCTGTCATAGACCCTGACTTAACATTGTAAGG
ACTATGAGTCCTCCATTTTTTAATTAATTTTTTTTTAGCAAATTAGGACTTCGGCAGGTT
TTCCTCTCCTAAACTCATTCTTTCCTCCACAGGATTGCTTTGTCCATCTCCTGCTTTCAT
TTCAAGTGCATAAACAAAACCTCAAAGGGCCTGGGAAGGTGAGGCAGGCCAGAGTCTGTG
TTCTGTGTTGAGTGTCAAGCTATTTGTTAAGAAGGTCTGCAACAGGCCTTTGGTGTGGGC
TCTGCCAGAGACTGTTCTGAACACTTTGCTTGAGATCCGTGCCCTGTAAAATGGATATGA
TGTTTTACTGATGTCTGTAATACATTTGTAAACTTCCAATAAAATTTGAATAAAAGAAA
tgttgccattcttctcagccctccctcactttccagattttaggggtggtctctgccttt
gagcatttcaacaaagaaaagaaaggacacaggtatggagggatgagttttactatgaaa
tattaacctgattgtttaaatcagggtttctaagcctcagcaatattgacgtcttgtgct