Gene NLGN1 Variant 1
DNA : 884.87 KbNT_005612
mRNA : 4918 bp NM_014932
CDS : 2472 bp NP_055747
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  34 bp
ggataagaaagttgctcttcttccccacaacgtttcctgagaggtggttttcagatctgt
gtgtttccagtcaagatgtcactccctagatcccccgcgttgagcaactaatatattatg
cattattgggcaataaactctcctgggaagagaaggtattccaaacatttaaaccgttct
CCACCGACTCCTGCCCGCCTCAACACAATGCCTT
gtgagtagaaatgaaaaaccacctgaatttaaaattatttaggttgagattttgcattgg
gaataatttcttccagaggaggttgttagtgtgttatagagatgagggatattacatgtc
caatatttgattcatttgtgataattctaaatcatgaacagttggcctccacaaaggtac
EXON 2  69 bp
tgttgttggaaactcctaagtgtagcacatgctttagaggaaattttttggtcatttggt
ctaatgtaaaacttaaaaggtggcctgaaattcacccaccatttgaaaatacgtagttgc
tcagttccgtgtcactaattctctgctttctctttgctttctgacacttctgaggagcag
ACCTGTGAAGCTTGAGGCCACTCAAGTTCCAAATTTGTGACAAATCCCCCAGGGCTCACT
GGAGTGGCA
gtaagttctcgcagtttgatttcctttcaatcactgaagtgttagaaaagtagtaacaaa
agctcccacggcaaaacagcaattctgtttcctgaccatccaccatagtcatgacttacc
tcttttgttccattgatttttctgttgaacaattttaatacttttagccatacaatatgc
EXON 3  813 bp
aatcttataatcagttagtttacttgtcatctcacttcaatcgatgattttcctatggta
acatttaacttacctgatgctagtcattattaatgtatttctgtagattgtaaaacatct
agttatcacactgtctatgttagcttgttccagctcatgatttattttcattttttctag
GATATAGACCTGCAGCTAACTGGATTTGATTTATAAGAGAGAAATCTGCAGTCAATGCCC
ACTCTTGCCACACTGCTAATATGGAAAACAGAATGTTCAATAGGATATGGTCTGATAAAT
AGTGATGATTGAAGATGCTGCTCCAATACATGTGAAATCAATGGGAGATATCTGCTGTCT
GAAGATCTTTCAGAGCTTTTCTCGACAAGCTCCCCTGTAAGAAATCGGAGGTATATTCTA
CCATTATACAGTCTTTCTCAAGTGGATATAAATACGTTTGCCTCACTGTAACCAGACAAC
TAGACAACTAATGTGGGACCATGGCACTGCCCAGATGCACGTGGCCAAATTATGTTTGGA
GAGCAGTGATGGCATGCTTGGTACACCGGGGATTGGGTGCCCCATTGACTCTCTGTATGT
TGGGATGTTTGCTTCAGGCTGGCCATGTGCTATCACAAAAATTGGATGATGTGGACCCAC
TGGTGGCTACCAACTTTGGAAAGATAAGAGGGATTAAGAAGGAACTCAATAATGAAATTT
TGGGGCCTGTTATTCAATTTCTTGGGGTTCCATATGCAGCCCCACCAACAGGGGAACGTC
GTTTTCAGCCTCCAGAACCACCATCTCCCTGGTCAGATATCAGAAATGCCACTCAATTTG
CTCCTGTGTGTCCCCAGAATATCATTGATGGCAGATTGCCAGAAGTCATGCTTCCTGTGT
GGTTTACTAATAACTTGGATGTGGTTTCATCATATGTGCAAGACCAGAGCGAAGACTGCC
TATATTTAAATATATATGTCCCGACTGAGGATG
gtgagtttattgcaggaaaaacagggagatatatttatatattttttctattctaagttc
taacaatattaattcatgtgtactggtagtatgcatggcttttcctgttggcatgtagac
atattttacatgcgtgcatggtgctctttttgtttatgtgtgtcagtgtatctgtactta
EXON 4  153 bp
tattgctatttccacaatagctattcatatgagttgcttaagaaacactttaataaaaac
agcagtttaagaactatattgaaattatgccctcttttcactaagatggaaaatgtattc
tctgcttcattgtgtgttatttttgaggataagaacgattgccaaccatttgttttccag
ATATTCGGGACAGTGGGGGTCCCAAACCAGTGATGGTGTATATCCATGGTGGCTCATATA
TGGAAGGTACTGGAAATTTATATGATGGAAGTGTCTTGGCAAGTTATGGCAATGTGATCG
TCATCACAGTCAACTATCGACTTGGAGTACTCG
gtaagaagagtctctcttttgttttcaccatgaatccatgaagtatgtgatggttttgtt
ttgacttgttttgttctgctttgctttgtttcacccatttttttatgcgtgttgacattc
tcgagcccaaattttttatagtttcaatgaattctataggttggttttaagatgtgaaac
EXON 5  213 bp
ttcagccactactaactattcttgctaaagtaaattcttttgttatagtggaaaataatt
tttactaatgaacttggactgtccctaccttgattaatacaggcttcatttgtgtttaaa
tttgatgtctatttgattcacgtcagctcaaaacgtgttttctaaatttatatttttcag
GTTTCTTGAGTACAGGCGATCAGGCTGCAAAGGGGAACTATGGACTCCTTGATCTCATAC
AAGCTTTAAGATGGACTAGTGAAAACATTGGATTCTTTGGTGGTGACCCCTTAAGAATCA
CTGTTTTTGGATCTGGTGCTGGGGGTTCATGTGTCAACCTGCTGACTTTATCCCATTATT
CTGAAGGTAACCGTTGGAGCAATTCAACCAAAG
gtattatgcaaggttgcaaattttgacaattttggtgtctgcatgccaccaccatcagta
gtatgtgatgctctgtatatttctctgttcaaactgagtgttaggttgaactcaatagtt
taaagctttgtttcttcagtttttctgtgcatgtttaaattttcgtcaaactcttttctt
EXON 6  790 bp
ctctaatccattataccctgcggttggctttgtgtacttcccttaagaaaaatatctcta
actccctgtttcttgagctgtatctgggtttttatatacatgtctaaaatatcagatgtt
attgttttaccacaacattacccaaagatcatctaaaattctttgttgattttcccatag
GACTTTTTCAACGAGCAATAGCTCAAAGTGGAACAGCCCTTTCCAGCTGGGCTGTTAGTT
TTCAACCTGCAAAATATGCTAGAATGTTGGCCACAAAAGTTGGTTGCAATGTTTCAGATA
CAGTAGAGTTAGTGGAATGCCTACAGAAGAAGCCTTACAAAGAACTTGTTGACCAAGATA
TTCAACCAGCTCGATACCACATAGCCTTTGGACCTGTGATTGATGGTGATGTAATACCAG
ACGACCCCCAGATATTGATGGAGCAAGGAGAGTTTCTCAACTATGATATAATGTTAGGAG
TGAACCAAGGGGAAGGGTTAAAATTTGTTGAAAATATAGTAGATAGCGATGATGGTATAT
CAGCTAGTGATTTTGACTTTGCTGTTTCAAATTTTGTTGATAATTTATATGGATATCCTG
AAGGCAAAGATGTTTTGAGAGAAACCATTAAGTTCATGTATACTGACTGGGCTGACCGTC
ATAACCCTGAAACCAGAAGAAAGACATTACTGGCTTTGTTTACGGACCATCAGTGGGTGG
CACCAGCTGTAGCCACAGCGGATCTTCACTCAAACTTTGGTTCACCTACGTACTTCTATG
CCTTTTACCATCATTGCCAAACAGATCAGGTTCCAGCTTGGGCTGATGCAGCCCACGGAG
ACGAGGTTCCCTATGTACTGGGAATCCCCATGATTGGCCCTACAGAGTTATTTCCTTGCA
ATTTCTCCAAAAATGATGTGATGCTGAGTGCAGTTGTAATGACATACTGGACAAATTTTG
CTAAAACTGG
gtatgtacctaaggaatgaagtttatttttaataaaaatgttattttaaccattttaaaa
taatagatatttatgcccagataatgtcatattggattaatacctgcaagatattacatt
cctttattcaaaattaattctatattatggtgtttttaaaagtcattgctttattatttc
EXON 7  2846 bp
tcacccatctaacaatatgcctgctaggagatttatatttctaaattgacccaaattaat
gttaaaacacaatctaaagcattgctgagtcatctatttaattattagatgttaaagtag
tgtgattttaagtaaaaaataaaatagctttattctcataatttatcttttccttcttag
TGACCCAAATCAACCAGTCCCTCAAGACACGAAATTCATTCATACCAAACCCAACCGTTT
TGAAGAAGTAGCATGGACCAGATATTCCCAGAAAGACCAACTTTATCTCCATATTGGATT
AAAACCAAGAGTTAAAGAACATTACAGAGCCAATAAGGTGAACCTCTGGTTGGAGTTGGT
ACCTCATCTGCATAATCTCAATGACATTTCTCAGTATACCTCTACAACAACTAAAGTGCC
ATCAACTGACATCACTTTCAGACCTACGAGAAAAAATTCTGTACCTGTCACGTCAGCCTT
TCCCACTGCCAAGCAGGATGATCCCAAACAACAACCAAGTCCATTTTCAGTGGATCAAAG
GGACTACTCAACAGAGCTGAGTGTCACTATTGCAGTTGGAGCATCACTGCTGTTTCTGAA
CATCTTGGCCTTTGCAGCCCTGTACTACAAAAAGGATAAGAGGAGACATGATGTTCACAG
GAGATGCAGCCCTCAGCGCACTACTACCAATGATCTAACCCATGCACAAGAAGAGGAAAT
CATGTCCCTCCAAATGAAGCACACTGATTTGGATCATGAATGTGAGTCCATTCATCCACA
TGAGGTGGTTCTTCGGACCGCCTGTCCCCCAGATTACACACTAGCTATGAGGAGGTCACC
TGATGATGTTCCCTTAATGACACCCAACACCATTACAATGATTCCCAACACTATACCAGG
GATTCAGCCCTTACACACATTCAATACATTTACTGGAGGACAGAACAATACTCTGCCCCA
TCCCCATCCCCACCCCCATTCACATTCAACAACCAGGGTATAGCCAGATAAGAGAAACAA
ACTATTTTTTTTGATGGATTGCAGTAAACGATCACTGAAGATTCCTTGGCTTTCAACCTA
CAAGACTTACTATTTAAATAAGGAGGAATATTATGTGAATATACATATCAAGAACTTTGG
GGGTTTTGAAAAAAATGAATTGTATATATACAAATCAACTTTAAAAACAAATTTCAATTG
CTTGAAGCAATTGTTCTGAATGATACTTTTTCATTCACATTCAAGAATTAATTTTTTGAA
GATTTAAGTTACATAATGGAATTAGGCATGTGGAACACCAAACAGGAAAGAACTATGTCT
GAAATATAAAAAATAAAAATAAAAAAACAACTATGAATATGCACAAGGGACACACCAGTG
GAATGTCAGATAATTTTCACCAGTTTTTATTTGGAGCCGTTTTATTGTGTAGACCATATT
TACATATTTGGATAAGTACACAAAGCGTCAATGCTGTTAATGGCCTTAGCAAAGGCTCAT
GCTGAAATTTGCCAGTAAAACAAAGAAGTTTAAAGACTGGCAGGTACACCATTATCACAT
AAGTGCTGTCAGTATAAAGTTGTGGGGATAAAGGAAACTGGATATTTTTAGCACGATGTG
CATGATAATTTATATGCTTGGTGGCTGTGCTGCTGATTAAGCCGTAATTAAAATTCTTCT
CATCCCATTGGAGTTTTTAATAGAAGCTTCCTCCATCAATTGGCAGAACCTAAAGAAGAT
TTTAAGGGGCAAAAGTAATTACAATAAAATAATTCACAGTAGTTTCAATATAGAAGGAAT
TAGCTATTAAAGGTATTTGAAGAAACTATAGGTATAGTGGTGAATACTCGCTGATATGAA
TCCCAGAAAAAAATTTCCTGTTTTTAATGTTCTTTTCAATCCCATCTAGATAATTTATAG
AAATATAACCCTAATTGGACATGTGGTACAGGATCTATAAGTTGCTGTGTTTTTTTGTTA
CTCTGTATTTTGTTCCTTTTGGTAAGGTGAAGTGTGTCCAAAGAGTTACTTGCAACAGTC
TTTCATGATATGAGGATGCCCCCGTATTACCACTCTGATTATAGTTCTGAGTTCTTTGAT
TTACTCATGCTGCATGACAAAATGTTTACTAATAACAATTCATTATAAAGTTATATCCCT
CTTTACATCACTTATCTTTCTCACTGAGGTTCATTCACTGGAATTTACTCACGCAATCTC
AGTAGAGTACAACGTAGATACAGAACCTAGGAGAGTCAACATCTGGAGGATTTTAGTCTT
TCTTACACATATGTGTGATTTTAAACGAATATTCTCAGACCACAGGAAACTCTTCATCCC
CCTGTTGTTTACCAGTAACAGTATATCACAGACCTTTCCAAATGTTTGTATATGTAATCA
GATGTACATTTATATTGAAAAACAAATGAGATGGACTTAAAGAGCACATCCTGATAAATA
CTTTCTCTCTCACCTGTACTATATTTCTATTAGACTAAAGTTATGTGATTTTTTTTTTAC
ATTTTTTCAGATGACTAGCAATTTTGATAGTTTATAAGATAATGCAAAGAACTTTCTCTG
ACAAACTAACTGCAGTAACAGAAACCTTTCTTTTCAGTTACTCTTTTTCAAGAATGAAAG
ATTATTATACAAAAAATTGTATACTACTTGATGGAACCAACTTTGTACATCTTGGCCATG
TCACTGGTCATTGTGTGAAATAAAGATAATCTGGATAATGACTATTAGTCCAATGCTAAG
AAACATGATCTTTGCTCATTAAAGAGCTAAAATGTTTATTGCTGTTTTGTCTTTCTTTTT
TCTAAAAAAAGAAAAAAAAGAAAAAAAGGAAAAGAAGAACAAAGAAACATGACTGTCTCA
AAGAGTAATTTTTCTAGATTAGACCAGTCAGGTTTTTGAAGACATATAGGTAACTTCCAC
AGAAAACACAAACATGTATTTAAAGGCAAGTCTCATCTAAGATGAAACTCATAAAAATTA
TTTAATGTTTGTTATGAATTTAAAAG
ctccagaaatccatgaaaaaaagaaagattagctttgtgttgttaaatatctcttaggta
cagatgttgtagaaataaagtgccaattgttttcagttagttagaaaaacaagttccaat
tctagtcatcaaggaaaaggtctattgaaaagaaatttgcaatatttcatggaatacaaa