Gene ITGB5 Variant 1
DNA : 124.35 KbNT_005612
mRNA : 3371 bp NM_002213
CDS : 2400 bp NP_002204
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  367 bp
tgtggcggccgggcgagggcctggcaggggagagaaggggaggagaaaggagaggaggaa
agtggagcctggcgggccggagggaggaagggaaggggcggaggccaggggcagagtgtg
ccggcgcgcgggggagtctcggcgctgggcgcgtctcggagcccaagtcgcggccgccga
GCGGAGCCAGCCCCTCCCCTACCCGGAGCAGCCCGCTGGGGCCGTCCCGAGCGGCGACAC
ACTAGGAGTCCCGGCCGGCCAGCCAGGGCAGCCGCGGTCCCGGGACTCGGCCGTGAGTGC
TGCGGGACGGATGGTGGCGGCGGGGCGCGGGCCAGCGCGGGCGCCGTGAGCCGGAGCTGC
GCGCGGGGCATGCGGCTGCGGCCCCCGGCCCTCGGCCCCCGCGCTCCGGCCCCAGCCCCG
GCCGCCGGCCCCCGCGGAGTGCAGCGACCGCGCCGCCGCTGAGGGAGGCGCCCCACCATG
CCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCCCGG
CTCGCAG
gtaagccgcgccgcccacggcgcccagagaaactttgtcgcacactcagccgcgggcggg
cgtctcggaggggcggggagcgcaggcggtgcctgagggcggagggcgccttcggggcac
tccctggtgggccagtcgctgggggacagccccgcggggcgctccccgcgcgcagccccg
EXON 2  86 bp
aaaaactcaatgttcagccttagcaaatgagccttaacctgcaattagcaatggtacctg
caccctttagactcagagaggcctcctgttaaagaaggatgtaattccccctattcaaag
gcttgatccatgaagtttatagccaggaactaattagtgcatctttatcttgctttaaag
GTCTCAACATATGCACTAGTGGAAGTGCCACCTCATGTGAAGAATGTCTGCTAATCCACC
CAAAATGTGCCTGGTGCTCCAAAGAG
gtatgtaggtgggggaggggaggaagaagggaaggaatgctgcgagggtgagggtgagaa
ggaggccaacaccacaacacactaattcactatacataaaaatcctgtgcagattctgta
agctgcctcttccccatcagggcagagtgatgacaaatccaagtttatgagacaataaga
EXON 3  205 bp
atccttacaatacttggtgaagcatctgggatagggattaccatttcctccattttcaga
caatgaaaatggaaagtagagaatttaaggtcaaccagatggagacgcagccacgacatg
cgatgttttcgggagacaccctgaccacctcctgctctcttcctctttttccctgcctag
GACTTCGGAAGCCCACGGTCCATCACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAA
AATGGCTGTGGAGGTGAGATAGAGAGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTG
CCCCTCAGCAGCAAGGGTTCGGGCTCTGCAGGCTGGGACGTCATTCAGATGACACCACAG
GAGATTGCCGTGAACCTCCGGCCCG
gtgagttgcccacagaaagggctggatgctctgggatcaggaaggcccatgggggaggtg
ggacttgttaataatgggacaatgagtcaggccaggctgagatcagagccacgagatggt
gatggggaggcaaggctcagacctcaggaagcagagtatattcttattgatgtgtctgtg
EXON 4  250 bp
aggcctccattctcagcaccgtattcccttcaggcactttacttccaagaaaaatcttct
gtgaggcacacaatcactaaagaaaagtaagaggcaaactagctttgaaagcaaatccca
tccctcagccctcagcaggttgcacaacctctaacacacgtggcctctctgttggtgcag
GTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTGT
ACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTGG
GCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGGT
CTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAATC
CGTGCATTGG
gtaagtgaccagttgcccttctgttgggtacttaagggtgggagaatggagaagcaggaa
aatttagctcaaagaaagaattaaggaaggcatggttaggaggggtggccaggcttaggc
gtttaatttgattaatgataagcatacattctctcctttcctgacgtgtgaagaagtgag
EXON 5  169 bp
ggagaacaggaactatgttatttatctttgctctctctgctgtgcctgtcctggggcatg
tggtaggtgctgggtaaatagttattggtgcctctcaaggcactcagtgaatgctcagaa
cacttggttaagatttacagacaatgatggaaaagtgactcttctcttcttcctctctag
TTACAAGTTGTTTCCAAATTGCGTCCCCTCCTTTGGGTTCCGCCATCTGCTGCCTCTCAC
AGACAGAGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCCCGGAACCGAGA
TGCCCCTGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
gtaactttcctttctggtcctgtccctgcatggggaggtcaaggtagagagcgtcagtgg
gtgttggtacttcctgcaggagtctttgagtgccccagcatgtggctcctgaccactctg
aagtcagagggtgagctcagtggaacttctgggaaatctacagcagtcaaatcagccgga
EXON 6  162 bp
tctcttcggagcctctgtggaatccctccccagtggttttgtgagtgtgccccaggtaca
catggcaaggggaatgcctctgattcaggccgtgactcctggagaggggccagtgccctg
catgaccagggcaggactgggcagaaagactggtgtacccatccaccttctgtccttcag
GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATG
gtgagtgccgggaaccagatcccccctccctgttgcctctcttgtgaccctgcccgtggt
cttagtacttgcccagccttgaaaccttcctctggccctcagtattcactggctttctga
tcccttcttggggttgggtttcattattcagtcttctccaactgggtttccggaactcct
EXON 7  96 bp
tactcagttccttagttcaggagctaccaagaaggcttagttattaagggactctaaggg
gccacctaaggaaaaggtgcttccctggcaaatgctggctgctgactgtgcattggagcc
aggtgctggtatctacacctgttaggaatgtcatagccttgacttttgccttggccctag
GACTATCCATCCCTTGCCTTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATC
TTTGCAGTGACAAAAAACCATTATATGCTGTACAAG
gtatgctgggagggagggaggctagtgatttgtggggtgaagtgggtggtgaggagtgtt
tacaactctgcctatctgggggaaattcaaaggaggggtggaatatagcccagtcttgat
ctaatggaaaataataggaggaaacaattaagcattcgcatagcagtgaataccttacaa
EXON 8  90 bp
cttcttctgtgccatttcttcttgcttttccctgtgggatcttctttagttcatggtggg
agaaggtggcaggatatggttctaggagcctttactgttctagcccagtatagcaatgct
cactctgatggttggcagggcaaaatgaacttatttcttttctttactttttttcccaag
AATTTTACAGCCCTGATACCTGGAACAACGGTGGAGATTTTAGATGGAGACTCCAAAAAT
ATTATTCAACTGATTATTAATGCATACAAT
gtaagtcatcagtttcttcccccactgccacctcccttccaccctctcccactgaggccc
tgcagctgccgcgggctcaggtgggcagttctccgtgctgctcttcttggctctgctccc
ccatccccttgagtttggtatcttcttcctgcttcactcagggtcagggtggagaaaccc
EXON 9  135 bp
gtgagtgcagagagaagggaaaggatgagggagggccagggaaccaagctcactggctct
tcctttggcttgggattcctgagttagaggaagccacgtgggcctcagaaaaccagtgtg
ggagcacctcagccacagcctttattaaatggttgggcttcattttctctctccattcag
AGTATCCGGTCTAAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTC
TTTACTGCTACCTGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTG
AAGATTGGGGACACG
gtaagtctcaccccaagtttgtatgaactcttgttagcattggtcatcagtctttgggtt
ctaataacttttgtgacttattaagagtcctttcggaatttatattctgttttccaattc
agcatcccagaggagtctcctaagcctgttttgcatgatgtgttcagagtctcaggtgaa
EXON 10  430 bp
aagcatgggagcttgctggttctgaggtctcttcctactccggccatcttggtggttcta
cctgagtgcgtggagagggctggagttcgcagctgctcttcatcaagggccctgcccctg
ggtgaatgggagaccctggcttgccgcagccatgatatcccttctcttccttctgcccag
GCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCATGTG
TTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAACTGC
ACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGCGCCAGGTGCAACGGGAGCGGGACC
TATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGCCAG
GATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCACTG
TGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTTGGC
AAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGAGTC
CTCTGCTCAG
gtaagtgtccccagcaagcactttagctctgagccaggccaagatgccgttaggacaccc
tcccaaagcctgccttttactcagtggtggtagaaagtgtcactaccatggctctccttg
gagaagacagtgggcaagccttgctacccgtaggcaggaggtggggatctgtgtgcagaa
EXON 11  223 bp
cccctgctgtcccttcatgctggctctaggccctctgtctatctccccaaacaggctctg
agggcagagttggtgttccattctctgctgaatcccagtcctggcatgtggggcaccaga
tggttatgtgctcatgtgtaaaggtgagcaggtgctgatgtgccacatgtatccttttag
GCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTACATCGGGGACAACT
GTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAGATCTGCAGCGAGC
GTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCCTTTGGGGAGATGT
GTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAG
gtactggttccactgacagccccaccttacttctcacccaggccaggcctgtggtccagc
caggcagccctcagggccggctagcctccactcctcacctcctgcatctcccacccagca
agcctcgctggggagccgcattcttaccaaccgtaactgaaactgtggctttcaaatgct
EXON 12  101 bp
cccttgggcttcctcccataacaagaagaaaggcagagcagaaacattccctgaggctga
acatctgcagctggaaagaagtgaaagccttcccaggtcctgcactgtcaggagctcagg
gacaggtgtgggactgttctacattatctgacacccacctttatctcctcttttccaaag
AGATTGCGTCGAGTGCCTGCTGCTCCACTCTGGGAAACCTGACAACCAGACCTGCCACAG
CCTATGCAGGGATGAGGTGATCACATGGGTGGACACCATCG
gtgagtgtgctgccaccacccgggcagtcacggtttttctccttcctggggaggagggta
gttttagccttgagtcaggaggcactgcccaggcttcctgggcataactgtgggctcccc
atgaggacccggtgctggaaccatcatccacagctgatgggaatgtagaatggtacggac
EXON 13  120 bp
ctgcattcttggtgtgagaaaactgaactcatcttcaaaggcccagcctccccttaagat
tttctgcccacaccccccatgccctttcctttttcaaggcactcggctccctgccccgac
catcagtggctgtgggctgctcagagagactcaggccattcccgcttggttttcttccag
TGAAAGATGACCAGGAGGCTGTGCTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGA
TGTTCACCTATGTGGAGCTCCCCAGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAG

gtaggtgagggctgcaagggctcggcccactcagccagccctcagttctgatttctgatg
ccattctctgctctgggaccactgccctttctgtcctcatcggccttttgaaactgcagg
gagaggagggatacaatttcttctttttctttttttttttttttttgacacaggctgtca
EXON 14  167 bp
ctgtcccttttgaatctttcattttttgtacattggggaaaccctcctgaggatctaagg
gagagccgaggagaaggcctttggaaggggtgcaactttcatctcagaaatgcctgcagt
tgcgtgagaggggcatggtgatgctagtggctttgcttaccatgcttctggtccccccag
AGTGTGGAAACACCCCCAACGCCATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCC
TTGTTGGGCTTGCACTCCTGGCTATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGG
AGTTTGCAAAGTTTCAGAGCGAGCGATCCAGGGCCCGCTATGAAATG
gtaagcacgtgggaaatgggaagcagaggagacttcaagctcagaggcgtggttgagttc
agcggtatgttagcaatagaggctcactaatgtctttggcattaaaaacaaaagaatcaa
caccagaaacgctgtgcccagttctggagagagagaattgcacagccccagtgcagagtg
EXON 15  770 bp
gcgatggctttcctggggaacacagagctgtcctagagcccacggccgtctcctcctgag
tgctctgcctgctgctgtcgcagggggctgacctgggaagggatcctagggcctgcgtct
gtcggtttgagtgtgtgagctaacatgtgtcctcatcctcttccccgccgtgttctgtag
GCTTCAAATCCATTATACAGAAAGCCTATCTCCACGCACACTGTGGACTTCACCTTCAAC
AAGTTCAACAAATCCTACAATGGCACTGTGGACTGATGTTTCCTTCTCCGAGGGGCTGGA
GCGGGGATCTGATGAAAAGGTCAGACTGAAACGCCTTGCACGGCTGCTCGGCTTGATCAC
AGCTCCCTAGGTAGGCACCACAGAGAAGACCTTCTAGTGAGCCTGGGCCAGGAGCCCACA
GTGCCTGTACAGGAAGGTGCCTGGCCATGTCACCTGGCTGCTAGGCCAGAGCCATGCCAG
GCTGCGTCCCTCCGAGCTTGGGATAAAGCAAGGGGACCTTGGCGCTCTCAGCTTTCCCTG
CCACATCCAGCTTGTTGTCCCAATGAAATACTGAGATGCTGGGCTGTCTCTCCCTTCCAG
GAATGCTGGGCCCCCAGCCTGGCCAGACAAGAAGACTGTCAGGAAGGGTCGGAGTCTGTA
AAACCAGCATACAGTTTGGCTTTTTTCACATTGATCATTTTTATATGAAATAAAAAGATC
CTGCATTTATGGTGTAGTTCTGAGTCCTGAGACTTTTCTGCGTGATGGCTATGCCTTGCA
CACAGGTGTTGGTGATGGGGCTGTTGAGATGCCTGTTGAAGGTACATCGTTTGCAAATGT
CAGTTTCCTCTCCTGTCCGTGTTTGTTTAGTACTTTTATAATGAAAAGAAACAAGATTGT
TTGGGATTGGAAGTAAAGATTAAAACCAAAAGAATTTGTGTTTGTCTGAT
actctctgtgtgtttctttctttctgagcggacttaaaatggtgcccccagtggggattg
aagcggccgtgtacttcctcagggatgggacacaggctggtctgatactccagactgcag
cttgtcaagtaagcatgaggtgctcggggcagtgagggctgtgcaagggggaacactgag