Gene PLXNB1 Variant 1
DNA : 20.36 KbNT_022517
mRNA : 6643 bp NM_002673
CDS : 6408 bp NP_002664
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1107 bp
ggtcctggggtcatcctggacatagtgcctatctaagaagcctggtcctcctctgctcac
cccctaggttaggaggagcatcttggcaatgccacagtcctatcccttaccagtggcccc
agggtgctctggcggccacgtgagccccactctctcgacctctcttcctgccaggtgacc
ATGCCTGCTCTGGGCCCAGCTCTTCTCCAGGCTCTCTGGGCCGGGTGGGTCCTCACCCTC
CAGCCCCTTCCACCAACTGCATTCACTCCCAATGGCACGTATCTGCAGCACCTGGCAAGG
GACCCCACCTCAGGCACCCTCTACCTGGGGGCTACCAACTTCCTGTTCCAGCTGAGCCCT
GGGCTGCAGCTGGAGGCCACAGTGTCCACCGGCCCTGTGCTAGACAGCAGGGACTGCCTG
CCACCTGTGATGCCTGATGAGTGCCCCCAGGCCCAGCCTACCAACAACCCGAATCAGCTG
CTCCTGGTGAGCCCAGGGGCCCTGGTGGTATGCGGGAGCGTGCACCAGGGGGTCTGTGAA
CAGCGGCGCCTGGGGCAGCTCGAGCAGCTGCTGCTGCGGCCAGAGCGGCCTGGGGACACA
CAATATGTGGCTGCCAATGATCCTGCGGTCAGCACGGTGGGGCTGGTAGCCCAGGGCTTG
GCAGGGGAGCCCCTCCTGTTTGTGGGGCGAGGATACACCAGCAGGGGTGTGGGGGGTGGC
ATTCCACCCATCACAACCCGGGCCCTGTGGCCGCCCGACCCCCAAGCTGCCTTCTCCTAT
GAGGAGACAGCCAAGCTGGCAGTGGGCCGCCTCTCCGAGTACAGCCACCACTTCGTGAGT
GCCTTTGCACGTGGGGCCAGCGCCTACTTCCTGTTCCTGCGGCGGGACCTGCAGGCTCAG
TCTAGAGCTTTTCGTGCCTATGTATCTCGAGTGTGTCTCCGGGACCAGCACTACTACTCC
TATGTGGAGTTGCCTCTGGCCTGCGAAGGTGGCCGCTACGGGCTGATCCAGGCTGCAGCT
GTGGCCACGTCCAGGGAGGTGGCGCATGGGGAGGTGCTCTTTGCAGCTTTCTCCTCGGCT
GCACCCCCCACTGTGGGCCGGCCCCCATCGGCGGCTGCTGGGGCATCTGGAGCCTCTGCC
CTCTGTGCCTTCCCCCTGGATGAGGTGGACCGGCTTGCTAATCGCACGCGAGATGCCTGC
TACACCCGGGAGGGTCGTGCTGAGGATGGGACCGAGGTGGCCTACATCGAGTATGATGTC
AATTCTGACTGTGCACAGCTGCCAGTG
gtgagttccagtattgccccacttttccgcctctctgaggccactggccaagcatttgca
gccaaggagctgcccagagagtccgagggcagctggtggtagcacgaggatgatcagatc
agcaaatattaagtgcttcctatgttgcctgggcagtggaagggtaccttaccacaaatc
EXON 2  183 bp
aaaaagggaagagagactgggggcggggatgaggttgtcccaggagggccagcagagaaa
acacagttgtacagggagagctaccagagcggctgggggagggaatgaggttgtccaggg
acgatgcggccgaggaggttatccagggagggccttcctgatgcttcttgctgcctatag
GACACCCTGGATGCTTATCCCTGTGGCTCAGACCACACGCCCAGCCCCATGGCCAGCCGG
GTCCCGCTGGAAGCCACACCAATTCTGGAGTGGCCAGGGATTCAGCTAACAGCTGTGGCA
GTCACCATGGAAGATGGACACACCATCGCTTTCCTGGGTGATAGTCAAGGGCAGCTGCAC
AGG
gtgagcccacaggaagtactggcccctgccccagagtctggagggaacagattgctaggg
acccagcctggtttaagctatccctgtgacccctgggccaggagagatgacctgagctcc
tctccccaggactgggtggtgtttacctgtgactttcctccatccccgctaggccagttg
EXON 3  129 bp
ccaggactgggtggtgtttacctgtgactttcctccatccccgctaggccagttggtatg
acctgtgactgcctaggaggaaattctatttgtaaattacttcgattgggtggaggaggg
gagggctttgggcctctggccatggacttgggtcccagaccctgtggtctctgatcccag
GTCTACTTGGGCCCAGGGAGCGATGGCCACCCATACTCCACACAGAGCATCCAGCAGGGG
TCTGCAGTGAGCAGAGACCTCACCTTTGATGGGACCTTTGAGCACCTGTATGTCATGACC
CAGAGCACA
gtgagtgccaggcacaagccagggcatgactgctgggaggggcctctgggtggggccagg
gacccacttgtgggtgagccactggtgtttggattgctggcctcaggtcctctttgctgt
cacagcttctgaaggttcctgtggcttcctgtgctcagcacctggactgtgcatcttgcc
EXON 4  101 bp
agacctcacctttgatgggacctttgagcacctgtatgtcatgacccagagcacagtgag
tgccaggcacaagccagggcatgactgctgggaggggcctctgggtggggccagggaccc
acttgtgggtgagccactggtgtttggattgctggcctcaggtcctctttgctgtcacag
CTTCTGAAGGTTCCTGTGGCTTCCTGTGCTCAGCACCTGGACTGTGCATCTTGCCTTGCT
CACAGGGACCCATACTGTGGGTGGTGCGTGCTCCTTGGCAG
gtcagatttctgaccccatcccagccccagcctcaagcccacaatgctcctgcataattg
tcctgtccagaattcctgacccttagaccatgactctcaacccctgatccccagacaccc
caattcctcacccccatcctctgcactgggcatcagtgccctgccagggcagacacagga
EXON 5  133 bp
cccaattcctcacccccatcctctgcactgggcatcagtgccctgccagggcagacacag
gagcctctatcatgcccactctagggccctgcccaggtcctccagattgtaggagtccct
accctatgaactcccagtggcccatgagggtcacagatagacactggtcatctcgcccag
GTGCAGTCGCCGTTCTGAGTGCTCGAGGGGCCAGGGCCCAGAGCAGTGGCTATGGAGCTT
CCAGCCTGAGCTGGGCTGTCTGCAAGTGGCAGCCATGAGTCCTGCCAACATCAGCCGAGA
GGAGACGAGGGAG
gtgaatgatcagataggcagggccctggtggggagggctctgggcatcaaggtctgggta
gagatcttggatcctgatgtcggacatgccagataccacatggcctcacacaagtcactt
cttttaggagctcagtttccccatctatttctaactcaggccagagggtgtttggggagg
EXON 6  157 bp
acaagtcacttcttttaggagctcagtttccccatctatttctaactcaggccagagggt
gtttggggaggcctgagggctgttgattgctggtgcctgcccacattgggtgtcccataa
atgtgagccctggtctgctgcccactagccccaacagtgtgtccctggctctcttggcag
GTTTTCCTATCAGTGCCAGACCTGCCACCCCTGTGGCCAGGGGAGTCATATTCCTGCCAC
TTTGGGGAACATCAGAGTCCTGCCCTGCTGACTGGTTCTGGTGTGATGTGCCCCTCCCCA
GACCCTAGTGAGGCCCCAGTGCTGCCGAGAGGAGCCG
gtgggtgagagaatgggccagcctggtgggggccagcccctgcttcaggggatgcggtgg
ggttaaagtgtgaatccaggcaaagagccatgaatggatgcctttctctgggtcctccca
ctccccaaccacctgaagcctccattctgtgcccttggactgtattccctcatcctgggt
EXON 7  109 bp
gaatggatgcctttctctgggtcctcccactccccaaccacctgaagcctccattctgtg
cccttggactgtattccctcatcctgggtcctcttccccattcaagggctcaggatatcg
gctctgggtctgagtgcacctccttgctgcttaaccctggccctctctccccctctgcag
ACTACGTATCCGTGAGCGTGGAGCTCAGATTTGGCGCTGTTGTGATCGCCAAAACTTCCC
TCTCTTTCTATGACTGTGTGGCGGTCACTGAACTCCGCCCATCTGCGCA
gtgagttcctcgccctgtccccaggcctgggcttccctgtggcgacccttgccccatggc
tgtgctctgtgcaggtgccaggcctgtgtgagcagccgctgggggtgtaactggtgtgtc
tggcagcacctgtgcacccacaaggcctcgtgtgatgctgggcccatggttgcaagccat
EXON 8  109 bp
acgtatccgtgagcgtggagctcagatttggcgctgttgtgatcgccaaaacttccctct
ctttctatgactgtgtggcggtcactgaactccgcccatctgcgcagtgagttcctcgcc
ctgtccccaggcctgggcttccctgtggcgacccttgccccatggctgtgctctgtgcag
GTGCCAGGCCTGTGTGAGCAGCCGCTGGGGGTGTAACTGGTGTGTCTGGCAGCACCTGTG
CACCCACAAGGCCTCGTGTGATGCTGGGCCCATGGTTGCAAGCCATCAG
gtgagtgtgactttgggctgggccataccgggggggttgggggtcccagtgtgagagttt
ttctcatggcccggggtctgtctgcctatgtgaggctctgtcctgagcaccagagccgct
gtatgtgacggactccctggagaacagccgccgatacatcccgcctgttttgggagaggg
EXON 9  681 bp
cggcacagacacccctggagccttcccccgcagttttctccagtggagaattaatgggct
gtttttatttctcttttccttggtctcctttcctcttaacatacactgtgcctgcctgcc
tcctgtcccgcgcctgcctgctgagtggcccttcctgtcttcctctgcctcccccttcag
AGCCCGCTTGTCTCCCCAGACCCTCCTGCAAGAGGTGGACCCAGCCCCTCCCCACCCACA
GCCCCCAAAGCCCTGGCCACCCCTGCTCCTGACACCCTTCCCGTGGAGCCTGGGGCTCCC
TCCACAGCCACAGCTTCGGACATCTCACCTGGGGCTAGTCCTTCCCTGCTCAGCCCCTGG
GGGCCATGGGCAGGTTCTGGCTCCATATCTTCCCCTGGCTCCACAGGGTCGCCTCTCCAT
GAGGAGCCCTCCCCTCCCAGCCCCCAAAATGGACCTGGAACCGCTGTCCCTGCCCCCACT
GACTTCAGACCCTCAGCCACACCTGAGGACCTCTTGGCCTCCCCGCTGTCACCGTCAGAG
GTAGCAGCAGTGCCCCCTGCAGACCCTGGCCCCGAGGCTCTTCATCCCACAGTGCCCCTG
GACCTGCCCCCTGCCACTGTTCCTGCCACCACTTTCCCAGGGGCCATGGGCTCCGTGAAG
CCCGCCCTGGACTGGCTCACGAGAGAAGGCGGCGAGCTGCCCGAGGCGGACGAGTGGACG
GGGGGTGACGCACCCGCCTTCTCCACTTCCACCCTCCTCTCAGGTGATGGAGACTCAGCA
GAGCTTGAGGGCCCTCCCGCCCCCCTCATCCTCCCGTCCAGCCTCGACTACCAGTATGAC
ACCCCCGGGCTCTGGGAGCTG
gtgaggcccagcccaggaaggaggcctcaggggaggggatgtggggaagatgctacccct
agcttgccttgtgattctgcactgggaggaggtgaggggcagggtggagtctgcagcccc
acaccggccttgcctctggaatctggcaaggcagagggctgagctgggcagggtgggctc
EXON 10  123 bp
gggaggggatgtggggaagatgctacccctagcttgccttgtgattctgcactgggagga
ggtgaggggcagggtggagtctgcagccccacaccggccttgcctctggaatctggcaag
gcagagggctgagctgggcagggtgggctccatagactgccttgcccttggtgcctgcag
GAAGAGGCGACCTTGGGGGCAAGCTCCTGCCCCTGTGTGGAGAGCGTTCAGGGCTCCACG
TTGATGCCGGTCCATGTGGAGCGGGAAATCCGGCTGCTAGGCAGGAACCTGCACCTTTTC
CAG
gtcagtgtgtcctgcctgccgctgtccttgcagcctccttagctgttgagaaactctgca
caagccctggggagcaggaggagggcagagtccgagggctcaactccaacccagaagctg
tgctgggggatctgttgggtgacctgcaggactccctgggcccagctcctgaagctgccc
EXON 11  123 bp
tccttgcagcctccttagctgttgagaaactctgcacaagccctggggagcaggaggagg
gcagagtccgagggctcaactccaacccagaagctgtgctgggggatctgttgggtgacc
tgcaggactccctgggcccagctcctgaagctgcccaacagctgtgttctctgccctcag
GATGGCCCAGGAGACAATGAGTGTGTGATGGAGCTGGAGGGCCTCGAGGTGGTGGTTGAG
GCCCGGGTCGAGTGTGAGCCACCTCCAGATACCCAGTGCCATGTCACCTGCCAGCAGCAC
CAG
gtgcacaccatgagcgcctgggtgggcacgggtgcactgcactggccacaggctggctgc
caactgtagctggctgcaccacactttccagagccacgctctgaccgtgtcgccctgagg
gagtctccacacccatttctgacctctgaccatgtgccccgtggagtccttgcatcccag
EXON 12  94 bp
ttgagaccccatggggtccccatactccatttctggctctgccctccaacttgtggcccc
atggggtccctctgaccctatgctcctaactggtcgttttagtcctttctctgactaacc
cctccccaggcctgacacttcccccagtgcttgactctgaacccactcccatttctccag
CTCAGCTATGAGGCTCTGCAGCCGGAGCTCCGTGTGGGGCTGTTTCTGCGTCGGGCCGGC
CGTCTGCGTGTGGACAGTGCTGAGGGGCTGCATG
gtgagccacctgcgggctgctgggctggcggtggtagcagggctctcccaggcctgcctc
tcacgtgtgtctctgccacccccagtggtactgtatgactgttccgtgggacatggagac
tgcagccgctgccaaactgccatgccccagtatggctgtgtgtggtgtgagggggagcgt
EXON 13  173 bp
gctcagctatgaggctctgcagccggagctccgtgtggggctgtttctgcgtcgggccgg
ccgtctgcgtgtggacagtgctgaggggctgcatggtgagccacctgcgggctgctgggc
tggcggtggtagcagggctctcccaggcctgcctctcacgtgtgtctctgccacccccag
TGGTACTGTATGACTGTTCCGTGGGACATGGAGACTGCAGCCGCTGCCAAACTGCCATGC
CCCAGTATGGCTGTGTGTGGTGTGAGGGGGAGCGTCCACGTTGTGTGACCCGGGAGGCCT
GTGGTGAGGCTGAGGCTGTGGCCACCCAGTGCCCAGCGCCCCTCATCCACTCG
gtttgttgaaaggctggccatcccttcctcagtgctgcccttagagggagggtgtggggg
cccaaaggtgggaggttggggctgcctttccagttgagtagaggtgagcagtccttgtcc
tggaacaggtggagccactgactgggcctgtagacggaggcacccgtgtcaccatcaggg
EXON 14  152 bp
tggtgaggctgaggctgtggccacccagtgcccagcgcccctcatccactcggtttgttg
aaaggctggccatcccttcctcagtgctgcccttagagggagggtgtgggggcccaaagg
tgggaggttggggctgcctttccagttgagtagaggtgagcagtccttgtcctggaacag
GTGGAGCCACTGACTGGGCCTGTAGACGGAGGCACCCGTGTCACCATCAGGGGCTCCAAC
CTGGGCCAGCATGTGCAGGATGTGCTGGGCATGGTCACGGTGGCTGGAGTGCCCTGTGCT
GTGGATGCCCAGGAGTACGAGGTCTCCAGCAG
gtaagctggctgcacccagcaggagcacggcgcagcctggggcctccgcggttggcgttg
ctgcttggggcctcccacccaccgctcatctgcccccctctctccctgttccttgatcct
ggccacaatgcccgagtgccagcgttgccactgaagaccctgagcacccaccacacctgt
EXON 15  106 bp
ccaaggccttctgatgtgtcataaagaattccctccaaagtgagagagggtctctgtcaa
tcttatggagcatgggaaggggaagaccacctgacagtagggcagggagaggggctgcca
ggtaagcttgaggggcccttgatgcagcctggcaccccctagcctgccctgtgcctacag
CCTCGTGTGCATCACCGGGGCCAGTGGGGAGGAGGTGGCCGGCGCCACAGCGGTGGAGGT
GCCGGGAAGAGGACGTGGTGTCTCAGAACACGACTTTGCCTACCAG
gtacctgactgctgagccacccccagctgccagcgggccaacctctctggtggctcctct
caacccatctggttattccttggtggggctcccagtcctgggccagcctgtctctcaggc
tgtccctgcctccatgtgtctggtctgatgctcatctctctccctgtctgtcccacagga
EXON 16  137 bp
aggtacctgactgctgagccacccccagctgccagcgggccaacctctctggtggctcct
ctcaacccatctggttattccttggtggggctcccagtcctgggccagcctgtctctcag
gctgtccctgcctccatgtgtctggtctgatgctcatctctctccctgtctgtcccacag
GATCCGAAGGTCCATTCCATCTTCCCGGCCCGCGGCCCCAGAGCTGGGGGCACCCGTCTC
ACCCTGAATGGCTCCAAGCTCCTGACTGGGCGGCTGGAGGACATCCGAGTGGTGGTTGGA
GACCAGCCTTGTCACTT
gtgagggccacttcctcatcctgcaaaaatccatctgctccaggggaaagatggaggggt
ctgagatcctggggagagcagaaaggggaagagggccagtctgctccttcagagagtggc
cagaccctccctagccagctgtggtgggagtgcacctccagggacacctggtggagactg
EXON 17  177 bp
agggccagtctgctccttcagagagtggccagaccctccctagccagctgtggtgggagt
gcacctccagggacacctggtggagactgcagtcagcgcttgagggaagccagttggggc
ctgagtggtccaagttttccctgcctgcgcccctgcattcattcccacctcccctcccag
GCTGCCGGAGCAGCAGTCAGAACAACTGCGGTGTGAGACCAGCCCACGCCCCACGCCTGC
CACGCTCCCTGTGGCTGTGTGGTTTGGGGCCACGGAGCGGAGGCTTCAACGCGGACAGTT
CAAGTATACCTTGGACCCCAACATCACCTCTGCTGGCCCCACCAAGAGCTTCCTCAG
gtgttgggccaggggtgtggctgcatggcaggtggcagggaggtctttgcagctccacta
tgtgggggtttgtagggctttatgttgaggcactgagaatcccatgctgctagtaggggc
aaggggtcgtgtggtttggggctggggctgagctgacctagccgggactgggctgtgctt
EXON 18  172 bp
cactatgtgggggtttgtagggctttatgttgaggcactgagaatcccatgctgctagta
ggggcaaggggtcgtgtggtttggggctggggctgagctgacctagccgggactgggctg
tgctttaggtccaggtaacataagccatcttacgttacgtaagctcacggtctgtttcag
TGGAGGACGTGAGATATGCGTCCGTGGCCAGAATCTGGACGTGGTACAGACGCCAAGAAT
CCGGGTGACCGTGGTCTCGAGAATGCTGCAGCCCAGCCAGGGGCTTGGACGGAGGCGTCG
CGTGGTCCCGGAGACGGCATGTTCCCTTGGACCCTCCTGCAGTAGCCAGCAA
gtaggacacccttgggtacccccacactctccccttgccccataccacaccctggggaca
gccagagcaggtgccagaggaggctcttcccatctttgcttggcccctcgtcaacctgcc
tgtcttccttccagtttgaggagccgtgccatgtcaactcctcccagctcatcacgtgcc
EXON 19  243 bp
cccggagacggcatgttcccttggaccctcctgcagtagccagcaagtaggacacccttg
ggtacccccacactctccccttgccccataccacaccctggggacagccagagcaggtgc
cagaggaggctcttcccatctttgcttggcccctcgtcaacctgcctgtcttccttccag
TTTGAGGAGCCGTGCCATGTCAACTCCTCCCAGCTCATCACGTGCCGCACACCTGCCCTC
CCAGGCCTGCCTGAGGACCCCTGGGTCCGGGTGGAATTTATCCTTGACAACCTGGTCTTT
GACTTTGCAACACTGAACCCCACACCTTTCTCCTATGAGGCCGACCCCACCCTGCAGCCA
CTCAACCCTGAGGACCCCACCATGCCATTCCGGCACAAGCCTGGGAGTGTGTTCTCCGTG
GAG
gtacagctcctacttggacctggcagggccccgagacccttcccttggctggacagcact
gctgtgtgtggcggagaggccgagacagtagagcaagggccggtggatggacatggctcc
tcatccttgctgtggtgggggcagagggggctggtggggggtgcctagcctagcatctgg
EXON 20  177 bp
aacaaagggtgatgaggagcagcttggaggacactgtgtgactggcctgcactcgggaag
ggtgctgagaggctgtcagctttgctgctgcggctgggtctcagggtccttcccacattt
ggggaggacaggatctgagggaagggtcctgagtgactgatcggtgaccctctgttccag
GGGGAGAACCTGGACCTTGCAATGTCCAAGGAGGAGGTGGTGGCTATGATAGGGGATGGC
CCCTGTGTGGTGAAGACGCTGACGCGGCACCACCTGTACTGCGAGCCCCCCGTGGAGCAG
CCCCTGCCACGGCACCATGCCCTCCGAGAGGCACCTGACTCTTTGCCTGAGTTCACG
gtcagtgggcaggtccctggccgggctgggcattgacctgggccaaacccttgctcacag
gtggctcctgacacaggtgcagatggggaacttgcgcttctccctgggtcacgtgcagta
tgacggcgagagccctggggcttttcctgtggcagcccaggtgggcttgggggtgggcac
EXON 21  149 bp
agacgctgacgcggcaccacctgtactgcgagccccccgtggagcagcccctgccacggc
accatgccctccgagaggcacctgactctttgcctgagttcacggtcagtgggcaggtcc
ctggccgggctgggcattgacctgggccaaacccttgctcacaggtggctcctgacacag
GTGCAGATGGGGAACTTGCGCTTCTCCCTGGGTCACGTGCAGTATGACGGCGAGAGCCCT
GGGGCTTTTCCTGTGGCAGCCCAGGTGGGCTTGGGGGTGGGCACCTCTCTTCTGGCTCTG
GGTGTCATCATCATTGTCCTCATGTACAG
gtgggtgcagccagatgtggctgggctggggcaggtcgtgggatctggctggactgggaa
gggacagaccgggccaggagtcaggaaacattctctgtaaatggccagagagtaaatatt
ttcgctttgcaggccaagtggtctctgttcaacaactcagctttgccactgtggcacaaa
EXON 22  101 bp
ggtgtgtgtgacttgcttgggacgggacaggctgaatcgtactgggctaggcttgagctt
ggctggcatggctgcattggactgtgctggatgaggccggggtgtgcctggggattgtca
ggcaggcctgggcgagtaggactcatctggccatcctctcctgaccctggggctgagcag
GAGGAAGAGCAAGCAGGCCCTGAGGGACTATAAGAAGGTTCAGATCCAGCTGGAGAATCT
GGAGAGCAGTGTGCGGGACCGCTGCAAGAAGGAATTCACAG
gtgtggctgggagaatgggccccgccctccagaactctgcccaaacccactcccatcaca
cgggattggtgcttaacaggtgcttaacctggcctcttctgcttaacagacctcatgact
gagatgaccgatctcaccagtgacctcctgggcagcggcatccccttcctcgactacaag
EXON 23  218 bp
taagaaggttcagatccagctggagaatctggagagcagtgtgcgggaccgctgcaagaa
ggaattcacaggtgtggctgggagaatgggccccgccctccagaactctgcccaaaccca
ctcccatcacacgggattggtgcttaacaggtgcttaacctggcctcttctgcttaacag
ACCTCATGACTGAGATGACCGATCTCACCAGTGACCTCCTGGGCAGCGGCATCCCCTTCC
TCGACTACAAGGTGTATGCGGAGAGGATCTTCTTCCCTGGGCACCGCGAGTCGCCCTTGC
ACCGGGACCTGGGTGTGCCTGAGAGCAGACGGCCCACTGTGGAGCAAGGGCTGGGGCAGC
TCTCTAACCTGCTCAACAGCAAGCTCTTCCTCACCAAG
gtacccccagctgcatcttcctggcctgcccctggccctgccccttctccagggcatggt
ttctgagcccgcccctctgtccccctaaaccccttttcccatcccttctctttggctgca
gttcatccacacgctggagagccagcgcaccttttcagctcgggaccgtgcctacgtggc
EXON 24  179 bp
tggagcaagggctggggcagctctctaacctgctcaacagcaagctcttcctcaccaagg
tacccccagctgcatcttcctggcctgcccctggccctgccccttctccagggcatggtt
tctgagcccgcccctctgtccccctaaaccccttttcccatcccttctctttggctgcag
TTCATCCACACGCTGGAGAGCCAGCGCACCTTTTCAGCTCGGGACCGTGCCTACGTGGCA
TCTCTGCTCACCGTGGCACTGCATGGGAAGCTTGAGTATTTCACTGACATCCTCCGCACT
CTGCTCAGTGACCTGGTTGCCCAGTATGTGGCCAAGAACCCCAAGCTGATGCTGCGCAG
gtctgtgtggctgttggggctgggtgggccctggacagctggagctggggtggggcctcg
ggctggggggtctgcaggatagagaggcccgcagccccacctgctgaccctggcactccc
ctttcccatcatctcaggacagagactgtggtggagaagctgctcaccaactggatgtcc
EXON 25  67 bp
ttgcccagtatgtggccaagaaccccaagctgatgctgcgcaggtctgtgtggctgttgg
ggctgggtgggccctggacagctggagctggggtggggcctcgggctggggggtctgcag
gatagagaggcccgcagccccacctgctgaccctggcactcccctttcccatcatctcag
GACAGAGACTGTGGTGGAGAAGCTGCTCACCAACTGGATGTCCATCTGTCTGTATACCTT
CGTGAGG
gtgagggggcagaggtggacagggctcctgtccagggagggtcaggccctccaaacttct
aagccctcagccaccatgcagctcggacacttgtgccagagcagagactcctgctcagcc
tgtcctcagtccccttaagcccatgtcctgtccccttccccagtgtgcgtcatgtcccat
EXON 26  147 bp
ctccaaacttctaagccctcagccaccatgcagctcggacacttgtgccagagcagagac
tcctgctcagcctgtcctcagtccccttaagcccatgtcctgtccccttccccagtgtgc
gtcatgtcccatacacctctgccacctgctggggggccctaactgcctgtgctctcctag
GACTCCGTAGGGGAGCCTCTGTACATGCTCTTTCGAGGGATTAAGCACCAAGTGGATAAG
GGGCCAGTGGACAGTGTGACAGGCAAGGCCAAATACACCTTGAACGACAACCGCCTGCTC
AGAGAGGATGTGGAGTACCGTCCCCTG
gtgagggtgtgcaagtgtgtggcctgcagtctgagtgcggtgagggcgagggtggagagt
gtgtgggtgtgtggggtctggacaccagcttctgatgtggtacctggatgtagagctggg
ttgacctctggctggctcctggagagagcccatcagactagcttagcaggatagcagttt
EXON 27  169 bp
aatggggaggaagctgctgtccctggggaaggcaggcaggtgaagagacgagaattaggg
attgtgtggtgcgtggggattggaggcagcagtttctcatgagttgtctctgcccttggc
ctgtgtcttggtcatcctgagtgcacatgaaccctgatggctcctgtgtgtcctgcacag
ACCTTGAATGCACTATTGGCTGTGGGGCCTGGGGCAGGAGAGGCCCAGGGCGTGCCCGTG
AAGGTCCTAGACTGTGACACCATCTCCCAGGCAAAGGAGAAGATGCTGGACCAGCTTTAT
AAAGGAGTGCCTCTCACCCAGCGGCCAGACCCTCGCACCCTTGATGTTG
gtgagggcgtggagagcccctggggacctgagccactgttgggcctgggctggccccgga
ccaactctgcagggacaactcatcactcagggtggggaggatgctgggaggcaggcagaa
gctggctttggaacatctttcttggacagcctctcatctggggagggggtccctgctctt
EXON 28  104 bp
ggaacatctttcttggacagcctctcatctggggagggggtccctgctcttggtctttgg
agaggttgagtaaggctgccccatgatggaggggctggtgtccctgtggaggaggagatg
ggctccactatgggaagggtatcttccagccctgcacccagttctgccttgcccttgcag
AGTGGCGGTCTGGGGTGGCCGGGCACCTCATTCTTTCTGACGAGGATGTCACTTCTGAGG
TCCAGGGTCTGTGGAGGCGCCTGAACACACTGCAGCATTACAAG
gtaggaggagtgggagctggaggagggcatggtggggtgggactggtggagggatcacca
gctgtgctcagcaggtcccagatggagcaactgtggccctcgtcccctgcctcaccaagc
atgtgctccgggaaaaccaggattatgtccctggagagcgtgagtaccgctcccatcacg
EXON 29  85 bp
agagtggcggtctggggtggccgggcacctcattctttctgacgaggatgtcacttctga
ggtccagggtctgtggaggcgcctgaacacactgcagcattacaaggtaggaggagtggg
agctggaggagggcatggtggggtgggactggtggagggatcaccagctgtgctcagcag
GTCCCAGATGGAGCAACTGTGGCCCTCGTCCCCTGCCTCACCAAGCATGTGCTCCGGGAA
AACCAGGATTATGTCCCTGGAGAGC
gtgagtaccgctcccatcacggtcctctgcccctgctgtgcccagcccggagtcatgggg
aaggtcctctgggcctcagggcaggcttgtgcctatttccattcggcccaggaaatccct
caaccaggtgcccccacccctgggagagctggcaagaaacagggggcctggggaggtggc
EXON 30  173 bp
tgcccagcccggagtcatggggaaggtcctctgggcctcagggcaggcttgtgcctattt
ccattcggcccaggaaatccctcaaccaggtgcccccacccctgggagagctggcaagaa
acagggggcctggggaggtggcacctggggaggggtgacagctgtgggctcttggcacag
GGACCCCAATGCTGGAGGATGTAGATGAGGGGGGCATCCGGCCCTGGCACCTGGTGAAGC
CAAGTGATGAGCCGGAGCCGCCCAGGCCTCGGAGGGGCAGCCTTCGGGGCGGGGAGCGTG
AGCGCGCCAAGGCCATCCCTGAGATCTACCTGACCCGCCTGCTGTCCATGAAG
gtggggtggggcctgccaaggtagtggggcctgggctgagagggagcatggccactcgtg
ggatttgggggtggtgtggggctcgtgcaggcacagtgccggggggtgtctgaggctggg
ctgctgctgagggccctttgctgaccacacctctctgcttcttccttcccacagggcacc
EXON 31  161 bp
atgaaggtggggtggggcctgccaaggtagtggggcctgggctgagagggagcatggcca
ctcgtgggatttgggggtggtgtggggctcgtgcaggcacagtgccggggggtgtctgag
gctgggctgctgctgagggccctttgctgaccacacctctctgcttcttccttcccacag
GGCACCCTGCAGAAGTTCGTGGATGACCTGTTCCAGGTGATTCTCAGCACCAGCCGCCCC
GTGCCGCTCGCTGTGAAGTACTTCTTTGACCTGCTGGATGAGCAGGCCCAGCAGCATGGC
ATCTCCGACCAGGACACCATCCACATCTGGAAGACCAACAG
gtggggtggagctgggtgggctctaggtgtgtgtggggggtcttctcttctgcctcccca
gcacattcatcggccatgcctgccccacccgcagcttgcctctgaggttctggatcaata
taataaaaaacccgcagtttgtgttcgacgtgcaaacatctgataacatggatgcggtgc
EXON 32  148 bp
aagtacttctttgacctgctggatgagcaggcccagcagcatggcatctccgaccaggac
accatccacatctggaagaccaacaggtggggtggagctgggtgggctctaggtgtgtgt
ggggggtcttctcttctgcctccccagcacattcatcggccatgcctgccccacccgcag
CTTGCCTCTGAGGTTCTGGATCAATATAATAAAAAACCCGCAGTTTGTGTTCGACGTGCA
AACATCTGATAACATGGATGCGGTGCTCCTTGTCATTGCACAGACCTTCATGGACGCCTG
CACCCTGGCCGACCACAAGCTGGGCCGG
gtgagcgagtctgggatggacacgggggggatgggtgagggtggacagtgctgtgtgtgc
actcagattccaggcttttctgagaacttcaaggagggcttaggggagacctctgacctc
ccaagccaaggcttcatcccggggccacctcagttttaagggatgagcaagaggagggga
EXON 33  65 bp
aggaagtaggcgagggtgaccacctgtcctggttttccgggactcaggggcttcctggga
tgtgagacttttccttttcaaaactgaagcagtactgggaaacccaggacacttgatcac
tcgaacagggaccctcatccttccttccttcctcttttgctgtcctcctgctatgtccag
GACTCCCCGATCAACAAACTTCTGTATGCACGGGACATTCCCCGGTACAAGCGGATGGTG
GAAAG
gtactggagggcacggtgggtagaggttggagggcgtgtgcagctgaggcttggggggtg
ggctctggttgggagcaggggagtgggcttgtttacccagcagctgctgtgccctggctc
tctggcaggtactatgcagacatcagacagactgtcccagccagcgaccaagagatgaac
EXON 34  76 bp
acaaacttctgtatgcacgggacattccccggtacaagcggatggtggaaaggtactgga
gggcacggtgggtagaggttggagggcgtgtgcagctgaggcttggggggtgggctctgg
ttgggagcaggggagtgggcttgtttacccagcagctgctgtgccctggctctctggcag
GTACTATGCAGACATCAGACAGACTGTCCCAGCCAGCGACCAAGAGATGAACTCTGTCCT
GGCTGAACTGTCCTGG
gtaaggcctccctctgcttcttgggttgggcataggcctcctgccacaacggtccttccc
ccttcacactgcccctttgcagggaagcccttgggaacctcagcagccctgtgagctggt
tggggcaggaaacataaatgcagaatgttccaactgccactgaaagaccagggctcccac
EXON 35  75 bp
gcacacctggcctggggtccctgggccatggaggggactctgcttcccactgtagtgccc
atcccattctctacctctcaggtccccttctcccccagcccttccctggggtcctgggct
gcctcctgtggctctctgcacccctcgtctctctcacctttcatttggcctcttccctag
AACTACTCCGGAGACCTCGGGGCGCGAGTGGCCCTGCATGAACTCTACAAGTACATCAAC
AAGTACTATGACCAG
gtgggcaggccctggaccccgactgggaggctgacccaaggcctcccaggagacttaagg
ggctctgaccctgtgactcacgttgggggctttggtcttccccagggacagagtagtggg
gggccgggccccttggtggcttgagaagtgttttccaggcgggcttcctggcattggctg
EXON 36  340 bp
gatgttattacccctcccgccagcgaggccctgaggtcccagaaagtacgtgaagtgacc
ggctgggtttcttggcctcctaccccactcatgccacagcgtcttaggagggctgttgaa
ttttgcagcaaacacgttggccaaagaagtctcccctgatggcattggtctctgtttcag
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTC
CAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAGGAACCCAGGAGCCAC
GGCCTGCTGTTGCTTCAGCCTGGCCTGGGCAGCCCTGGAAGCTCGGAGGAGAGGCCACCT
TCTTAGGTGCCTGTAGTGACTGACAAGCAGAGTTAGTGGAAGGTGACTCCCAGTCTCCTG
GTGGCTCTGGCCTCGGCCCTGCTGGATCCACCTCCTAGACCCGGGGCCTCAAGGCTCATG
GGGTAGTACCCAGCCTGCTCCCCGAGTCCAGCGACCCTGT
gacaccggtctgcagggagttggggactaagggcttccagagagtggctggaagagactc
caggcccctggggagactgtactgttcctgaacactggccttggccacactgggattcgg
agaggaaggaggagagccccatgcttcctgtctgcctcctccaccatccctgacctcagt