Gene MYNN Variant 1
DNA : 14.12 KbNT_005612
mRNA : 2833 bp NM_018657
CDS : 1833 bp NP_061127
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  36 bp
catgctggggagtgggtctctgtggtacatcctgtaccgccctggccggcgccggacccc
catggccccagaacctcccgcactgccacgggaagacagagccggacgtgacgccaccgt
ggaaggaagggaggggcggagcgtggctcggtgacgtcctcccaagatggcggagacaga
GTGAAGAAACTGTGTTCCCCCCTTGGGTTGCTATCG
gtgagttcctacttcacccccagcccgccatcccggtctctctagagcctgggccatcag
agggcaggctccttggagttccagcacgggtcggggcgcaggtggaaggcttgggctagg
cagccccggggtggcctgggccacaacctctgctgtggaaattcgcgggagtgggagctg
EXON 2  67 bp
aggttttggtgacttgagagcagtttttaaaaactcgtactgttctgcccctatctgtcc
caagagatcatgtcttagtggtttaaaaaatttttttgtaacataagtatgtctactgag
cttgaaaatctgagggttcaacagatgtgaaagcgtcaggttttgctgtgctttttgcag
GTGGTAGAAGTGTTGCCATTCACCGTCACTTATTGATGTGTCCAAAGGATTGTGTTAGTT
GATCAAG
gtaaccaaagatagaaaggcactcatcccttcattcttaaccatgtatgtttgataagga
ttttcaagggggctaaaattgtttaagttatgtcctctgtcccttccctcactgaacgtt
gatgagaacttacggttactgatttactgtttctttttgtcttttagatcaagggtaaaa
EXON 3  297 bp
ttagttgatcaaggtaaccaaagatagaaaggcactcatcccttcattcttaaccatgta
tgtttgataaggattttcaagggggctaaaattgtttaagttatgtcctctgtcccttcc
ctcactgaacgttgatgagaacttacggttactgatttactgtttctttttgtcttttag
ATCAAGGGTAAAATTCCATTCTGATATCAAAATGCAGTATTCGCACCACTGTGAGCACCT
TTTAGAGAGACTGAACAAACAGCGGGAAGCAGGTTTTCTCTGTGACTGTACCATAGTGAT
TGGGGAATTCCAGTTTAAAGCTCATAGGAATGTGCTGGCCTCCTTTAGTGAGTATTTTGG
TGCGATCTACAGAAGCACTTCTGAGAACAATGTCTTTCTTGATCAGAGTCAGGTGAAGGC
TGATGGATTTCAGAAACTGTTGGAGTTTATATACACAGGAACTTTAAATCTTGACAG
gtaaagtacacattttattttcagttataaaagctagtcagtagtcttcacagcaaaagt
agatttgtattttttccattcattctctgaactcaaattcttcacctatttatgcacaca
atgtttgtttttataaagaaatcagtatcactgatttaggatgagcaggcaatatttttc
EXON 4  794 bp
ggagattttttacctaaacattattctgaatgaatttataaatctatttttctcttagtt
atgtctttttcagcattctgcttcattaggtctttaaaatacattgaagtatatatgcag
ctctgtttcgaaagtttttctttgatcagaatattgtcatgtagccttgtttccttgcag
TTGGAATGTTAAAGAAATTCATCAGGCTGCTGACTATCTCAAAGTGGAAGAGGTGGTCAC
TAAATGCAAAATAAAGATGGAAGATTTTGCTTTTATTGCTAATCCTTCTTCTACAGAGAT
ATCTAGTATTACTGGAAACATTGAATTGAATCAACAGACTTGTCTTCTTACTCTGCGAGA
TTATAATAATCGAGAGAAATCAGAAGTATCTACAGATTTGATTCAGGCAAATCCTAAACA
AGGCGCGTTAGCGAAAAAGTCATCTCAAACGAAAAAGAAGAAGAAGGCTTTCAACTCCCC
GAAAACAGGGCAGAATAAAACAGTGCAATATCCCAGTGACATCTTAGAGAATGCATCTGT
TGAATTATTCCTAGATGCAAATAAACTGCCCACACCTGTAGTAGAACAAGTTGCACAAAT
AAATGATAATTCAGAACTCGAGTTGACATCAGTTGTGGAAAATACTTTTCCAGCACAAGA
TATTGTGCACACTGTTACAGTGAAACGGAAACGTGGAAAATCACAGCCAAACTGTGCTCT
GAAAGAACACTCTATGTCTAATATAGCCAGCGTCAAGAGTCCTTATGAGGCGGAGAACTC
CGGGGAAGAGCTGGATCAGAGGTATTCCAAGGCCAAGCCAATGTGTAACACATGTGGGAA
AGTGTTTTCAGAAGCCAGCAGTTTGAGAAGGCACATGAGAATACATAAAGGAGTCAAACC
TTACGTCTGCCACTTATGTGGAAAGGCATTTACCCAATGTAACCAGCTGAAAACGCATGT
AAGAACTCATACAG
gtgagacgggtgtgtggggagatattatttttatactgtgactaatatagtgtattttta
tagagagtacttagcacacactacttgtgaccagaatttggtatatttttctattcatca
aagtatttaacagtgttaaactgttgaaaatttatttgtaattgtaaccaagtatttaat
EXON 5  160 bp
acactaatttcttttgattctactggtgttttcagtggtctggaaaagattatatttgtt
ttcagttccaacagttaacattttcttaataacaaagctagtactgttgatgaaatctta
tatgacttatgcaaccaaaacactattttcttctaaatataaattttattgttcctttag
GTGAGAAGCCATACAAATGTGAATTGTGTGATAAAGGATTTGCTCAGAAATGTCAGCTAG
TCTTCCATAGTCGCATGCATCATGGTGAAGAAAAACCCTATAAATGTGATGTATGCAACT
TACAGTTTGCAACTTCTAGCAATCTCAAGATTCATGCAAG
gtaaaaaaccaaatgagttgtttgatcttttagtcttttaatcaccatagtcttatgaat
agactattatattagaattcaggacagtagaattgtaattgtggttccaccaaacaatgt
taacacgttcaaggaaccacaaggaagccacagtggttgataggaaataagcagggggtg
EXON 6  179 bp
tttgataataagaaatatttgtttttggcagtgtttacactgaaacaactactgatttta
aatacatagtcttggcctgttaagatgacatgaaataaaatctataaaaaactttatgaa
ttcttgctatatagactgacctccaaattgttttacttatttaactttatttactaacag
GAAGCATAGTGGAGAGAAGCCATATGTCTGTGATAGGTGTGGACAGAGATTTGCTCAAGC
CAGCACACTGACCTATCATGTCCGTAGGCATACTGGAGAAAAGCCTTATGTATGTGATAC
CTGTGGGAAGGCATTTGCTGTCTCTAGTTCTCTTATCACTCATTCTCGAAAACATACAG
gtaagtttgacagggagagactgcttaaaataaagttataaataaaagaaaaaggggact
tgggccttttagcgaagtagatcggaaactttgtagttagatatctgtttatatttctat
aagctatgtttatgatttttgcacatatttgttaaatataaaagctgacttattttctag
EXON 7  84 bp
acagtatacaataattactaatattcatttacttggatcactgaaaatacctctaaagta
caatatagagagattttaatttaaataatattccagaaaagcttactttagattatttgt
aattgataaatattatattggtatagtacaccacttcgctatcttttattttccatctag
GTGAAAAACCATACATATGTGGTATTTGTGGGAAAAGTTTTATTTCCTCAGGAGAGCTCA
ACAAACACTTTCGGTCCCATACAG
gtctgtgtttagggagaacgtattattttttgttctctcttaatttctttttatgtaaac
cttgacttttaagccattatggactatatggtatttagtcatactgtacctatagcaata
tcttaatgtataaatatcaacttatttgcttattttgttttttttttagttgtttggagt
EXON 8  87 bp
tgtctaggttgtatagaatctttcatttcactatattataaccaggtgattaaagtgaca
atttgaaaccaaatttaaacactataataatttttgccttgtgttcataaacattgatat
ttttgtcttagctagcagcttttaaaatattgaaatttaaacttctaatttgtttttcag
GAGAAAGACCATTTATCTGCGAATTATGTGGAAATTCTTACACAGATATTAAAAATTTAA
AGAAGCACAAAACAAAAGTCCATTCTG
gtaaatgcttgtgttttgtttgcttgtttgtttgttttaatttggtgctcatattagtgc
tattccttaaaatgctgagatgagatttacatttaagcagtttaaattagatgtctattt
caaaaactaggtatatacatgtgaggaaagtagcttttttgcagaaacattcactctgga
EXON 9  1129 bp
ttgaggcccagattgaatttacatagatagtgaggagggcatatgtacaaaagagaaacc
gcttgagtaaaggtatggtggttggaatgtaatttctgggaatggtaagtacattagtct
acctcaggggtttagttttgttttaaagataatgtagatttttttttccttccattctag
GTGCAGATAAAACTCTAGACTCCAGTGCAGAGGATCATACTTTGAGTGAACAGGATTCCA
TACAAAAAAGTCCTTTATCAGAAACTATGGATGTGAAGCCTTCTGATATGACTTTACCAT
TAGCTCTTCCACTTGGGACTGAGGACCATCACATGCTTCTGCCTGTCACGGATACTCAGT
CTCCTACATCAGATACATTGTTGAGGTCAACTGTGAATGGGTATTCAGAACCACAGTTGA
TTTTTTTACAACAATTATACTGACTTTGTAAGGAATATGGAATTGCTAAGATATCATTGG
TAGCAAACATCTCTGGTAAGGTGCATATATTCATATTAAATTCCCATTCATTTGAGTTGT
GACCATTATTTTTCATTCACTGAAGTAAAAGCACCTGATGCTGCATCACAACTGCAATGT
TTGTTTTTATTTTTGGCTTTATGTCTATACTCCACAGAGAGCTTTTTAAGTAATGAATTA
TGTAGCACTATTTTGGGTGGATGAGTTTTATTTTCTTTTAAAGCTGCCTTAATTCCATTT
TTATTTTGCATTTTAGAATTGCCCTTCATTTACTAAATCAGCCAGTTAATGTGATTCAGT
TGTGACCTGTGGGATTTTAAAATTTTCCTGCCCTCATAATTTAAGCAAAATCCACGATAG
TATCAGCCCAAGAGTGTGTTGCTATTTGTAAGCCCCATGGATCAATACATAAACTATGCA
TAAAAATAAAATTTCATATTTTCGCTCGTAAAAATTTAGGCGCTGAATAAGAATTGTGCT
ATTTCTCTATTAATATATTGTTAGAAATAACTTTTCTAATGAAACAAAAATGTTTCTCAA
AATCTAGAAAAGTGCATATAAATTTTTGTTCATTTAGAACTGAGTATTCTGGAGAAAACC
AATGGTCAGCACTTTTGGTTTGAGTTATCTGAGATTGTATTTTCAAAATGAATTTTAAGT
AGATATTTGGTGTTTTTATCTTGTCAAAGACAGTTTCAAAATTTGATTCAGTTTATGTTT
TATTCCGTTCTAAAATATTGGAGATGAGGAAAATGTACTTGAGTTTTGAAATATTTTGGT
AAGCCTCTCTTACTCCTGTTATGCACTTTTTAAAATAAATACTGAATTC
cagaaagaattttctagatataaacttaatgcatactagaaatcacttggcttctaaatt
tggtacattatattgcataaagagttaagaaattaacctcaattataagtaaacattttg
agttaccagaaagccaactatagttaaatattttatatctgagttttctataagtttggg