Gene MYRIP Variant 1
DNA : 450.51 KbNT_022517
mRNA : 4870 bp NM_015460
CDS : 2580 bp NP_056275
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  105 bp
cgcgggcgcctccctcgcagccgctgctgccgacgccgctgcgctcccgcctcctgtcgg
ttcccgggttcccgctgcggctgcggttctggcagccgagcccccgcggtgctgcagccc
agctttagcgcgcagaccgacccgcgccccttcttcgccgccggcagcctctaatccacg
CGGCGCGTTGCGGCAGGTGCCCTGGGCGTACTGAGGCGCGGTGGCCTGAGCCCGGCCGCC
ATCGATGACCCCGGTCGCGGACTTGCTTCAGGCTGGCCACCCCCC
gtgagtaccgtccgcctccctcttctcccctctggcagctttgcgccactctcccctcaa
cgttgccgcaacttcgggggtgggtgtgtgaaggtgtggaggtgtctctcacgctccccc
gcaccctgtgcgcgtccggagccaggaaccctaggcgcggccagtcagcctctgcggagg
EXON 2  140 bp
ttctctgtggccttggtgaggtcatttgtaaatatttgctgagtctgagtcaagagaaag
atactaccttacataaacacttacatataaacactatatttaactctattttaataacaa
aataggttgattttgtccatgtagagattttatcttgcttgtatcattttggtttcccag
GTCTTGTTTCATCATCTGTGTTGAGTAACCATGGGGAGGAAGCTGGACCTGTCTGGTTTG
ACTGATGATGAAACAGAGCATGTTCTTCAGGTGGTTCAAAGAGACTTCAATCTTCGCAAA
AAAGAAGAAGAACGACTAAG
gtgagatgcctgttttgctcagcagcgtacagcaaaccacatgtggacaagcgtaacagg
tttcctgagggtattccctcctgctagccctgagtttggatatacacttatgtttgtcag
aatgtcctgtcctttgtagaaaggtttgccagtttcagaaatgtcagttcagaaatgtgt
EXON 3  222 bp
atgttcttctctggacataatgttgagcagttgatctttctgagttctcttgttctccag
gaaggtcctacatggtagcttggcctaagggagggacagggtgcatgctttggggagaca
ccccctgacctgatgttgtgtttctctcctcctcccatttcccctaccttggtttcccag
TGAGCTGAAGCAGAAGCTGGATGAGGAAGGCAGCAAGTGCAGCATCCTCTCGAAGCACCA
GCAGTTTGTGGAGCACTGCTGCATGCGCTGCTGCTCGCCCTTCACCTTCCTCGTCAACAC
CAAGCGCCAGTGTGGAGATTGCAAATTCAATGTCTGCAAGAGCTGCTGCTCCTACCAGAA
GCACGAAAAGGCCTGGGTCTGCTGCGTCTGCCAGCAAGCGAG
gtgagtggctggtgcattcccagggtctacactgttgatttagagagattcacctgccac
ttccttcagtcaggtagaaccagctatgattggtagatcaacacagagtattgaccaaag
taaatagcttgctgaagagagatgcatggataaggaaacctgttgatctttatagggagg
EXON 4  137 bp
aggattcacacaacatcactttcactattttctatggtcagagaaagtcacaaggcccgc
ccagattcaaggggaataaacttcacatcttgatggatggagctgtgaagcattgcagca
gttttgcaattcaccatttaataattctaattttgtgttgtctaattctgttttcctcag
GCTTCTGAGGGCCCAATCTCTGGAATGGTTCTACAATAATGTGAAGAGCCGCTTCAAGCG
CTTTGGCAGTGCCAAGGTTCTGAAGAACCTGTACAGGAAGCACCGGCTGGAGAGTGGCGC
GTGCTTCGACATTCTAG
gtactctcacttcctgccgctctgggagtctttggtgggctggtgggtagaaggcctggc
tcaggggccctgaacactggagcacactcacctgggacagataaatttgcttaaatatct
ggcaccagtgagaagcagaaatagaaggacggatgccagagattctgctaagttgtgact
EXON 5  81 bp
agcaatgggtcaaaactgttagcattattgtgggacctcatgagtccctaaacctatttg
caaggctaacaacccaagtgtgtaatagtggtctgccagttcagtgacacagtgcatcag
ggttcactgaagacctttgataatcatattcattctcttctcccacccctaccctgccag
GAGGAAGCCTTTTTGAGTCAAACCTGGAGAATGAAGGAAGCATTTCTGGCAGTGATTCAA
CATTTTATAGGCAGTCAGAAG
gtaaagttgcttaagagtttacagctactgggaagttggagtaatagaaacacctacagg
tacaggtactgccagggtcccccagatgcattgttaccccagatgcaactatctactact
gtgtgtgagtctccctgggtcacttattattgccaattgtatgaatccatcatcaaaata
EXON 6  98 bp
atgtgaatgatgcatgggaggcagtgtgaggcaggtgggaagggcgagggctttgtgtgc
catggtaaacagcttagaacttatcccagagcccctgaagaatttaagcagaagagcttg
aacaatcgttttactcatcattcccttttagaaatgctctttgttctgtttcctgtctag
GACATAGTGTGATGGACACCTTGGCTGTGGCCCTACGGGTGGCTGAAGAGGCCATTGAGG
AAGCAATTTCCAAAGCAGAGGCATATGGGGACAGCCTG
gtagggcccctcctgctcctctctgtggggggaggtgtgggttggggtccttgctgccag
gagaaagtgcaggttgtcaggaaatcaatgtcccagcagctctgactagagcaaggccct
ccctctgcttttgtggtcaggactctcctggcaaagtgactgccaagtcaccccaaatcc
EXON 7  81 bp
tgtgggttggggtccttgctgccaggagaaagtgcaggttgtcaggaaatcaatgtccca
gcagctctgactagagcaaggccctccctctgcttttgtggtcaggactctcctggcaaa
gtgactgccaagtcaccccaaatccacccacagcacacagccattctcttccctcctcag
GACAAGCAAAATGAGGCCAGTTACCTGCGGGACCACAAGGAGGAGCTAACTGAGGAACTG
GCCACGACAATCCTGCAGAAG
gtaggtgggtcctggcagtgggatggctgcagtttcctggctgggcctggtgcagggact
ctggcaagtagcaggtgaaacatggggagtgtctctagcactgtatcttctgtgccttct
cactttagacttttgtgccctggggacccatgcagagggaatgcatcgcactgcttgctt
EXON 8  144 bp
gaatgctcaaggctataattgtgctggtttctcatagcgcagatctgaaacagcctggtg
ttctgttgaaattaagcttataagtggctgaaaaaaattccaaagatggtcccagttact
ccacatagcatcaggaggcctctccaataacttgccccttttttgtcctcccctccccag
ATTATACGAAAACAGAAGAGCAAAAGTGAGCAGCAAGTGGAAGAAGAGCCAGGATGGCCA
CATCCCCAGAGTTGCAGCACAAAGGTGGCAGATGAGGGGACCTCAGCATCCCCTGGAGGC
TACCGTGCTCCCGCTGCCCTCTGG
gtgagtccccaagcagtgctggtctaccctccacacgtgcaggtctggggcacacattta
accctctgtagttgaatcaggtggccactggccagggtaaaaatttcagaaggatgggga
gcgaaattgaaagagaaagtgagtgtgagtcgggggccaggaagggtaagagaggagaga
EXON 9  154 bp
aataaacatttacctggccttatatactgatttgcagcttttaaggctcacgtgaaaaga
gccattaccattaaacatgttttctccatgctggacaatgtctgcccccaaaaggtgaag
gcacacctcccaggcactgtaccttatgagctcaccccttcccctctttcctttccacag
AGGTCCCAGTCTGCCTTCTCAATCACTGGAGAAGAAGCCCTGAAGACCCCTCCAGTGGAG
GCTCCATCGAGGCAGCCAAGGGACCAAGGCCAACACCCGAGAGCAGAGTCTGCTCTGCCC
AGCTGGAAGAGTGTGGACAGGCTGGATGAAACAA
gtaactgttttaagcagtatctagttggtctgtgggtttcaaaagtgtggtttggagaca
tcttggctattgcatggccactctgctcttcttcccataagtctgaactggtgtgtgtcc
ctctgggctaccaagtcatgaggcctccagcacaacacacaatatataatgtggtcatgt
EXON 10  638 bp
gattccttggggaactttgaactctgcccaccaattgggtttgccttcctgggcttccta
aaggcaactgctctccaacagccccacaagccactcttggggaggtaacaagtggcaact
tcatcttgcattaaagtgataacagcccctctctgctttctctatcctctccatccacag
ACCTGGCCCCAGTTTTGCAGAGCCCCGACGGGAACTGGGTGGCCCTGAAGGATGGCGCTC
CACCCCCCACCCGACTACTGGCCAAACCTAAGAGCGGGACGTTTCAGGCCCTGGAGGTGG
CCTCCAGTGTGGCATCTGCCTACGATGAGATGGGCTCCGATAGCGAGGAAGACTTTGACT
GGAGTGAGGCCTTGAGCAAGCTGTGTCCCAGGTCCCGGGCCCTGCCCAGGAACCCCCAGC
CTCAGCCCACACAGGCCCAGAGCTCTGACCAAGGCCCCATAGCTGCCTCCCCATCCTCTG
CACTCTCCCCCAACCCTGAGGCCATGTGCTCTGACTCGGAGACCTCCTCCGCAGGCTCTT
CCCGAGAAGTTGGGCACCAGGCCAGACTGTCCTGGTTGCAGAGGAAGGCCCCCAGGAACC
CTGCAGCTGAGAAGATGCGCTTGCATGGAGAGCTGGACGTGAACTTCAACCCCCAGTTGG
CCAGCAGGGAGACCTCGGACAGCAGCGAGCCGGAGGAGGCCCCCCACACCACAGACCGGC
GGGCCAGGAGGTGGAGAAGAGCCCGACTGGGCTCAGAAGAGCCAAGCAAAGAACCATCTT
CCCCCAGCGCCCAGCTCCGGGATCTAGACACACATCAG
gtaatggaagtgcatgcgtgcaaatgcacacacactctttaggtaggatgtgccctactc
caagcacaagtggcatagagtcctgggtttggaatccgcagacccagattctcatcttgg
ttttgcagctaagtagctgagtgcctctagacaggtcacatcaactctttgggactccac
EXON 11  240 bp
atttgagaaagtaaaggtaaaactaaaagtccatctgaagagaaagcagaccaggtaaga
aagctgttactttcctagactatatgttcctatgttcctttactcaggggttattgggaa
caagaagcaacatggctgtagcagagggctcctcatctcatgattctggctttcatttag
GTGTCGGATGATTTATCAGAGACAGACATCAGCAATGAGGCTCGGGATCCCCAGACTCTC
ACAGACACCACAGAGGAGAAACGGAGAAACAGGCTGTACGAGTTAGCAATGAAAATGAGT
GAAAAGGAGACTTCTTCAGGGGAGGATCAGGAGTCTGAGCCCAAGACAGAATCTGAGAAC
CAGAAGGAAAGTCTGTCCTCTGAAGACAACAGCCAGAGTGTCCAGGAAGAGCTGAAGAAG

gtaagggctgtgaagccacctgcagacagctcaagcttctgcagtggggtgttggagaaa
gatcctatattggtgcagaaagctgctgggtccccaaagagctctctctaaaatgcccat
ccctgtgcatttgggagagcctaagagaacccttcttaacttgcactggggggtacaatc
EXON 12  195 bp
ccctcagttctcttctgctgtgtctagtttaattttctcattcttcagcacattggtgtt
tgtgtgtggaattacagaatcaacctcatgatgatgagtgtcatgataacatagaatttc
tgtgtcattgttaatgtgctgttcttgtcttctgtccccttctgttatcggaccaaacag
AAGTTTTCTGCTGTTTCTCTCTGCAACATCTCCACAGAAGTCCTGAAAGTCATCAATGCC
ACAGAGGAGTTGATAGCAGGATCTACAGGGCCCTGGGAGTCCCCACAAGTCCCTCCTGAC
AGACAGAAGGGGATGTTTCCTCGTGGGACAGACCAAGTGAGACTGGATGAGCAGCTGACT
TCCCTGGAAGAAAAT
gtaagagggtatggaggtgccctgtctagggtgaatgtatgtgaagaagaagctgatgaa
attgtagcttatcgtgaagagtgcaaggacacacacatacacacacacaccactaccact
atagcaaatacattctcaggaaggaccttaggttggattccccagaagcagaccctagat
EXON 13  162 bp
gtgtcaagacctcacacatttaagtgtgaagaacgtttataaatgttataaaaataacat
cccccctgcaatgtgaagtccagttatctcactcccctgaattgctggggtcccctcaag
ggacccccaaccagtcccaagtctgcagacatgaactcaaatgtagcactgtctctacag
GTATACCTGGCAGCAGGCACTGTGTATGGACTGGAGACCCAGCTGACTGAGCTAGAAGAT
GCCGCCCGCTGCATCCACAGTGGCACTGATGAGACCCATCTGGCGGATCTGGAGGACCAG
GTGGCCACGGCTGCAGCCCAAGTCCACCATGCTGAACTCCAG
gtgagaactctcctctctgcccacatgggtcctgcagggtgaaacagggagccccatgtt
ctacaagaatcactttaaagccattgtatctatcagctcccatcatctccagcatgtttg
cgtggatacagtccttccagatggattccaccaaattctccctttaaaagtgtagtcctc
EXON 14  105 bp
tgtgttttattttcttgctacacactagatagaggagtgtttggtagaagttgaatgaat
gaatgaatgaatgagcatacatcaaagcagatttgtctttataaattcttaacactttta
agaaatattttccccttccgtattttctccctgccaatcttgtctttctgttgctttaag
ATTTCAGATATTGAGAGCCGGATTTCAGCCCTGACCATTGCAGGATTAAACATAGCACCA
TGTGTGCGCTTCACAAGAAGACGGGATCAGAAGCAAAGGACCCAG
gtgtgtttgtccctttctccctctgttggaatgttacatggcttggaaaatttagaagac
aaaatatctttggctctgcaaaggtatattgctcattgtgttctgtttgtaggtacaaac
catagatacatcaaggcagcaaaggaggaaactgcctgctccaccggtgaaaggtatgct
EXON 15  61 bp
ttgcaggattaaacatagcaccatgtgtgcgcttcacaagaagacgggatcagaagcaaa
ggacccaggtgtgtttgtccctttctccctctgttggaatgttacatggcttggaaaatt
tagaagacaaaatatctttggctctgcaaaggtatattgctcattgtgttctgtttgtag
GTACAAACCATAGATACATCAAGGCAGCAAAGGAGGAAACTGCCTGCTCCACCGGTGAAA
G
gtatgctaaattaaaaccacaaagctaccaaaaaattaagcctgaatcatttactttggg
taacaaagagacctgagtttgagaattagatctaatggagtgttctcacacagaattgct
cttgtctatcttgatttgggtccccccagaagcaaaccctgggacaaggataggagtgaa
EXON 16  119 bp
atttgtccatcataaaaataaacacaaaacaaaaagatcccatagtcaatcaaacacagt
acaggaatgagattccaagtctagaacaaaagtctgagtaatctggccaccttgtttttt
ccttaacaatcaatcagtccatcttctgggtaacattttttcccatttatttccttttag
CTGAAAAAATTGAGACATCTTCAGTGACTACCATTAAAACATTTAACCACAACTTCATTC
TCCAAGGCTCCTCAACAAACAGGACTAAGGAAAGGAAAGGCACCACCAAGGATTTGATG
gtaaatgtcatctctgtcttaatgttcaacgctttcactgttgatggtacctccactctg
cagcctttccttctgtagctcccgcatcagaacccccaaaaagtatccttcctccgtggt
cttatggtctgttggatttgactggggggtggacttagcagtaaaccaagagcagagtgc
EXON 17  2188 bp
caggtggattaagaagcatgcatttaaaaatgacatcagtttctaaatgttgtgaaacat
ctaactggtcaaaaagcatgaatagcttttgatattaaaaagcagtaaacattatttttc
attgcttcttctcactcttcccaagtggctgatgggagtgtgttcaatgtctcacctcag
GAGCCTGCTCTGGAGTCAGCTGTGATGTACTGACACCATGGAATTCCACTGCCAGTGACC
CACTGCCTCCGGCCGTACACGACAGTGCCTTGACCCAACAGCCATCGAGTACTGTATGTA
TTTCCACCTGAGGAGAAGGCCTGGGGAGGCCACAGTGCACCATTGCACAGGGCTGTCCTG
ATACCTCATCCAGAAAGCCGTCTCAGACTTCAGCACTGCGGTCTTGCCCACTCTCTGCCT
TAGGCTCCCAGGGGAATCCAAGACAGAAAATGAAGACACTGGCTTCCAACAGCAGCGCTC
CATGTTTAAGATACATATTTTCCCTGTTTGCTTTGCTACTGTATGTTGACTTTAAGATCT
TTTTTTAAATACATTTGATTCAGCTAGTATTCCATGTCAACAATTTGTCCAAAGGAAAAC
TGCTGGAGGGAGGTGGAGGGAGGAAGGTGGGAATTATTATTTAATACATCATTAATGCTT
ATTAATCTCTCACAAGCATCTTTGTCTTGCAAATCCTAAGGGAAAAGCAAGTCCCTGCAG
TGAGCACTAGGGACAGTCTAATTTGGGGATTGCTCAACCATCAAGACTGCAGGTCTCCCT
TCAGCCACCTCCTTCCTGCTAAAAGCTTAGCCTACCACACTACCAGTCATTCCCATCGCT
TTGCAATCACAAGCCACAGGATGAGAAGTTCTGACTCACTCATGCCATGCCCAGGGCTAT
CTGAAACAATGTCTCATTAAGAATTTAGGGTTCTTCCATGGGCTTACTGACAGTTGCCCA
GATCTGAAGGGGAAAGGGTCTTGAGAAAGACCATCACTGGCTCAACTTTAGGGCACTGTC
CAGAGTCAACATGATGTGGTTTAGCAGTGATCACATCTAAACAAAGTTTAGGTAAATGAA
TTATCGCAGAGAAAAACCACATGAGAAAATTTTTGTACTCCAAATTTACTTCCCAATAAA
TATTCAGCAAAGTAGTAAAATGACCTTAAAGATAAAAATGATTAGGGAATAGCCTTAGAA
AATTTATAGGTATAAAAAATTCAAGGACAAACTGTGCATTTAATGGACACAAGAATTGAC
TCTAACTCCATGTCTGTGGTTTCTTTGAACCCATATCAAATGTATGACTATTTAGAGTGT
TTATAAGAGATAATGGAACTGAACTTTCACTCAATTAATTGGGCATTAACAACCTTCTTT
TATGTTTGTTCCTGATATAGTCTGAATCTTAGGAAGAAGGTAAAAGAAAGGAGGCAAGAG
AATAGTTATGATGAATATGTGTTAAGTGCCTGCTCTGAAGGAGGCAATGTTCTTCTCATT
TGAATCCTTATGGCAACCTTATTCAATAGGTTTTCCCATATTTCAGATTTAATAACTGAA
GGCCAGAGAGATTAATTTGCCAAAGCCACACCTTTATGCTAATTATGATTGGAATGCATC
ACAAAAGCCTAACTCTGTTGTTTTCAACCTCTACGTTATTTTGCTGCTATGTGCATTTCC
AGATCTGATTTTCTGCTAACTTGTGTGCTATGATCCACTCCTGATGGGGGTCTACATTAA
TCTTCCAGTACTCCTTGCTGATGCTGTGTTATGTGTCATCTAACAGAAATGACTCCTTTG
AAATAAGTAAATCTTTGGCTTTTTGTTCTGTTGGTGTGATTCAAAGCAAAACAAACAAAC
AAAAACAAATTTTAAGAACACAACAAAAAAGATTTGACTTCCGAATAGAATGTTTTCTTT
AAGAGGCATGAAAAGCAACTATTGTTGTGTTACAGTGTTAAAAATATTCAGTTTTCTTTG
ACAAAAATGTGTACTGTGTAAGCCTTGCAAACAAAAAACAACAAAAAAGAAGCAGCAGCA
GCAGCCTGCTGTGTGGCATCTGAACTTTTATAAAGGTTTCCTTGTGCCAAATAAGTGCAA
AGATTTAATTTACTATTAAAAACCATAAGCATATGTTATAGTTCCAGAAGAATTATTTTG
TCATCAAGTGATTTTGATCTTTAGTGTCAATATTTATATTTAGATTAATTTTTATAAATG
AAAATATTTTAATGGTTTAAGAAAATGAGGACAACAGGATAATATCTTTGATGACTTCTG
AAAGTTATGCTTCCCTTCATGTTATATGCACATTGCCAAGAATTACTGTCAAGAGAAATG
ATAAGTAAAAGTCATTTATGAAAATAAA
gattgtgtgtgtgcaattttttggttaagggagactaggagtgagtaggggatagggaaa
gaagtcatgtggctagtaactggaggggccaagattcaataccttccttccagttatact
gctctcccctccattgcaagttgtccagacaacagaatttcccagtgactacctccactc