Gene NR1I2 Variant 3
DNA : 35.77 KbNT_005612
mRNA : 2742 bp NM_022002
CDS : 1422 bp NP_071285
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  143 bp
gcctcctagaaaaatcaccacaggagaagccttaactactgcatgagttaccacaagtca
cacatacaaccagctccctgttacagggctggagtccctggacccaggaaataccacctc
caaggactgtgggagctggggactatgggaactgggatcaactcagtcctgattcctttt
GGCCTGCTGGGTTAGTGCTGGCAGCCCCCTGAGGCCAAGGACAGCAGCATGACAGTCACC
AGGACTCACCACTTCAAGGAGGGGTCCCTCAGAGCACCTGCCATACCCCTGCACAGTGCT
GCGGCTGAGTTGGCTTCAAACCA
gtgagttttctacctctactattgaaagggcaccttgtcccacagaaccgagtcttgcct
gcatgtggtcagtgccaccaggtccttcttctctccactttacagcccagctcggctgaa
gctatggccagaggcactgctttaaggccactccatatctaggacaggtcaacagacacc
EXON 2  219 bp
tacagctctctttataacaattccaacccccattccccgctttttttccccatgagaggt
cagctcccgagttcacaggcccaaatgtgagtgatgcatagaagggacagagtgtttcct
ctgaggcctctacacatccctgtccagtcttttcattctctgtggttttctcatttctag
TCCAAGAGGCCCAGAAGCAAACCTGGAGGTGAGACCCAAAGAAAGCTGGAACCATGCTGA
CTTTGTACACTGTGAGGACACAGAGTCTGTTCCTGGAAAGCCCAGTGTCAACGCAGATGA
GGAAGTCGGAGGTCCCCAAATCTGCCGTGTATGTGGGGACAAGGCCACTGGCTATCACTT
CAATGTCATGACATGTGAAGGATGCAAGGGCTTTTTCAG
gtagagttacccatcagccttcacccacgtgccaccactgacccactgggtaacgtctca
gggcctcagcttgacctgtcccccaggttcagagtgtgggctggtggcccacccaaaggc
cttgtaattagtctcaagggagccatttatatcccagaggaatccttcatcttcagtctt
EXON 3  134 bp
gacctctagggactcccacctacacccttcccataaagcctgacccagctgggacgcaaa
ggctagtgtccccctccccgagtcggtaggggctggggagggaggtggtatggcccggag
ccccaggccgagggcccgggcacccgtgcatccccccttctgctccccattctctcacag
GAGGGCCATGAAACGCAACGCCCGGCTGAGGTGCCCCTTCCGGAAGGGCGCCTGCGAGAT
CACCCGGAAGACCCGGCGACAGTGCCAGGCCTGCCGCCTGCGCAAGTGCCTGGAGAGCGG
CATGAAGAAGGAGA
gtgagcagtgggcgcgcgggcgggccggcgccggggtgcacggctctgagtaaggacgtg
ccgtgggtgtgggcatgcttgtgtggagatgcgcgccgagtgtgcgcgtgaacacacgtg
cacatgtgagctggtgtccgtgtgcaacaggcagccacctgggggagcgcttgcagtcgg
EXON 4  188 bp
gtttctccagaagagcccacaggcctcttgagtccagacaggggagaattgcttgtcacc
attactttctcttttgcctaacggcttctgctgccttgagagggttacacagtggctctc
cagggggctggaggctcaccaggggcacgtgtgcctgagccagcctcactgtccctgcag
TGATCATGTCCGACGAGGCCGTGGAGGAGAGGCGGGCCTTGATCAAGCGGAAGAAAAGTG
AACGGACAGGGACTCAGCCACTGGGAGTGCAGGGGCTGACAGAGGAGCAGCGGATGATGA
TCAGGGAGCTGATGGACGCTCAGATGAAAACCTTTGACACTACCTTCTCCCATTTCAAGA
ATTTCCGG
gtaggaggaactgcacagtgacccgaggtgtcactgccatcttcattctcacatagaaac
tgaggttccccaaggataagaaacttatacaaggtcacagctaatcagtggtggagggta
gatttggagagctggtcctgcatctgtgctagctcctcaaagccttagtctcattcccaa
EXON 5  275 bp
aaatgctgtgtgtgtatatgtgtgaggacacacgcatgcatgtgggtgtgaatgcctgca
tttgtgcatcctctcgagctgcaactgtggctgtgcatgtttggctggggcctgagttgg
gacctgtctatgaaagcacatgctgtctctcctctgtccacctcctggcatgtgtcctag
CTGCCAGGGGTGCTTAGCAGTGGCTGCGAGTTGCCAGAGTCTCTGCAGGCCCCATCGAGG
GAAGAAGCTGCCAAGTGGAGCCAGGTCCGGAAAGATCTGTGCTCTTTGAAGGTCTCTCTG
CAGCTGCGGGGGGAGGATGGCAGTGTCTGGAACTACAAACCCCCAGCCGACAGTGGCGGG
AAAGAGATCTTCTCCCTGCTGCCCCACATGGCTGACATGTCAACCTACATGTTCAAAGGC
ATCATCAGCTTTGCCAAAGTCATCTCCTACTTCAG
gtaggacatggagactgggtggttgggtgtggaaaagaactggaagtggccaggaggttc
aaagggcctggggtagatcctgaatttgggggatattggtgtcagaagaccctccttttc
ctgtgccctttccccgggcagccagtgctgctggggagtagagcccttgctgtatggctg
EXON 6  143 bp
gctgggttgtgaggggagagatgagaggcagccagacagcagccacagtcatcctcaggg
aaaggagccatcctccctcttcctctcgcccccaacttctggattatgggatggctgctg
gtgccggtctgtgggctgcctcccagggagctgtcctcccctccccatccttgctgccag
GGACTTGCCCATCGAGGACCAGATCTCCCTGCTGAAGGGGGCCGCTTTCGAGCTGTGTCA
ACTGAGATTCAACACAGTGTTCAATGCGGAGACTGGAACCTGGGAGTGTGGCCGGCTGTC
CTACTGCTTGGAAGACACTGCAG
gtgcccgagagagcctgcctgccctggcagagggagggaaacactgcagttatgggagga
agggagctacgccaggatatgcaggttctgggatggcagggcaggaagatggaatggtgg
aaaacaagatattggtgagggatgattagatcttggtcagcttgctgagaagctgcccct
EXON 7  117 bp
ccctggcagagggagggaaacactgcagttatgggaggaagggagctacgccaggatatg
caggttctgggatggcagggcaggaagatggaatggtggaaaacaagatattggtgaggg
atgattagatcttggtcagcttgctgagaagctgcccctccatcctgttaccatccacag
GTGGCTTCCAGCAACTTCTACTGGAGCCCATGCTGAAATTCCACTACATGCTGAAGAAGC
TGCAGCTGCATGAGGAGGAGTATGTGCTGATGCAGGCCATCTCCCTCTTCTCCCCAG
gtgaggatctcccctaggctgcctgacatcccccccagccttatctgccctccccaggga
aggtcccagtctatggccttgctcctcattcactgcgcagccaggatgggggctctcgct
ggtttctcctggggtcagtgggtgatgcccagccctggtcttccttcacttccctgcctg
EXON 8  106 bp
tgggggctctcgctggtttctcctggggtcagtgggtgatgcccagccctggtcttcctt
cacttccctgcctgggtgactccagctctggagggtggttggcgagcaatgccctgactc
tgggctggactgagcttgtctttgccccatgatcttgcaccacacctccctcccctccag
ACCGCCCAGGTGTGCTGCAGCACCGCGTGGTGGACCAGCTGCAGGAGCAATTCGCCATTA
CTCTGAAGTCCTACATTGAATGCAATCGGCCCCAGCCTGCTCATAG
gtgagcacagcagggggtgaggacccgtgagggtgatgtgagggagccgaggttcaggga
aattgcccaagacttcatggccagagggtggcatctggaggtagccccagccagaccagg
tccaaagctcacacttttgagcactacctaaccacttcccaggaaaaacacaagcaaaca
EXON 9  1417 bp
caggctgttctgcctttctcatctacagggtaaaagagaagcttacggaattcagccaag
ccttgtctcttggctgacctgaaatgtccagagattatgcttgtgcagcctcagagcagc
cctgaggcttgtgggtcagggcgggctgcacccacaatcttttctctggctggcatgcag
GTTCTTGTTCCTGAAGATCATGGCTATGCTCACCGAGCTCCGCAGCATCAATGCTCAGCA
CACCCAGCGGCTGCTGCGCATCCAGGACATACACCCCTTTGCTACGCCCCTCATGCAGGA
GTTGTTCGGCATCACAGGTAGCTGAGCGGCTGCCCTTGGGTGACACCTCCGAGAGGCAGC
CAGACCCAGAGCCCTCTGAGCCGCCACTCCCGGGCCAAGACAGATGGACACTGCCAAGAG
CCGACAATGCCCTGCTGGCCTGTCTCCCTAGGGAATTCCTGCTATGACAGCTGGCTAGCA
TTCCTCAGGAAGGACATGGGTGCCCCCCACCCCCAGTTCAGTCTGTAGGGAGTGAAGCCA
CAGACTCTTACGTGGAGAGTGCACTGACCTGTAGGTCAGGACCATCAGAGAGGCAAGGTT
GCCCTTTCCTTTTAAAAGGCCCTGTGGTCTGGGGAGAAATCCCTCAGATCCCACTAAAGT
GTCAAGGTGTGGAAGGGACCAAGCGACCAAGGATGGGCCATCTGGGGTCTATGCCCACAT
ACCCACGTTTGTTCGCTTCCTGAGTCTTTTCATTGCTACCTCTAATAGTCCTGTCTCCCA
CTTCCCACTCGTTCCCCTCCTCTTCCGAGCTGCTTTGTGGGCTCCAGGCCTGTACTCATC
GGCAGGCGCATGAGTATCTGTGGGAGTCCTCTAGAGAGATGAGAAGCCAGGAGGCCTGCA
CCAAATGTCAGAAGCTTGGCATGACCTCATTCCGGCCACATCATTCTGTGTCTCTGCATC
CATTTGAACACATTATTAAGCACCGATAATAGGTAGCCTGCTGTGGGGTATACAGCATTG
ACTCAGATATAGATCCTGAGCTCACAGAGTTTATAGTTAAAAAAACAAACAGAAACACAA
ACGATTTGGATCAAAAGGAGAAATGATAAGTGACAAAAGCAGCACAAGGAATTTCCCTGT
GTGGATGCTGAGCTGTGATGGCGGGCACTGGGTACCCAAGTGAAGGTTCCCAAGGACATG
AGTCTGTAGGAGCAAGGGCACAAACTGCAGCTGTGAGTGCGTGTGTGTGATTTGGTGTAG
GTAGGTCTGTTTGCCACTTGATGGGGCCTGGGTTTGTTCCTGGGGCTGGAATGCTGGGTA
TGCTCTGTGACAAGGCTACGCTGACAATCAGTTAAACACACCGGAGAAGAACCATTTACA
TGCACCTTATATTTCTGTGTACACATCTATTCTCAAAGCTAAAGGGTATGAAAGTGCCTG
CCTTGTTTATAGCCACTTGTGAGTAAAAATTTTTTTGCATTTTCACAAATTATACTTTAT
ATAAGGCATTCCACACCTAAGAACTAGTTTTGGGAAATGTAGCCCTGGGTTTAATGTCAA
ATCAAGGCAAAAGGAATTAAATAATGTACTTTTGGCT
agaggggtaaacttttttggcttttttctggggaaaataatgtgggggtgtggaaataga
aacatacgcaagcatacatatttttactacttattttattattatcctgtataaatctga
agactccggcgtaagaacataaaaatgaattatttaacttggcttacttataaaatgatt