Gene LMCD1 Variant 1
DNA : 66.29 KbNT_022517
mRNA : 1733 bp NM_014583
CDS : 1098 bp NP_055398
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  156 bp
tcagggcagccggcgctcagctccgctcgctgccacagtgcagagacctccctgagggag
ggggacagcctcgcgctgggattggctggcctcgcgcgagcgccggcgcggagtggctgg
cgaggttttagagggagtcccgctctccaattaaagcggcccagctgcgcctggctgcgc
ACAGAGCTCCCTCCCAGGCCCGCGAACTTGGCCATTCAGCCGCCGCTGTCCCCGCTGCGC
GCCCTCGCGCCTCTGCCTGAGAAGCCAGGCGCTGTTCCCCCACCCCAGAAGAGGATGGCA
AAGGTGGCTAAGGACCTCAACCCAGGAGTTAAAAAG
gtgagtggaaagctgtttgtatttacccagattcttactttttcttgttccccttcccat
ctgttcgcggaaacttcccaaaaggtaatgagaagggaactctttaaattccaaaactgc
atggaaaacaaatagttgggaatacatgtttgagctaacaggcacacacaccccaaaccc
EXON 2  89 bp
attccatgttcctgtttggtcttctcagttcccggtaaacagtttgtgatggcttattga
tctcaagccctttgaaccccacacagtccctttgccagcacgccaagtcttttagaggtc
aagcatctccggtccaagatgtttggaaggaaaacaccctcttttctgttccttttccag
ATGTCCCTGGGCCAGCTGCAGTCAGCAAGAGGTGTGGCATGTTTGGGATGCAAGGGGACG
TGTTCGGGCTTCGAGCCACATTCATGGAG
gtaacagattttgtcaggagggtccctgtctgcctttgttacttggctgtcctctcgggg
aaccctggttgctttcttcgctgagactgctttggttgtatgcgttgtcagggaaggatg
gctgcagagggaaggcactcctgcttggtccaattcagaaacgaaaaaagtccttggggg
EXON 3  256 bp
tttcccaaatgcagttcccaattccaaaggcctttttgtctcaggttaccatttgtccgc
tgctagtttttccaacttaaagttttagcttgctttcaaaagggtagatgctgctagcag
gagaatgtgcctctttttcctggaggttaatctcactggtccccatccacccacccccag
GAAAATATGCAAGTCTTGCAAATGCAGCCAAGAGGACCACTGCCTAACATCTGACCTAGA
AGACGATCGGAAAATTGGCCGCTTGCTGATGGACTCCAAGTATTCCACCCTCACTGCTCG
GGTGAAAGGCGGGGACGGCATCCGGATTTACAAGAGGAACCGGATGATCATGACCAACCC
TATTGCTACTGGGAAAGATCCCACTTTTGACACCATCACCTACGAGTGGGCTCCCCCTGG
AGTCACCCAGAAACTG
gtaagagagcttccccaaccaagcagttgttttcctatcctcataaatactagccatgtc
aagtgtttctgaatttcaaacatggggtggcaagagctcaaggtcacaaaaatgacagga
gtggctgtggttttagccctgcccttatatcatgtgatgttgagaaatgaagactatctg
EXON 4  336 bp
ctaaaattacaaaagtaatctaactgcattaagttaagaaaataaagactgtgggtcttt
cagttgctgagaatgctggaagagaatgcattttcagttttaggtagattctgtcatagt
ttctttgactgatgaagccccatccacatcatgttgtctcttcctcctcctcctccctag
GGACTGCAGTACATGGAGCTCATCCCCAAGGAGAAGCAGCCAGTGACAGGCACAGAGGGT
GCCTTTTACCGCCGCCGCCAGCTCATGCACCAGCTCCCCATCTATGACCAGGATCCCTCG
CGCTGCCGTGGACTTTTGGAGAATGAGTTGAAACTGATGGAAGAATTTGTCAAGCAATAT
AAGAGCGAGGCCCTCGGCGTGGGAGAAGTGGCCCTCCCGGGGCAGGGTGGCTTGCCCAAG
GAGGAGGGGAAGCAGCAGGAAAAGCCAGAGGGGGCAGAGACCACTGCTGCTACCACCAAC
GGCAGTCTCAGTGACCCGTCCAAAGAAGTGGAATAC
gtaagtttctcccatgcttccagccaggctgaaaccatgcaggcccagggctggacagtc
agggccccatcacggggctttgttccctcattcatgcatttattcatgaatttgtgcatt
cagcagatattgattgctcatttagtctgtgccaggcactgtcccatggaaaatgataca
EXON 5  216 bp
gcctgttaggtaggcaatattattgtgtcgctttgcagatgacaaaactgaggcacgaag
aggtatagtgacttgcccaaggtcacccaggaagtagaaaggctggagctggaattcgaa
cccatgtcactgtgctctcctgacttccttgtctcctatggtccttccccatccttccag
GTCTGCGAGCTCTGCAAGGGAGCGGCCCCTCCTGACAGCCCCGTGGTCTACTCGGACAGG
GCAGGCTACAACAAGCAGTGGCACCCCACCTGCTTTGTGTGTGCCAAGTGCTCCGAGCCG
CTGGTGGACCTCATCTACTTCTGGAAGGATGGTGCACCCTGGTGCGGCCGCCATTACTGC
GAGAGTCTGCGGCCCCGGTGCTCCGGCTGCGATGAG
gtgggagatagccgcgagatgggttagggggcttgagggacactgctgagggtaaaagcc
cagaggccaagaggagcatggctttgtggatgatgtgttctacagattgggaaactgaag
tcaggcctcactgcatgctctcaaccttcattttctcatctgcaaaatgaggcagacaac
EXON 6  680 bp
accttcaccaaatattatccttactgcctcaaatttatgccagatttttccactaaggct
ttaaaaggtcaaaacaagaataggatgggatgaaccaccaccctataacttgtcctagat
ataccgtctctacctagggacagaaactgagtcatgcatttctcctgctcccctccccag
ATAATATTCGCTGAGGACTACCAGCGTGTGGAAGATCTGGCCTGGCACCGAAAGCACTTT
GTCTGTGAGGGTTGTGAGCAGCTGCTGAGCGGCCGGGCGTACATCGTCACCAAGGGTCAG
CTTCTGTGCCCAACTTGCAGCAAGTCCAAACGCTCCTGAAGGGCTGCCCACCCACAGCCA
GAATCCACAGGATCCCACCGAGAAGGAGAGCCAGGTGTGCCGAGACCATCCTAAGGGTCC
GATGTGACAGCAAGCAAGTGAAATAAACAATGATTTGCTTTTCAGTGAGAATATATATAT
GAGATATATATAGATATATATTCTAGGTTGGGTGGTGGTAGATCCTTGAGGGTCAGTAGT
TTCAAAACCAAAAATATTCTAAGAAGTCTTAGGATGGAGTTCCTTTTCTTTCTGTTGTTG
TTTCCCAGCTACAACCAACTAAAGACACAAATGGCGTTCTGCAAGGGGACTCTGGGAGGA
GTTTTCCAGAATGCAATTCCGAGTGAGCAAATCGCATAGCTGTAGAATGTGCGTGCTTTT
TTGTGGACACAGGAGCTCCTCCAGGAGCAGGCTGGGATCCCAACTATCGCTTGTTGCCTC
TTTTTCAAGTGGAATTTGAATTTTAAATAAACAACTTTTTTTGGCATGATAAACAGATCA
ATAAAAGTTTTGTGAATTCC
acatacacccttatctaattatttacaccatggcagtgattttgcaacacccagtgctgg
cagaaaatatagtaaaatactaatgagcctctctatcaatgtatctcatcagacttccac
tgggagtgtaggctttgggacagaacccccgccccacctgcctattccagatactcccag