Gene NME6 Variant 1
DNA : 6.79 KbNT_022517
mRNA : 697 bp NM_005793
CDS : 585 bp NP_005784
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  60 bp
ggcaaatgcatgcgcctggaaaacccgccaccctccagggcaactcacacctcacctcac
gccgcggcgcaaccggactaggaccccgagcagggctgcccagggagcgcctgaaggacc
ctgcgagggccgcaggctatccagcgtggcgcctggtggccgggccctgtgccggaggac
AAGGTGAACCCGCAGCCGGACTTCTGCTGCACTGGGGCTCCGAATGACCCAGAATCTGGG

gtgggcttaggccccgggtacgaggggtgagggctgcgcggttgcaggcctagagaagta
gggggctgggtcgagagttgaggccgtgagcccggggggctggagggcgtggccacgggg
gtaggggcgcaggtcccggccgcgcgtgggtggaccagggctgggccgccgccctccagg
EXON 2  97 bp
atcccatgagcccaaatgggcaattaaaataatgtatatggccttaagatgaaactgtca
ggttctttatgagtgtcaggagtgagagcactcgttggcttgcaaggctgcgtggctcca
atgtagggaaggctgggagtgccgtcctgaagggttcctaatacagctctctaatggcag
GAGTGAGATGGCCTCAATCTTGCGAAGCCCTCAGGCTCTCCAGCTCACTCTAGCCCTGAT
CAAGCCTGACGCAGTCGCCCATCCACTGATTCTGGAG
gtaagaatgaatcctaagtctctaccgcatgccctgggaattgctactgcttcaggtgcc
attgggccatttatggtgactgacaacacagacttgtgctggatgctgtggaggcaaagc
tagaagccatgaactctgacctaaggagactaagaatccattggagacttgaggcagacc
EXON 3  103 bp
tttcacccaaggtgcacactctggctgtgtgactgaaggtcttcacctcaccccacctcg
tcttctcacccttcaatgggacaaaccctcaggtcctgagcaacaagtggtcctcatggt
ttcttttggtcagtttcagtctcctgattgatttttattttggggatggtctttattcag
GCTGTTCATCAGCAGATTCTAAGCAACAAGTTCCTGATTGTACGAATGAGAGAACTACTG
TGGAGAAAGGAAGATTGCCAGAGGTTTTACCGAGAGCATGAAG
gtaggatcagtagtcctctgaatggaaggtgcctcaatcccaagaggccataagagagat
tttacctggaacacaatggcaggctctctgacctaccaaccgtgtacagttgcagccagt
tttctaaaatcttggtttaaaacacacacttttcatgattatccatcttttcccaaggag
EXON 4  40 bp
aaaactacgcaggttgtaagtggcagaccctggattcagacccaggtttgtcagactcca
aggtccttgttcttttctctgaaacaatttttattattctaggtaaggaggtagaagtac
agaaagttgccttgggcaccaggatgaaggtatcttgatgaaggtcctctctctttgcag
GGCGTTTTTTCTATCAGAGGCTGGTGGAGTTCATGGCCAG
gtacttcaaatttggttccagcatctttatccactgaggctaatctcccctgcccctaaa
tggatttgttcatttcactgccattctttaaagttgtaatcaggccaggcacggtggctc
atgcctgtaatcccagcactttgggaggctgaggcgggtggatcacttgaggtcaggagt
EXON 5  161 bp
gcaggcttgatgtacaccagcaggggccctgcatcacctatttgaagcagcattggtact
cagctggaaaggcaggaaaactctcagaacgtagagtgtgtttttattcaggccctgctc
acagcacaccctcctagtctagatggccaggttctttacatgtgcttgttttgttcacag
CGGGCCAATCCGAGCCTACATCCTTGCCCACAAGGATGCCATCCAGCTCTGGAGGACGCT
CATGGGACCCACCAGAGTGTTCCGAGCACGCCATGTGGCCCCAGATTCTATCCGTGGGAG
TTTCGGCCTCACTGACACCCGCAACACCACCCATGGTTCGG
gtgagtcccctgtccatagccataggatattttggggttagcgggcaggctgtgtggtag
agttgacagccaggtccctccagtgagctttcttccatttgtgtttctggtctttgtagc
catgttggcagatgtggcctgtggactttctttacatgccccaggactgaaggggcaggc
EXON 6  236 bp
cttccatttgtgtttctggtctttgtagccatgttggcagatgtggcctgtggactttct
ttacatgccccaggactgaaggggcaggcagagtagaggctcaggattctgaacctgatt
atgactgcctcttgcttctaccatgtgagaaccccttctctgtcttatctccccttacag
ACTCTGTGGTTTCAGCCAGCAGAGAGATTGCAGCCTTCTTCCCTGACTTCAGTGAACAGC
GCTGGTATGAGGAGGAAGAGCCCCAGTTGCGCTGTGGCCCTGTGTGCTATAGCCCAGAGG
GAGGTGTCCACTATGTAGCTGGAACAGGAGGCCTAGGACCAGCCTGATGCAGGTCTATGA
AGACCAGTGGTAGTGCCCAGACTTCTCCTAGACATCTAGTCTAAAACATTCTCCTA
ggaccagggaagcctggcttacagtgccatttctgctgggcaccaccacctgcctgaggg
cctagctcaccacagcacatcctccaggatctagccttctatctacctcttctctggaat
gtttatggtggttcagaagaatgatgactcctctttgctgagaactgttcatccttcttc