Gene PLS1 Variant 1
DNA : 90.16 KbNT_005612
mRNA : 3639 bp NM_002670
CDS : 1890 bp NP_002661
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  61 bp
atttttttatggttctgaaccacacccatgttgcagattggcctttctactgagagtaag
ttccatcaagattaatatctgtagtaataggcagaacacttcagtgtggaattgcttctt
ttctttggtcaaacactaactttggcagaggatagacacagcttaggaagactgaatttt
AAGTCTTCTGAATTGTTTTTCTGGACTTCCAAATCTCAAGTGATAAGACCAGCAGAAGCA
G
gtatacaaaaatttatctctgtcaatagcagtaagacagcctcggattccaggctgcttt
ttcatataattgttaaattgagataaacaccctcatagtatttcttttttaaatgcattc
ttgctttgggactctagatggctttgcataatcaatgtaaataggaaccttggtgtgaag
EXON 2  106 bp
ttatagtttggctggcctatgctgagagattgttaccaggggacctactcatatttgttc
tttgtcagccagatctcatagataattcctcctagagaatgtacttcctctgtaccttat
attgcttagttaaatgtttccaaaggcttcatgctttttttataatattgctttttctag
ATATAAAGACCTGAAGATAGTCTTTTCTGTCCAAAGATGGAAAACAGTACTACTACCATT
TCTCGGGAGGAGCTTGAAGAACTACAAGAGGCATTTAATAAAATAG
gtatgcttgagaaaaagtaaatatgatattactggtctgcttgatgtcagacttcaggaa
tggaaaaataccttttatttcatctaccaccacccaattacctccagatttattcctttt
tttctatctaggtttcactggattctttctttctgaaagataagctacgactagcttgaa
EXON 3  164 bp
ttttaaaataaagcatatagcatattctgtacagttcaggtacaggaaaaaaggttactg
ccacctgtgaaacaaatgtgaaaggctctgtctgcacatctatgaatcctcccaaaaggc
atccttattgtacaccttcaacaaagattacaaaatatattttataatatatctttacag
ATATTGACAATAGTGGGTATGTCAGTGACTATGAACTTCAAGACCTGTTTAAGGAAGCAA
GCCTTCCTCTGCCTGGCTACAAGGTGCGCGAGATTGTGGAGAAAATTCTATCAGTTGCTG
ACAGCAACAAAGATGGCAAAATCAGTTTTGAAGAGTTTGTGTCA
gtaagtaatctaatcctttcgggctactgataatcttgcttagagcagaattgtagtaat
gtcatcactagctttggttaaatccagcttcagagaccagaaaaaggactgctttaaaat
gatgatgatgatgatgacaataactattattatcgaaataatttccacaactaattcata
EXON 4  130 bp
tatttgtctattttgtgttattggtaaaatgatgaaagttatctgtgtatacaagcaata
agtacaactgactagtatttaatttggtgtcatttcaaataaagaagtgtaaataaatat
ccattttgtcaggtttttattgattatctgattctcaattttacttatgttccattccag
CTAATGCAAGAATTAAAAAGCAAAGATATCAGCAAAACATTCCGAAAAATAATTAACAAG
AGGGAAGGGATTACTGCTATTGGAGGAACTTCAACTATTTCCAGTGAGGGCACACAGCAT
TCTTATTCAG
gtaactgacttctccaaatttgatcttttagtcactgattcattgattaagtgacatatt
taatcagttctaagatgccactcattgtgattcataccgttattttatgtgccactgagg
agaaaaaaatactgcagaccacagtataacatgccattgaatttgaaatacatctcagtt
EXON 5  133 bp
agccacctttcttcttttcttgaacccttttgtgttttagtagatttgtaataatggtca
attattatctttgagcagaaattaacaagtatgtttttgtagtgcaatagctatgtatgt
ttttatagtgcaataaagtttgtgaaatgagatttgcctaccaaggttttctcctttcag
AGGAAGAAAAAGTGGCTTTTGTTAACTGGATAAACAAAGCCCTGGAGAATGACCCTGACT
GTAAGCATCTTATACCCATGAATCCCAATGATGATAGTCTTTTCAAGTCACTTGCAGATG
GCATCCTTCTTTG
gtgagttgaacttctggttaaggaagctgcgttcttgctgattacattgatgagcattcc
atgaaaactccaattcagctgtccattgtcttttggagtcagtagctacttaggtcatga
ggaatttatattgcatagaaaatgaactactgtatatctattggaaaatttccaaaattt
EXON 6  82 bp
tgggctcagcctcccaagtagctgagattatatgcatgtgccaccatgcctggcttactg
tttaatattttaaagtaatgaattgttattttcaaaatttatctattttggctgtttgca
ataataaactaaaaaaatttcttggagtattaaactaaattattctcattttctctttag
CAAAATGATCAACTTATCTGAACCAGATACAATTGATGAAAGAGCCATCAATAAGAAAAA
GCTCACGCCATTCACTATTTCT
gtaagtatttgccctttgcttattatcatgttactatgctgagaaatataagacctttat
taatgaatgcttggacccagataaaacctttgatttaattgtaatgctattctcctataa
aaacttttttttttggaatccttttttttatttttattttattttattattattatactt
EXON 7  166 bp
ggcatataaagtaacagttaaaaccatgtgtttttttttttgagtagtggtattttcgtt
gtataaatattatgtttataaatctgaaatttggcagtccattgtttcttatagataatt
tttatagataagaccttagaaaggacttcctcatgtgtacttttttttttggcaattcag
GAAAATTTAAACCTAGCTCTGAATTCTGCCTCAGCCATTGGTTGTACAGTGGTCAACATT
GGTGCATCAGATCTCAAAGAAGGAAAACCTCACTTGGTCTTGGGACTTCTCTGGCAGATC
ATCAAAGTTGGCCTTTTTGCTGATATTGAGATTTCCAGGAATGAAG
gtaagatcattagaaatatttgctgttcattgacatgtacttgctatgggaagaatttac
atttcgctgttttgccctcagctctgattgcattgttaaatgaaggtgaggaactagagg
agctgatgaagctttctcccgaggaattactgctgcgatgggtgaactaccatctgacca
EXON 8  143 bp
cagatctcaaagaaggaaaacctcacttggtcttgggacttctctggcagatcatcaaag
ttggcctttttgctgatattgagatttccaggaatgaaggtaagatcattagaaatattt
gctgttcattgacatgtacttgctatgggaagaatttacatttcgctgttttgccctcag
CTCTGATTGCATTGTTAAATGAAGGTGAGGAACTAGAGGAGCTGATGAAGCTTTCTCCCG
AGGAATTACTGCTGCGATGGGTGAACTACCATCTGACCAATGCAGGATGGCATACCATCA
GCAACTTCAGCCAAGACATTAAG
gtttatatttaaatgttcaaatttgtgacatgaaataaggatgtgcagtgtaaaaataaa
aggggttcagacttaaatttgaattaaattcacaagaacacttgggatagaaaatgaaaa
tttgcattactgtgtgaagtagatcccccaattatattcacaaaatatatattttctaaa
EXON 9  93 bp
tgaagctctgaagtgtgaaacagcatggtacattcaggaacctacaagtaattctttatt
tttaaagttattccattctttgagatagaggcaatttcttcagtttgagcacttgttttc
cctaaattcaatgatgattttattcgttttaaaaatgctatttcatatctttccttgaag
GACTCGAGAGCCTATTTTCATCTGCTTAATCAGATTGCCCCTAAAGGTGGGGAAGATGGA
CCTGCCATTGCCATTGACCTTTCAGGAATTAAT
gtgagtgcaatttttaacttttaaaatatattgtggtaaaacagacgtagaaaatttacc
atttttatcattttcagtgttcagttcagtggcattcagtacatttgcattgttgtgcag
ctatcaccattatccatctctacaaacttttcatcatcctgtagggaaattctgtactca
EXON 10  196 bp
ataaataaataaataaataaaggaatgggtaagttgacttggaattactacacattttga
tcttattttgagttattatttgatatatttgtggaaaagtaattgcttataaacatgtat
accaataaaaattatgccaattaaaacttcaattgtaaccatttttgttttattgtttag
GAGACAAATGACCTGAAGCGTGCTGGACTCATGCTTCAAGAAGCAGATAAACTGGGCTGC
AAACAGTTTGTTACTCCTGCAGATGTGGTTTCAGGCAATCCTAAACTTAATTTAGCTTTT
GTAGCTAATTTGTTTAACACATACCCGTGCCTGCACAAGCCGAATAATAATGACATCGAT
ATGAATTTACTGGAAG
gtgcgttctttctgcctttaattgacttgctatatttatcttcttatggtattgtcttac
ttcactgtcagagataggggattgtggtgggaaatgcaatttagtgtgtgtaggtatgtg
tatctattgaaaaattaaaattatggaaggtggttgctggttttggttaaaagagaatgc
EXON 11  79 bp
tagtaggaaagaagggactttggcattaagagactttttttctccctttaaagaaactgt
agtatctaaagaaccatggcaaggtaggtttgaccagtttgtacctgctagaatggttta
acatatagttcctggttccttttgtcctgagtcatcagtgtgagcttgtgtctactctag
GAGAGAGCAAGGAAGAGAGAACATTTCGGAACTGGATGAATTCCTTGGGAGTCAACCCAT
ACATTAATCATTTGTACAG
gtaaatattttattgtgcttcagctttactgtcagggtccaacttttcaagtttcaaact
gtaggcatgtttaaatggaacattttctcaagttgcaagaattttagccaatttttagag
tttcaggatgctgggaattggcaatacaatggattttaaaagaaagctactattcaaaaa
EXON 12  115 bp
taaacattttggacagattcttagactggaagttctgggtcaaatgatatgtcctgtcat
tctttaagaattaaatgacttatgttcttaaagatataagtctatctccagtgtacttaa
taaaattaggtaatacccaacatttcctcctcctttatctgcttttccttcctgcttcag
TGACCTTGCAGATGCTTTAGTGATCTTTCAGCTCTATGAGATGATCCGAGTGCCAGTCAA
CTGGAGCCATGTCAACAAACCTCCTTATCCTGCCCTTGGAGGGAACATGAAGAAG
gtgaatgaaataatggccatggatatattgttattgttctgatatgaaacaaagaattta
gagtttcatgaagttatacgtgctctgtccccacaattctgattcagaccaaaatgtgtt
aagcttaatagcctttttacaagtttgctttaataaatttgaagatgaaggcaatccctc
EXON 13  134 bp
tcttcaactataaaatggaaataattatgtccttgctttccctgggttattattatgaaa
ttggtcatataaatttaaggtgtcatcataattgtttttcagatggctgaactaggctgg
cctattctggagatatgtttttaaaaatctttttatacccaaacttttacttatttatag
ATTGAAAACTGTAACTATGCAGTGGAACTTGGGAAGAACAAGGCCAAATTCTCCTTGGTT
GGCATTGCTGGGCAGGACCTAAATGAAGGGAATTCAACACTTACCCTGGCATTGGTATGG
CAGCTGATGAGAAG
gtaaaggctgatatgttggtagcaacactgcctgtttcctccaacaagtaatctgaacca
aatttttagctatttttgaacaataatgaacacagaagaaatatacaatgcaaaatattt
taatttttaaaggatttactgttgattatggtttttttgtaaattatattttatttaaaa
EXON 14  124 bp
tgtttctgattaatgaggtttgtaactttggaatgtaactgggtgcaaatgccagactaa
aattagaaatatttattagaactgaactatttcttaagtatttatctaaacattgatata
aattatgtgaaagcaaatttcacccttttcagtctcaaatatacatcttttctgttgcag
GTACACATTGAATGTGTTATCGGATCTTGGAGAGGGTGAAAAAGTAAATGATGAAATTAT
AATTAAATGGGTCAATCAGACTCTTAAAAGTGCAAACAAAAAGACTTCTATTTCCAGCTT
CAAG
gtaatcaagagtcctaaaaaaaatttttttttgtaggtataggaaggaattttttttttt
tttttttttttttttttttggagatggagtctcgctctgtcacccaggctggtgtgcagt
ggcgcgatcttggctcactgcaagctctgcctcccaggttcacaccattctcctgcctca
EXON 15  125 bp
ttcaaggaaaagtatattttaaagggtttatttatgtgtgctggttgcagaaaagctgaa
cgttaggttaagtacaaagaatttgtagattgccttcagttatatgatcagaagagtctg
aaaataatgaaaattaaaggtcagatgtttatgaatgttcatctatgctttattttctag
GATAAATCTATAAGCACAAGTTTACCTGTCCTAGATTTAATAGATGCCATTGCACCAAAT
GCAGTTCGTCAAGAAATGATCAGGAGAGAAAACTTATCTGATGAGGACAAGCTGAACAAT
GCTAA
gtaagcctttatggtttatattacaatacatggccctttaattctctaaaatccttatag
gaaaagttactatgcccttaaaattcatatttttaaatataacttatatgtgagtcttag
atttaagactcacaaacttaaccttttcgtaaaactaatcttgtcaaaatatttcactct
EXON 16  1788 bp
ttactatgcccttaaaattcatatttttaaatataacttatatgtgagtcttagatttaa
gactcacaaacttaaccttttcgtaaaactaatcttgtcaaaatatttcactcttttgtt
aaaatatgttaagtgaaaacacagtggataacaccaagatatttttcttgtctcttcaag
ATACGCCATTTCAGTTGCTCGAAAGATCGGTGCCCGGATATATGCATTACCTGATGACCT
CGTAGAAGTGAAACCAAAGATGGTTATGACGGTGTTTGCATGCTTAATGGGAAAAGGACT
GAACAGAATAAAATAATCATTTCATATGATTTTCTGCCACATTAAACATATTGTATGCCT
CACAGTTTACAGGATTCTGAAATGTAGTGGGTGTAAAACCAGAGATTATTTGTATGCTCA
AAATAGTTATATATTCATTAATGAATTCAATATCCTGTTCATACTAGTTAGAGCTGGTCA
GCCTTTTTGGGTAACACAGTTAATTTACCAACTGATACAGATAATAGAATATATTCATAA
TCAAGCTGATACTTCATGATTAAATTATTTTTGTTGCTTAAAAGTCGTATTAGACAAGAC
TAAATCATTCTTTTTTATGGTTCAAAAAAGATGAATACAAACGTTTTTGCAGGTTCTGCT
GTGAAATGTGGTTTGATTTTTTTGGTGTGTTAATTTTGATCATAAATGCATTCATACTCA
TAATCCAGTTTAATCCTTTTATTTGCTTCCTCCAACTATTTAAAGTGGTCCAAAAACACT
TTTCTGTAAGTTTCTATACTGTCTAAAACCTTATGGTGACCAGAATTGTTTATTAATATC
AAACTTTTTTATATATGAGAACTAATTCTTGAATAAACCCCAAAGTTCACTCTCTTGTTT
AAGTAGCAGCAGCTTTTTACTTAAAATTTAATTTTAACTACATTGATACTTTACACATCC
TAGTTTGGTAACACAGCTTTAACTATGTCATGCAACATATATATGTTGGTAGGATGTTAT
TAGAGAGATATGTGTGCATATATATTTTTTTGCACCTGAATCACCCAGCTTTTCATAAGT
GGTATGTTTAATTGGTCATTCAGCCAACCATCAGTATTTTCCCCCCACAACATGTGTAAC
ACTTTTCAGTCTGTGGATATCTGATACATTAAGATTTCTTTTTATAAGTATTCATTTTGA
ATGTGCATATAGTTATTTGACCCCTTCCAAATACTTGTAGCCAAACATTGGCTAGAACAT
CCCAAGATATGCTGACACTGTCCTGTTAGCTTCATATTATACTTGCTAGTTTAGGTCTCT
ATAGAAGCCCTATATAATTTAGAATATGCCCACTGAATATCTTTAATAGAAAGTAACATA
AAGCTAGTATTCAATGTAGAGTATTTTCATATGTTTTTCACAGCCCGTTACAAATTGGCA
ATGTTTGGTTAATGTTTGTATTACTTGGAAATCGCTACAGCTTGGACTATTTTTTTCTAA
ATTTTTAGCATTAGTCCATTTCTGCTGCTAACAATTGAATCCAGAAATCTACTTTCTCCA
TCTTCCACTGTTAGTGCCAGTGAGCAATACTGTTGTGCAACAAAAATGTCACTTTATCTC
AGTGTGAATGAGTAGTCTAAATTCCCTTTCTACCATTGATTTAAATATATATATTGGTAA
GAGAGACTGCCCATGTGTTTAGAATAGAATTTTTTAAATGAAATGATCAACAGGTGGAAT
TTGAAATATATTCTTCTACAAAAGAGATTTCTTTCCCTTTTATATTTTGATGATTGTTTT
CTTAAGATTAAGATATGTTCTTGCTCTTTTATAAGATTATTTAAATTATGTTTCCCTCTG
ATTTTTTTTCACCATTGTATTTACTAAGTTATTGGATTTACATGAAATCTGGCACTTTAG
GGTGTTCTTTTTCTCACAGAGTATATTTAATAAAAATGCTGTGTATAT
agaaatgtgtttatatttatttcatttgaagaaaaatattcagccttgaaaattagtcta
gcataagcttattttccagaaaagaaaagaattcctaaatgagttagtaaaacaaaaaaa
aaattgtgtctgatttctttgaagatgagggtagttcttttgttcttaaatatgaagaat