Gene PLXND1 Variant 1
DNA : 51.64 KbNT_005612
mRNA : 7093 bp NM_015103
CDS : 5777 bp NP_055918
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1490 bp
cggcggctacggggagggaccctggggccgcgggcgggtcctggagggcgcgggcggcgg
gacccgcggacggcggggcgtggcccagggcggccaggggcaggcgggggtcccgggggc
gggcggggccggggcggggagtgagggcgtgtccgcagcggagccgcccccgccccgccc
CCGGGCTGCGCGGCGAGGCTGACCCGGGCCCGGGCGCCGGGGTCGGGGGCGGCTGGCGCG
GGCAGGAAGCGCATCGCGGCCCGGGCCCGCCCCCCGCCTCCCGCCGCCTCCGGGCTCCCG
GCTCCCGGCCGCGCCTCGCCCCATGCACTCGCCGCGCCGCGCAGCCCGCGCACGCCCGGA
TGGCTCCTCGCGCCGCGGGCGGCGCACCCCTTAGCGCCCGGGCCGCCGCCGCCAGCCCCC
CGCCGTTCCAGACGCCGCCGCGGTGCCCGGTGCCGCTGCTGTTGCTGCTGCTCCTGGGGG
CGGCGCGGGCCGGCGCCCTGGAGATCCAGCGTCGGTTCCCCTCGCCCACGCCCACCAACA
ACTTCGCCCTGGACGGCGCGGCGGGGACCGTGTACCTGGCGGCCGTCAACCGCCTCTATC
AGCTGTCGGGCGCCAACCTGAGCCTGGAGGCCGAGGCGGCCGTGGGCCCGGTGCCCGACA
GCCCGCTGTGTCACGCTCCGCAGCTGCCGCAGGCCTCGTGCGAGCACCCGCGGCGCCTCA
CGGACAACTACAACAAGATCCTGCAGCTGGACCCCGGCCAGGGCCTGGTAGTCGTGTGCG
GGTCCATCTACCAGGGCTTCTGCCAGCTGCGGCGCCGGGGCAACATCTCGGCCGTGGCCG
TGCGCTTCCCGCCCGCCGCGCCGCCCGCCGAGCCCGTCACGGTGTTCCCCAGCATGCTGA
ACGTGGCGGCCAACCACCCGAACGCGTCCACCGTGGGGCTAGTTCTGCCTCCCGCCGCGG
GCGCGGGGGGCAGCCGCCTGCTCGTGGGCGCCACGTACACCGGTTACGGCAGCTCCTTCT
TCCCGCGCAACCGCAGCCTGGAGGACCACCGCTTCGAGAACACGCCCGAGATCGCCATCC
GCTCCCTGGACACGCGCGGCGACCTGGCCAAGCTCTTCACCTTCGACCTCAACCCCTCCG
ACGACAACATCCTCAAGATCAAGCAGGGCGCCAAGGAGCAGCACAAGCTGGGCTTCGTGA
GCGCCTTCCTGCACCCGTCCGACCCGCCGCCGGGTGCACAGTCCTACGCGTACCTGGCGC
TCAACAGCGAGGCGCGCGCGGGCGACAAGGAGAGCCAGGCGCGGAGCCTGCTGGCGCGCA
TCTGCCTGCCCCACGGCGCCGGCGGCGACGCCAAGAAGCTCACCGAGTCCTACATCCAGT
TGGGCTTGCAGTGCGCGGGCGGCGCGGGCCGCGGCGACCTCTACAGCCGCCTGGTGTCGG
TCTTCCCAGCCCGGGAGCGGCTCTTTGCTGTCTTCGAGCGGCCCCAGGGGTCCCCCGCGG
CCCGCGCTGCTCCGGCCGCACTCTGCGCCTTCCGCTTCGCCGACGTGCGAGCCGCCATCC
GAGCTGCGCGCACCGCCTGCTTCGTGGAACCGGCGCCCGACGTGGTGGCGGTGCTCGACA
GCGTGGTGCAGGGCACGGGACCGGCCTGTGAGCGCAAGCTCAACATCCAG
gtacacccgggcggtggcggcggcggcggcggcggcggcggcgggggcgggggcgggggc
gggcgggaaccgagcgggtcgtgagctgagtgggtcacaggtgggagcgcgcagagatcc
agatgtacgtggaacccaggtgtgcacgcgagaatacaggtgtcccccgaggggtactac
EXON 2  177 bp
aggcctgggcttggggatggggtcccgtttgtgtttgggcctcagctgagcactgaggat
ataaagtaggaacaagacttgaaagctctgatgccagggcctgagatcccagccagctgt
gcgggcggggagccggagaaggttctggagctgggatctgacgtgccgttcctcttccag
CTCCAGCCAGAGCAGCTGGACTGTGGAGCTGCTCACCTGCAGCACCCGCTGTCCATCCTG
CAGCCCCTGAAGGCCACGCCCGTGTTCCGCGCCCCGGGCCTCACCTCCGTGGCCGTGGCC
AGCGTCAACAACTACACAGCGGTCTTCCTGGGCACGGTCAACGGGAGGCTTCTCAAG
gtaggtatggttggggatgtggggagggggtgggggtgggaggctcccctgggagttggc
tgagggggtcagtctgtacacagggctgctacaggtccagcctgaccctttgttttctcc
cattcgcctagcactttacagtttacaaagtattttgcaagtctgtttttgccactattg
EXON 3  132 bp
ggcagaagcatcaaggcccggccctgtgccctcccctgcacgcccgtgacttcccacccc
tcctgaagggtccaagacaggatggggaggcagagcccccagacccgggctcaggttgtc
ccctgggtttggcctcccctgctatgggctccagcaccctgatgcccactacccccacag
ATCAACCTGAACGAGAGCATGCAGGTGGTGAGCAGGCGGGTGGTGACTGTGGCCTATGGG
GAGCCCGTGCACCATGTCATGCAGTTTGACCCAGCAGACTCCGGTTACCTTTACCTGATG
ACGTCCCACCAG
gtgaggccagagccccagcccaacgccatcccagcaccagccgagccctcttgcttgcct
ggcctttacacacgctgttcctctgctgggagcaccctcctcctccatctcccttatctg
ctaactccaccttgtcctgcgcctcccaacaccgaccttgcctctgcagggaagccttgt
EXON 4  101 bp
cctgcgcctcccaacaccgaccttgcctctgcagggaagccttgtctcccatgttccccc
attagagtgttgaccctcagtttccccagcctctcatggcccgcaccatgctgaccgtac
cacctccccaagggagaggctggcagtcccattgagctgggcccccacctctgcccccag
ATGGCCAGGGTGAAGGTCGCCGCCTGCAACGTGCACTCCACCTGTGGGGACTGCGTGGGT
GCGGCGGACGCCTACTGCGGCTGGTGTGCCCTGGAGACGCG
gtgaggctggacaccagcaacagctggaccaggagggctgtgggggtgggaggagctgac
ctgggtcctgaccctgcggtgccaccccaggtgcaccttgcagcaggactgcaccaattc
cagccagcagcatttctggaccagtgccagcgagggccccagccgctgtcctgccatgac
EXON 5  130 bp
gaaggtcgccgcctgcaacgtgcactccacctgtggggactgcgtgggtgcggcggacgc
ctactgcggctggtgtgccctggagacgcggtgaggctggacaccagcaacagctggacc
aggagggctgtgggggtgggaggagctgacctgggtcctgaccctgcggtgccaccccag
GTGCACCTTGCAGCAGGACTGCACCAATTCCAGCCAGCAGCATTTCTGGACCAGTGCCAG
CGAGGGCCCCAGCCGCTGTCCTGCCATGACCGTCCTGCCTTCCGAGATCGATGTGCGCCA
GGAGTACCCA
gtgagtcctgggggaggcaagacccagctcgggacacaggggagcctcccttcacccagc
acccaggccccgagaggtggagactcccacccatggtgccccaaggacctgaagacaaat
aatgagaacagtgacaatgactgggctttcctgaccaactagtaagtgccaggcacgtgc
EXON 6  178 bp
aactgaggctcagagggtcacatgtagggcatagccctctggccctgagtcctggccacc
actaccccttcccccaggggacattcaggcagtgccagaccttgggttggtgcacagccc
tggggcaggctgtgaggagcatagcctggacccccagagctgagggctccttgcccccag
GGCATGATCCTGCAGATCTCGGGCAGCCTGCCCAGCCTCAGTGGCATGGAGATGGCCTGT
GACTATGGGAACAACATCCGCACTGTGGCTCGGGTCCCAGGCCCTGCCTTTGGTCACCAG
ATTGCCTACTGCAACCTCCTGCCGAGGGACCAGTTTCCGCCCTTCCCCCCCAACCAGG
gtaagcacgctgtgctgttggcacagccccagaggggcagaacggtggactgtcaggcat
ggggatggcagggggccagaggtcacagcttctgatgttggtggcaatcccctgccccca
tgtcctcccctggctcccccatccattccagaccacgtgactgttgagatgtctgtgagg
EXON 7  109 bp
ccagtttccgcccttcccccccaaccagggtaagcacgctgtgctgttggcacagcccca
gaggggcagaacggtggactgtcaggcatggggatggcagggggccagaggtcacagctt
ctgatgttggtggcaatcccctgcccccatgtcctcccctggctcccccatccattccag
ACCACGTGACTGTTGAGATGTCTGTGAGGGTCAATGGGCGGAACATCGTCAAGGCCAATT
TCACCATCTACGACTGCAGCCGCACTGCACAAGTGTACCCCCACACAGC
gtgagtggcttgggtggcttgcctccagttggtggagggaggaacgcatccccgggaagg
gtctttgctttcagggggccctgagaagaaaaatcatagcatcgtagaggtagacaggcc
cttcagttgttcattcaccagcacatttattcattctacaataaatgcatactgcctgat
EXON 8  103 bp
ttgtatacctcttgttagcaggcagctcactaccttaaagacccaatctttcccaggcag
ccccgatgatgagaaagacctttccctgtgctgggatctgccttttgggttctagttcct
gggacagggatgagttgaggggtggggaaccaggagttgaggggcctccttgtcttccag
CTGTACCAGCTGCCTGTCGGCACAGTGGCCCTGTTTCTGGTGCAGCCAGCAGCACTCCTG
TGTTTCCAACCAGTCTCGGTGCGAGGCCTCACCAAACCCCACG
gtaagccaggctagggggcccctccgcctctgctgtttcattaccttttttaaaaaattc
acatgttgagaatgtttcaatgcctttgcatattccgccttagctttggctttgacagct
atatggggctcatcacataccacggtgcgtttaacccatgccctatagttggacatacta
EXON 9  105 bp
ggatggagggtggtggcgagtgggaggcacggggtggggctggtggccgttaggactgaa
tgactagtgttttctcctcaggaaggcaggactgaaccaggcaggctggggtgcagtgag
tcctcctgcctcttctctgaaatgcccctgtgtcaccctctccttctgtttcctctgcag
AGCCCTCAGGACTGCCCCCGGACCCTGCTCTCACCCCTGGCACCCGTGCCTACGGGTGGC
TCCCAGAACATCCTGGTGCCTCTGGCCAACACTGCCTTTTTCCAG
gtaagtagaagccaggccagcgccgggtggggccaggaggaggccggggagcacgcaggc
cactaactgcccccatgtcctggtgtgacccctgctctgggcccactgcagtgctttcgc
acctgtgtgggctttgcttttctttctctgagtttccaccttctgcatgaggaagcccca
EXON 10  90 bp
cattggacgtgatggccaggaaggggattttgggggacgggacagcccatgcaaaggcct
gacagttcgaccaagcccacctttcccagcaggagcccgtggtgtcctgctggagttaga
gggcaatgcatgctggcttggttctcctcaaacccgcctcccactccctgtttcccacag
GGTGCAGCCCTGGAGTGTAGTTTTGGGCTGGAGGAGATCTTCGAGGCTGTGTGGGTGAAT
GAGTCTGTTGTACGCTGTGACCAGGTGGTG
gtgagtggggtgactccagcatgggcggagggcgggcctgcgttaagtccagatgctgta
cccctcaccccaccctgcctctctctaccttctggttcccccatccccagcagccccaac
ttcatctgcctccatgacacccatccccagcagagccccaggcattgcccatgcccccta
EXON 11  94 bp
ggcggagggcgggcctgcgttaagtccagatgctgtacccctcaccccaccctgcctctc
tctaccttctggttcccccatccccagcagccccaacttcatctgcctccatgacaccca
tccccagcagagccccaggcattgcccatgccccctatgctcttttctgcccttttgcag
CTGCACACGACCCGGAAGAGCCAGGTGTTCCCGCTCAGCCTCCAACTAAAGGGGCGGCCA
GCCCGATTCCTGGACAGCCCTGAGCCCATGACAG
gtgggcacccccacccgccccacatggcctcggggcctcagtgcagtgggtggggctcag
ccttgtgcgactcattccagtggttgccccaaagccgcagatgtcccaccccattgttct
ccagcacacacacagcctcatatcccagccctgccatgccatgccaggctccaggccttg
EXON 12  155 bp
tttggggaaggggctaagaacctcaggggatcctgacccccagaatcaggacttcctctg
ggtggggcaccacaatgatggggcgcagacctcttgacagttgttgtgtgtggagggcac
agcggtgttggggcatgcaccgcagagcggggctgaccgagctgccccgtgtctccccag
TCATGGTCTATAACTGTGCCATGGGCAGCCCCGACTGTTCCCAGTGCCTGGGCCGCGAAG
ACCTGGGTCACCTGTGCATGTGGAGTGATGGCTGCCGCCTGCGGGGGCCTCTGCAGCCCA
TGGCTGGCACCTGCCCCGCCCCCGAGATCCACGCG
gtaagcatgcccagtggaggcacgtggcacccgcactccggcacggcgcatgcgcagtgc
cctcgagggtcccacttcttggggacccaaacggcacatacaccgacacatgggtgcagt
atcacctgtgaacaaaaggaagtgctctgcctcacagagctgatgtttcagtgggggagg
EXON 13  152 bp
ccttgccagcacagtgacctgccaagtggccacagtcccagccccacctgagcctccaga
ccttcctctaagcagtgggtctgcacggctgtgccctgctgggtgcctgtgactgtgggc
agaagcctgctggcctgcagcctcagatcccattcgcccctctctcgggtcacctggcag
ATTGAGCCCCTGAGTGGCCCGTTGGACGGTGGGACCCTGCTGACCATCCGAGGAAGGAAC
CTGGGCCGGCGGCTCAGTGACGTGGCCCACGGCGTGTGGATTGGTGGTGTGGCCTGTGAG
CCACTGCCTGACAGATACACGGTGTCGGAGGA
gtgagtagccacggtgcccccacctaccttctccagcagtgccagcctctgctctgtcct
cctcactcctccctccccatcctctgtcctcactctgctgctttctggaagactgttgct
tcgtggcctccaggcctgtgccgaagccattcccaccacacatcctgccgtttctgcttg
EXON 14  100 bp
gacccttttgtcccacccccgtgtcttatagttgcagaactgtgggaaactgatggggta
aattatacatagaaggcattggaagtgtggcatggcgtggaatggggcgatccctgagcc
tggctctagggtggccgtgggggccaaggaccgctggctgaccacagcacctcccctcag
GATCGTGTGTGTCACAGGGCCAGCCCCAGGACCACTCTCAGGTGTGGTGACCGTGAACGC
CTCTAAGGAGGGCAAGTCCCGGGACCGCTTCTCCTACGTG
gtaagggggggctgcagcccactgtccggcccgcccagcacgcacactcccgggggctgg
cccgaggcccaaacgcctgccttcctcccacagctgcccctggtccactccctggagcct
accatgggccccaaggccgggggcaccaggatcaccatccatgggaatgacctccatgta
EXON 15  140 bp
acagggccagccccaggaccactctcaggtgtggtgaccgtgaacgcctctaaggagggc
aagtcccgggaccgcttctcctacgtggtaagggggggctgcagcccactgtccggcccg
cccagcacgcacactcccgggggctggcccgaggcccaaacgcctgccttcctcccacag
CTGCCCCTGGTCCACTCCCTGGAGCCTACCATGGGCCCCAAGGCCGGGGGCACCAGGATC
ACCATCCATGGGAATGACCTCCATGTAGGCTCCGAGCTCCAGGTCCTGGTGAACGACACA
GACCCCTGCACGGAGCTGAT
gtaagcctctgggcctggcccatcccttccagcccagagaaatcaatgggcttgggggct
ggcgggctggaggtgacatccttgagccaagcctctcttgggtcttcattggctgtgtcc
cctaagccaagccccttctcctctctgagcctcagtttcctcagctggtaagaatagtac
EXON 16  168 bp
ggaatttggaagtgtaaggaaacagctgggcactaactgggcagaagatgagttgggacc
agtcaaggaggccttgaaccccaggccaagtgcgtggacttgtgccccaggtctcagggg
cattggcggtgggtgagcagcagaaggcaggccctgctgataacctgctgctccccccag
GCGCACAGATACCAGCATCGCCTGCACCATGCCTGAGGGGGCCCTGCCGGCTCCGGTGCC
TGTGTGTGTGCGCTTCGAGCGTCGGGGCTGCGTGCACGGCAACCTCACCTTCTGGTACAT
GCAGAACCCGGTCATCACGGCCATCAGTCCCCGCCGCAGCCCTGTCAG
gtgagactggcaccccgcccttcccccaggctctctggggctgcaggtgcactgataggt
tttgctgtcccccgcagtggcggcaggaccatcacagtggctggtgagcgtttccacatg
gtgcagaatgtgtccatggccgtccaccacattggccgggagcccacggtgaggcattcg
EXON 17  91 bp
gtgtgcgcttcgagcgtcggggctgcgtgcacggcaacctcaccttctggtacatgcaga
acccggtcatcacggccatcagtccccgccgcagccctgtcaggtgagactggcaccccg
cccttcccccaggctctctggggctgcaggtgcactgataggttttgctgtcccccgcag
TGGCGGCAGGACCATCACAGTGGCTGGTGAGCGTTTCCACATGGTGCAGAATGTGTCCAT
GGCCGTCCACCACATTGGCCGGGAGCCCACG
gtgaggcattcgggggcctgatgggtgggagggggtggcccaggcacagccagggcccta
actgaccaggcctcctcccactgcatctctgtcccctcttcctccctctgcctctgtgtc
tcctcaaaccccactccccaccgtttctccatgcccatctgtccatcctgcatcccggcc
EXON 18  264 bp
tgggagggggtggcccaggcacagccagggccctaactgaccaggcctcctcccactgca
tctctgtcccctcttcctccctctgcctctgtgtctcctcaaaccccactccccaccgtt
tctccatgcccatctgtccatcctgcatcccggcctgggcccctggctctcctgcaccag
CTCTGCAAGGTTCTCAACTCCACCCTCATCACCTGCCCGTCCCCCGGGGCCCTGAGCAAC
GCATCAGCGCCAGTGGACTTCTTCATCAATGGGCGGGCCTACGCAGACGAGGTGGCTGTG
GCTGAGGAGCTACTGGACCCCGAGGAGGCACAGCGGGGCAGCAGGTTCCGCCTGGACTAC
CTCCCCAACCCACAGTTCTCTACGGCCAAGAGGGAGAAGTGGATCAAGCACCACCCCGGG
GAGCCTCTCACCCTCGTTATCCAC
gtgagcaccaaaggggccggggtaggcgggggcaagcgagccagcctcagctgtgggcct
cgggagcacttccccatgagcatcctccccctttgcacccacagaaggagcaggacagcc
tggggctccagagtcacgagtaccgggtcaagataggccaagtaagctgcgacatccaga
EXON 19  150 bp
cccacagttctctacggccaagagggagaagtggatcaagcaccaccccggggagcctct
caccctcgttatccacgtgagcaccaaaggggccggggtaggcgggggcaagcgagccag
cctcagctgtgggcctcgggagcacttccccatgagcatcctccccctttgcacccacag
AAGGAGCAGGACAGCCTGGGGCTCCAGAGTCACGAGTACCGGGTCAAGATAGGCCAAGTA
AGCTGCGACATCCAGATTGTCTCTGACAGAATCATCCACTGCTCGGTCAACGAGTCCCTG
GGCGCGGCCGTGGGGCAGCTGCCCATCACA
gtgagtggatggggcgccggagcagggcagacctggccccacccctggcccatctgccaa
gcatctgcccctcacccagcacctgaattcactgagcgttttcacgctcaacagctcagt
ccagcaaagcagagctttacatccccacttgacatatgaggaaactgaggcccaagaact
EXON 20  115 bp
gccctcatttagccttcccagtgtccccaggaggtggacattgttatctctatgttatca
gtgtggcacctgaggctcagagaggttaggtaatttacccagggccacacagcaagtgag
gagcagaactagagtataagtccaggaaagctacaacccccttccccaacctctgcacag
ATCCAGGTAGGGAACTTCAACCAGACCATCGCCACACTGCAGCTGGGGGGCAGCGAGACG
GCCATCATCGTGTCCATCGTCATCTGCAGCGTCCTGCTGCTGCTCTCCGTGGTGG
gtaaggagccccaccctcaggacaccttggagggcaggcttgccaccttgccccagcccc
tctgaagattggcagatgggagaaggcaggatgggatggggcacagcttgaacaaaggct
tggccatgggaacaggttaggcacccagaggttgggggaggtgtgccctggctccagcac
EXON 21  108 bp
acgggagagctccccgcaactccccaccccccaccccaaccctgcccaggagggaggact
gcagggcctcctcccacaccctgcccagaggagctggagcggaggccagaatacagcagg
cgccaataaaggctttccaaagggcaccagaggcctgacctgcctctccactgcccgcag
CCCTGTTCGTCTTCTGTACCAAGAGCCGACGTGCTGAGCGTTACTGGCAGAAGACGCTGC
TGCAGATGGAGGAGATGGAATCTCAGATCCGAGAGGAAATCCGCAAAG
gtagtgggcggggaccctgcagggctgggcctcaactttccctcctaggggatgggttct
cgggccgctcacggctgtccgtgtgtccgccaggcttcgctgagctgcagacagacatga
cagatctcaccaaggagctgaaccgcagccagggcatccccttcctggagtataagcact
EXON 22  113 bp
agagccgacgtgctgagcgttactggcagaagacgctgctgcagatggaggagatggaat
ctcagatccgagaggaaatccgcaaaggtagtgggcggggaccctgcagggctgggcctc
aactttccctcctaggggatgggttctcgggccgctcacggctgtccgtgtgtccgccag
GCTTCGCTGAGCTGCAGACAGACATGACAGATCTCACCAAGGAGCTGAACCGCAGCCAGG
GCATCCCCTTCCTGGAGTATAAGCACTTCGTGACCCGCACCTTCTTCCCCAAG
gtcagcccgagcctgagcctgccctgaacctgtgccagccacctcaaggcaactcgacct
ctctgagccctgccagcctatagggtcccttgagcagtgccaaacctgcacagctgtccg
cagccgtcctggccacttgccctggcctgccacggggagaagggttggaggcagattctc
EXON 23  105 bp
acccctggaattccacagcccccaggcttggcccactgcctcttagtcctttatggggag
ctaattccgtgccagtttcccccagcagcccaagccagtgcccctttctgtgtgagtgac
ctttccatgccagcagggggtgtccagccccgctgagatgctgggggtctgcctctgcag
TGTTCCTCCCTTTATGAAGAGCGTTACGTGCTGCCCTCCCAGACCCTCAACTCCCAGGGC
AGCTCCCAGGCACAGGAAACCCACCCACTGCTGGGAGAGTGGAAG
gtgagtaccccacgacccacacacagtgggctgcttcagggcaaccctgctcccccctgg
gtcccctttccagttcatctaatgcattgatccctgtcatgcggagttgggaggcatctg
ccattgtaaggtactgagccctccatcccaggaggcattcaggcagccattcagggtatt
EXON 24  131 bp
ccacttttcaattcaaccaagctattgttccctgtcacaaaggttaggaggcatccaccg
tggaaggtaatgagctccccatcccaggaggcatacaagcagccgtcgtaagcactggct
gttaggctaggcagggacactgggcccctctggacaccccatcaccagttgcttccacag
ATTCCTGAGAGCTGCCGGCCCAACATGGAAGAGGGAATTAGCTTGTTCTCCTCACTACTC
AACAACAAGCACTTCCTCATCGTCTTTGTCCACGCGCTGGAGCAGCAGAAGGACTTTGCG
GTGCGCGACAG
gtcaggctgtgacagactggggtggggtagggaagaggagcctgtccaaggccacacagc
atcaggtcctgggtcctggggctctggggctcttgacacccccatattccagcccttcct
gggccgggatgcccaagaccttggctcacggggcacgatggttgctgtggacgtagaaga
EXON 25  199 bp
ggacgtagaagaaggtggctgtttctccaggaggattctagccccactcacccctcgcag
gacccacccacacaggcactcctgggatcgatgggcccggggatgaggcggcactgagac
cctgggacccacagctcctagggcctcaaggtgcagttgacacctgcctcccgctcacag
GTGCAGCCTGGCCTCGCTGCTGACCATCGCGCTGCACGGCAAGCTGGAGTACTACACCAG
CATCATGAAGGAGCTGCTGGTGGACCTCATTGACGCCTCGGCCGCCAAGAACCCCAAGCT
CATGCTGCGGCGCACAGAGTCTGTGGTGGAGAAGATGCTCACCAACTGGATGTCCATCTG
CATGTACAGCTGTCTGCGG
gtgaggctgcctggggacagacagagcccaggcgggggacgtggcagggactcagcggca
gtgaccccacggcctcccaggccttccctggcaccctcaggccagctctgccaggaggga
gtgttgcatgagacaggccaggcccgtaggacctgttatgcagagaggggagccatggcc
EXON 26  147 bp
tgtttaatgaacacgagcttagggtccgtggagacaccctggagaggagagtgttgacac
caggatccaaaaggagactgttggaggggttgggggacgggggcgtgaaggtgtttggcc
caaagcatgggggctggaatacagagggggccttggccctgatacccccgtgcccctcag
GAGACGGTGGGGGAGCCATTCTTCCTGCTGCTGTGTGCCATCAAGCAGCAAATCAACAAG
GGCTCCATCGACGCCATCACAGGCAAGGCCCGCTACACACTCAGTGAGGAGTGGCTGCTG
CGGGAGAACATCGAGGCCAAGCCCCGG
gtaagtcggcagggcggggagggtcccagggctgctgtgtcgccgccaacggcattgacc
cagccttcctctgcagggccttgctgcctgggcactgacatagtgatggcagcaactcac
tgacctttctctcccactctccccctgcagaacctgaacgtgtccttccagggctgtggc
EXON 27  161 bp
ctgcgggagaacatcgaggccaagccccgggtaagtcggcagggcggggagggtcccagg
gctgctgtgtcgccgccaacggcattgacccagccttcctctgcagggccttgctgcctg
ggcactgacatagtgatggcagcaactcactgacctttctctcccactctccccctgcag
AACCTGAACGTGTCCTTCCAGGGCTGTGGCATGGACTCGCTGAGCGTGCGGGCCATGGAC
ACCGACACGCTGACACAGGTCAAGGAGAAGATCCTGGAGGCCTTCTGCAAGAATGTGCCC
TACTCCCAGTGGCCGCGTGCAGAGGACGTCGACCTTGGTGG
gtgggaatgggggcagagaccccgtgtcaggcgcttcagccggggctggcccctgccttg
acgggaaacactcctttcacctggcatgggtgcatgaatgtggggacactgagaggatcc
aatgaggccccctcagcaagaagctcttactctgtaggagacaagtcctgcagtgtgagt
EXON 28  99 bp
tctttcctgccctccccattttacagatgggaaaatggaggctcagagagaggtatggct
tgcctcagtttacatggagagagcgagaggcctctccctatgtggctgggccggtaccta
cccctcaggcccagctccctgcccggaccctgatggcctgtcccttgtcccccagagtgg
TTCGCCTCCAGCACACAGAGCTACATCCTTCGGGACCTGGACGACACCTCAGTGGTGGAA
GACGGCCGCAAGAAGCTTAACACGCTGGCCCATTACAAG
gtgcagccctgccccccgcccccatttccccaccctcatgcccccaccccaacctccggc
ctctgacctcggcctctcccctcccatcagatccctgaaggtgcctccctggccatgagt
ctcatagacaagaaggacaacacactgggccgaggtagtgcgggtgcacgtgggaaggga
EXON 29  64 bp
agcacacagagctacatccttcgggacctggacgacacctcagtggtggaagacggccgc
aagaagcttaacacgctggcccattacaaggtgcagccctgccccccgcccccatttccc
caccctcatgcccccaccccaacctccggcctctgacctcggcctctcccctcccatcag
ATCCCTGAAGGTGCCTCCCTGGCCATGAGTCTCATAGACAAGAAGGACAACACACTGGGC
CGAG
gtagtgcgggtgcacgtgggaagggagcccaggctgcgtgtggacaggggcttccatccc
atgccccagtggggaagctgaggctccgagaggcagggctggcctgggctgaggcctcct
tggtgggggctgggcggggccagcctcctctgacccagtactgctggggcagggcccaca
EXON 30  35 bp
tgactgtctctttggatctctgtctccgtttctgtttctctctccatctttctgtctctg
cttctgtttctctccccatctttctgtcttgtttctgtttctcactccatctttctgtct
tcatttctgtttctctcctctcctctcccgtgtttatttattgtgtttttcctctcacag
TGAAAGACTTGGACACAGAGAAGTATTTCCATTTG
gtgagtgcccaacctcggccccgggggatccagcccctcagtgggtgtggccttggcttt
ctgtggccctgggcctcttgggaaaagtgctcccagccctgcgaaaggctggggggtggg
ggagtagggatggggcccagaatcaggagggaaccacagcccttgtgtgctaagaagcat
EXON 31  105 bp
ctcttgggaaaagtgctcccagccctgcgaaaggctggggggtgggggagtagggatggg
gcccagaatcaggagggaaccacagcccttgtgtgctaagaagcatggcagagccagacc
tcccacaggcggccgaggatggggcctggtgcggacactgaccactgcccggcctcccag
GTGCTGCCTACGGACGAGCTGGCGGAGCCCAAGAAGTCTCACCGGCAGAGCCATCGCAAG
AAGGTGCTCCCGGAAATCTACCTGACCCGCCTGCTCTCCACCAAG
gtgagtccggcctcagtctcccctctgtgcagtgggtacaaggctccagccccagctcca
gagggtcattgctcagggccagctgtgcacccgcggctgggagaggggtgtgagttcttc
ctgtttcccctgtggggctggaggggcaagaggctgaaggcttagggtcccacttgagga
EXON 32  164 bp
ttagtcctttcaacgcctctgggaggcaagtgagccagagaggctcggtgaccagcctga
tgccatgtggcttcctcattcagcagcctggcatttcaagctccgcagagccaccaaggg
tgcccactagccctctgcacgtggcccggggctgacggcggccaccccactcccccgcag
GGCACGTTGCAGAAGTTTCTGGATGACCTGTTCAAGGCCATTCTGAGTATCCGTGAAGAC
AAGCCCCCACTGGCTGTCAAGTACTTTTTCGACTTCCTGGAGGAGCAGGCTGAGAAGAGG
GGAATCTCCGACCCCGACACCCTACACATCTGGAAGACCAACAG
gtggcgggtgggggggccgtgtggacttcactgtgccactggggcccctgtggcaggggg
ttcagagtctagtcttctggcctcgcctgcttggggtcaagccctcctctgccatttccc
agctgtgtgttctcggatgagtgacttagcctctctgtgcttcagtttcccctccactgt
EXON 33  148 bp
gccccactgcaccccagctggccagggataggcaaactaaggttcccaaaggtcacatct
tgtgacaaggctccaacctcaggcccttgagggacaaagccagctctctcctccacaact
gtccctcgactgcttcctaccccaccctaccctcactgtctttgtcaccctaccccacag
CCTTCCTCTCCGGTTCTGGGTGAACATCCTGAAGAACCCCCAGTTTGTCTTTGACATCGA
CAAGACAGACCACATCGACGCCTGCCTTTCAGTCATCGCGCAGGCCTTCATCGACGCCTG
CTCCATCTCTGACCTGCAGCTGGGCAAG
gtcagctgttcccaggaccaggccaggcccatgcacagggccagagtggggtgccgacca
tgggtagcctcctcgactctctgaggctgagctcagagatcttcctgggaggggaaccaa
aagatctcaggtctaggggatgtgggatgagtgactcattcagacagggagacacctaga
EXON 34  141 bp
gagcccctggtctggggccggctgagtgcggggacgttcagtgaccgggtgagactcttt
gggcctcgggggcctgctaaggtcacttatgtggcaggagggatgagggctcatccagaa
aacgaccagatccgtcctttctccagcagccatctaacaccctcgctcttctctgcccag
GATTCGCCAACCAACAAGCTCCTCTACGCCAAGGAGATTCCTGAGTACCGGAAGATCGTG
CAGCGCTACTACAAGCAGATCCAGGACATGACGCCGCTCAGCGAGCAAGAGATGAATGCC
CATCTGGCCGAGGAGTCGAGG
gtgcggtggctcggcggcgggggatgggggcctgaagagctgagggatcgggggtcgggg
gctgggcctcaatgcctccactggagtaagggcagggagcgcagagggcatttcagaagt
ggctgtggcctcttgctggcctgcaaattcgtcatgcattttcccagagtttgaggagcg
EXON 35  75 bp
agattggacttcagggtccgggaagccgtcttcgtccatgggacttgaggggcctcatcg
ctgaactgttctgtgggggccgtggggagttggggattgtgtgcaagcagctggctttgc
tgggactaggctcagctttgaccgctgggctaacctcctccccatcctgcctccttatag
AAATACCAGAATGAGTTCAACACCAATGTGGCCATGGCAGAGATTTATAAGTACGCCAAG
AGGTATCGGCCGCAG
gtgagtgccccagggtgaggcacctgccctcggggtaggtgagcttcctactcaaggaca
cacatctcagggtgcttgcccctaatggacggatgtcactcgtggtagacgttcaggggt
gtgttctctcccacgaactgaggcagggctaccggccatggcccggctgactccgctgct
EXON 36  1254 bp
cccagggtgaggcacctgccctcggggtaggtgagcttcctactcaaggacacacatctc
agggtgcttgcccctaatggacggatgtcactcgtggtagacgttcaggggtgtgttctc
tcccacgaactgaggcagggctaccggccatggcccggctgactccgctgctcccctcag
ATCATGGCCGCGCTGGAGGCCAACCCCACGGCCCGGAGGACACAACTGCAGCACAAGTTT
GAGCAGGTGGTGGCTTTGATGGAGGACAACATCTACGAGTGCTACAGTGAGGCCTGAGAC
ACATGGAGAGTTGGTCAGGCTGCTGCTGGGAGAAATGGACGCCCACTGGGCCTCAACTTG
ATCTTCTACCCCGTGCCTGTGACTCAGACTGGGAAATACTGAGCAGAGACGGCTGGGGCG
GGGGCAGGAGGAGGGGCTGCTCTCTGAGACAGGGGCGCCCCCGCCTTGACCCCTGGGCAC
CTCCATCCCCTCCCACCTGTCCCCAGATCAGTCTCTGGGATGGAGGCCAGAGAGCTGGTC
AGGCTCCCCCATCTGCCCAGCACGGCCTGCACTGTGCCCACCCACTTGCTCCACAACGTC
CAGTTGGTCCTGCTGCCAAGAGCCCCGTGCATCCAGGCGGCCAAGCACAAACTGGGGGAG
AGGAGGCCGCCAGCCCGGAGGCTGCAGCCCAGAAACTCTACCTCATCCACACTGGTGCAG
GGAGCCCTCCTTGAACTGACCTTTGATTGGTTTCTGCTTCAACTACCAAAATGTTATCTC
CACTTCCCCCTCACCCGTAGAGGATCCTGGCCACAGACAGTTTCAAGTAGTGTCAGATTT
TTGTTGCTTGGGCGGCTGTTGGTAGAGTGGGCAGTGCCCGCGCCATGGGGTGCTCTGTGG
GCTTCTCCAGGAGCAGGGAGGGTGGAGGGGAGGGATGGGGGGCACAGGAGCTGGGAGCCC
CGTCTCCAGGAAAAGGAGAGGGGTTAAGATGCACCGAGGCTGTAGCTGGGCTACTTGATC
TTGCTGAAAGTGTTTCTAAAGATAGCACCACTTTTTTTTTTAAAGCTTTTATATATTAAA
AAACGTATCATGCACCAACTGTGAATAGCTGCCGCTTGCGCAGAGGACCCGGGGAGGGGT
CCCGAGAGGCTCCCCATGCAACACTGGAAATGACTGTTCCAGAGAGCGGGCAGACCTGGC
AGAGCGCCCCTGGCGCCTGAGACTACCACCCACTCCGTTCCTGCCAGAAACGACCCTCTG
TGGCCGATGGGCCATGCGGGCCCCTCGCAGCCAACTCAGCCAGTGTTGGGACTGGCTCAG
AGCCCATGGGGGCTGGAGGGGGGCAGCTGGGACTCTGGAATCTTCTTTATAATAAAAGCC
TTACGGACAAACCTACTGTGGGCTCCAGCCTTTGTCCTGAGATAGCCAAGCGGG
agaatgggcagtttctttaccagtttgtgagagagaggagggagggagcctgccgtccct
cctgtctcagctgcactcttgaggtttgggcagacacctgactagcttctgagaaggcag
tcagaggccaggagatgaaacgagacggtgcaggctgcatgcatgctgtgggcccggccc