Gene PCOLCE2 Variant 1
DNA : 71.22 KbNT_005612
mRNA : 1909 bp NM_013363
CDS : 1248 bp NP_037495
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  279 bp
gaggagacgttcgcccgccccacgagagggggcggctctggcctcggagccgcccctcct
gccgccggagaacaaacgggatattcagcagtggcctgtggctgccagagcagctcctca
ggggaaactaagcgtcgagtcagacggcaccataatcgcctttaaaagtgcctccgccct
GCCGGCCGCGTATCCCCCGGCTACCTGGGCCGCCCCGCGGCGGTGCGCGCGTGAGAGGGA
GCGCGCGGGCAGCCGAGCGCCGGTGTGAGCCAGCGCTGCTGCCAGTGTGAGCGGCGGTGT
GAGCGCGGTGGGTGCGGAGGGGCGTGTGTGCCGGCGCGCGCGCCGTGGGGTGCAAACCCC
GAGCGTCTACGCTGCCATGAGGGGCGCGAACGCCTGGGCGCCACTCTGCCTGCTGCTGGC
TGCCGCCACCCAGCTCTCGCGGCAGCAGTCCCCAGAGAG
gtaacgcgacccctgcccgggctccctttctctcctttcccttcctccacccctgcagcc
tcgcctgctgctttactcaacccgcttcggcgcgcctgggtgacccagcgctcgaccctg
cgctcccgcgcggtgcaggcgtccgccaccctcgggtaggctaagcccgggacttcggga
EXON 2  109 bp
caggctataatttaaatattctaggagctagcaaattttcagatcccttatatggtgcaa
gcattgattaatcaacattaacttttatttatattaataggctacacctttctgaaggta
acatcagattgttagaccatgtttcaaattacattatcttttcttcttttatgttcccag
ACCTGTTTTCACATGTGGTGGCATTCTTACTGGAGAGTCTGGATTTATTGGCAGTGAAGG
TTTTCCTGGAGTGTACCCTCCAAATAGCAAATGTACTTGGAAAATCACA
gtaagcattttttaaaaaggtattctcctggaagtgggtgttggcaacagtgtgaggctg
ctgcctttttcctctggtgttaggatttgagtaagaggcaaatgcctgaaatagtgaaat
gttggatttaccccaactattgggaagatttttattaatataatagatctagtcgtgtcc
EXON 3  256 bp
gtacttaaattttttaggaatgcaatatgctagaaaacttcccttgggttagttcagata
tgagagaggaaaaagcattatcttggatattatactttacacacttaagtaagtgactag
atgtcaaagcctcagatattgttttcatgacagttttctaattggcgcttttcttggcag
GTTCCCGAAGGAAAAGTAGTCGTTCTCAATTTCCGATTCATAGACCTCGAGAGTGACAAC
CTGTGCCGCTATGACTTTGTGGATGTGTACAATGGCCATGCCAATGGCCAGCGCATTGGC
CGCTTCTGTGGCACTTTCCGGCCTGGAGCCCTTGTGTCCAGTGGCAACAAGATGATGGTG
CAGATGATTTCTGATGCCAACACAGCTGGCAATGGCTTCATGGCCATGTTCTCCGCTGCT
GAACCAAACGAAAGAG
gtactgtttccacataatggcaataacaacagtaatgttggttcactgttcttggcactt
gatgtttatttactcctttaaagcttaagagtggttctcaaagagctagtgaatgccatc
aaaccatgatgagaccaatacaaaaaatcagccttttaatttaagtccacatgcattctt
EXON 4  125 bp
attgtgtgtgttggggggttatgtatgtaaccatatgtttaagagaaaatgtaagcgctt
ctgctgttgcctttatttactgtactctcaccaaagatcccacattcctaatctccacat
ggttgtattgctgtaacctacataaacttgtgggcttttttccttgtttaatacttgaag
GGGATCAGTATTGTGGAGGACTCCTTGACAGACCTTCCGGCTCTTTTAAAACCCCCAACT
GGCCAGACCGGGATTACCCTGCAGGAGTCACTTGTGTGTGGCACATTGTAGCCCCAAAGA
ATCAG
gtgagattccctggaagtgtgaagaaagcatgcatgtgtgaattgcccagtgtggggggc
ccaccaactctcaagagcctcctgttgtgggggctattcgagagctaagggatacaagaa
gaggaaggttcctggacacaggtatttcttcatgcgaagaccccagatattttttttttt
EXON 5  137 bp
agaataccacagttttttttttaactaaataagaaatatgcaacaaaaagcacttaatgc
atactttttttacaaaggaaaatcgtagtatcctccaaatctggggagaggaagaattcc
atttgaggttattcaacaatgctattaatatttgacacttctattgtgctttctctaaag
CTTATAGAATTAAAGTTTGAGAAGTTTGATGTGGAGCGAGATAACTACTGCCGATATGAT
TATGTGGCTGTGTTTAATGGCGGGGAAGTCAACGATGCTAGAAGAATTGGAAAGTATTGT
GGTGATAGTCCACCTGC
gtaagtagcacctatttatgtctttaatagttttatggctctaaacttgtttcttgttca
gtttcccaatcacatttgttttctggaagattttatgttgttgttgttttgttaaattat
tgggtcctctattagttctcgcactgctgtaaagaaatacctgagactgggtaatttatt
EXON 6  155 bp
gctgagcaaacactcggtaaatgttagctattagaattggtatttttaaacgttttaact
tttaagtttaaacaactggtaatctattgtcggaagttaatggaaaactagaaaatttta
cattttcagagaggcaccacttttaagtatttataaaaaaacacatttttctttttttag
GCCAATTGTGTCTGAGAGAAATGAACTTCTTATTCAGTTTTTATCAGACTTAAGTTTAAC
TGCAGATGGGTTTATTGGTCACTACATATTCAGGCCAAAAAAACTGCCTACAACTACAGA
ACAGCCTGTCACCACCACATTCCCTGTAACCACGG
gtaagttttcctgtttggaagtttgtgcaaaaactttaggagtataagaagaattctttt
aaagtagaaaaaaaataagaggaagatacttgaaattaaagttaaataggatgaaagctt
tggtaagagaataatatgactgcattaatgaaagaaaggtatggggtgtaagaatgcttg
EXON 7  84 bp
attagagcagtagttggtagcatggagaatttattttgcgtggttttaaattttttcttt
gtagtgatagattggtggctcagggaaataaatgataattttaaatgggtagattcagaa
ctaaagaccaattatgcttgaattcatttttcgtgaaacttatgtcttctttgaattaag
GTTTAAAACCCACCGTGGCCTTGTGTCAACAAAAGTGTAGACGGACGGGGACTCTGGAGG
GCAATTATTGTTCAAGTGACTTTG
gtaagaaataaaagccagtctttttctctttaaccagaaacttgaggctgcatgcttaat
ctcaaaggaattcctatgaatttatggtgaagggtcaataacgctgctcatttatccaag
aaaatacttgcctatacaccagaatggtcaaattgttagatttcaccactgagaaaaata
EXON 8  168 bp
cagctccaacctgaattttggtgacaaatgtacagaagcaaatgtgaaacctctatgagg
gccttttctttaacattaaaatgtttcgtatctgaaacttagaagaatgtaaacttgttt
ttcagttctgcttgcatttgccttcactgtcacatcacttcaaaatgttttcttctgcag
TATTAGCCGGCACTGTTATCACAACCATCACTCGCGATGGGAGTTTGCACGCCACAGTCT
CGATCATCAACATCTACAAAGAGGGAAATTTGGCGATTCAGCAGGCGGGCAAGAACATGA
GTGCCAGGCTGACTGTCGTCTGCAAGCAGTGCCCTCTCCTCAGAAGAG
gtgagtagggagaaaactgggtgtctctgagcaagccatggattttccatgccatggttg
gtctagggaagtaaaatcagggctaatatgttgcccacttcttgcagagcaggaaggcct
ttggagtcaggcagaattgggctctcatccaagtccttgtaacttgtggcagaagaaggg
EXON 9  596 bp
ggcaagacccccatctctaaaaagcaaaaacaagaaacccagattttatcgtggatggaa
tacatgtataatcttaccatttgcagaagagaacatttatctagaggtaacttacagtct
aagttgtttcacacatgatacatagagaaaaagattaatttctgtattctctttctttag
GTCTAAATTACATTATTATGGGCCAAGTAGGTGAAGATGGGCGAGGCAAAATCATGCCAA
ACAGCTTTATCATGATGTTCAAGACCAAGAATCAGAAGCTCCTGGATGCCTTAAAAAATA
AGCAATGTTAACAGTGAACTGTGTCCATTTAAGCTGTATTCTGCCATTGCCTTTGAAAGA
TCTATGTTCTCTCAGTAGAAAAAAAAATACTTATAAAATTACATATTCTGAAAGAGGATT
CCGAAAGATGGGACTGGTTGACTCTTCACATGATGGAGGTATGAGGCCTCCGAGATAGCT
GAGGGAAGTTCTTTGCCTGCTGTCAGAGGAGCAGCTATCTGATTGGAAACCTGCCGACTT
AGTGCGGTGATAGGAAGCTAAAAGTGTCAAGCGTTGACAGCTTGGAAGCGTTTATTTATA
CATCTCTGTAAAAGGATATTTTAGAATTGAGTTGTGTGAAGATGTCAAAAAAAGATTTTA
GAAGTGCAATATTTATAGTGTTATTTGTTTCACCTTCAAGCCTTTGCCCTGAGGTGTTAC
AATCTTGTCTTGCGTTTTCTAAATCAATGCTTAATAAAATATTTTTAAAGGATTAC
agaacaaccactaaacttctttttatagatagtgggacattgtagaaggaatattccctt
ttagcaataagaatagtgtgatttatgcataagattgcctttgtatcaatttacactttg
ctaaaagagcattccaagaatttcagggactaaatggatccagtaatgtcaatagactat