Gene FBXL2 Variant 1
DNA : 109.18 KbNT_022517
mRNA : 2360 bp NM_012157
CDS : 1272 bp NP_036289
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  74 bp
gtgatcagactgagaggatggaccagatacgaagtgggagaggcgaagaggcccagttcc
agggccgggggcgaggggtgggcggtccaaagggcaccgcccctgcgggtcacgtgctcg
ccgaccaccaatggccgcctccgagcccaccttggggacggggcggggcgcctggctggc
GTCACCAGGACAACGGGCGTCGCCGGCGCCGTGTGACTTCGGGCTGTGGGCTCGCTCGCG
GCTCTTCGGCCATG
gtgagtctgggacccgcgtctgcctagctgccccgccctacccctaccgggctgggtccg
cacgccgccgcccgctagggtcgggcaggcggcgcaggggtcgtggagaggccgggccgc
ggcctgcgaggctgctgggcagggcagggctgggcgggcccggggaggggtaacctgggg
EXON 2  62 bp
taggacataaaatattttatattactcaatattagaatatggtggctgcatgaaattagt
cacaccctatttgtaggacaataattggggccgttctgatctagtagtataaaaacaatt
aattttttccacattgattaaagaacattttcacaatttcctttttttttttctttccag
GTTTTCTCAAACAATGATGAAGGCCTTATTAACAAAAAGTTACCCAAAGAACTTCTGTTA
AG
gtaaatgtagataaattctggatgaagagtttagatctgatttagtcatcaagttccaag
actatcttctttctcactgtgagtccatagcatagaaaaacagacagaattagcctaact
gactttttgtttttgttttatagaatgctgttcagcttgttgttaaattttacttggtct
EXON 3  55 bp
gcaaacacttaatatttcactgtagtgatgtaaagttatagtgcacttgtatatttcaga
ttgaggaatcttgaaaaaacttatgtatccaggtggcggattagagtttatctttcaagt
tataattatcctgaaatgttaacaccatctcgtttttgtgtttttttcctctctctgtag
AATATTTTCCTTCTTGGATATAGTAACTTTGTGCCGATGTGCACAGATTTCCAAG
gtagagtattcaccagattttttaatcaataaatatcaagttttattagaatgagtttta
gttcaaattactgaaaattaaaattttattatcttttatacttaatataacataatggta
taattttgcatttgatgattaacttaatatacatcaaaaataggagtttggaaataaagg
EXON 4  75 bp
aattttattatcttttatacttaatataacataatggtataattttgcatttgatgatta
acttaatatacatcaaaaataggagtttggaaataaaggttaatcaagactttctttaat
agtctcaataaatgtgtttctttcatcccaatccctcttcctttacctcccaccttccag
GCTTGGAACATCTTAGCCCTGGATGGAAGCAACTGGCAAAGAATAGATCTTTTTAACTTT
CAAACAGATGTAGAG
gtaagttagctttggtttagacaaaaaactttttaaaaatatgagtagctgttccccctt
tcctgactttttattttactgcatttagatctaatattaaagtgctgaggtagaacagaa
agaagaaaaactggaagggatttgcatacatcaaaacaaaaccctgcttgcattttaaat
EXON 5  95 bp
tcagtgcttgcagcccctgtatgcattaaggatagaactgaggtgttacaggaatgttcc
aaaatattttctgttacacttggaaaaatatattcagttcctagatttcaggttattttg
ctgttagataagcagcatgaaaaaacagtattttttcctcccgaactttcttgattaaag
GGTCGAGTGGTGGAAAATATCTCGAAGCGATGCGGTGGATTCCTGAGGAAGCTCAGCTTG
CGAGGCTGCATTGGTGTTGGGGATTCCTCCTTGAA
gtaagtcaaatccagtgactcactgtcatggcagcttgtagcattttcatcagcaaaaat
aaaccaagcctattacatgctcttcttctgttaaaattctttctgtggtaatttgcatag
agtaatgagaggaccaggactttggaatagcaaacctgggttggaaaccgagctgtactg
EXON 6  69 bp
actgtcgagccccattctagatctatcatcagaatctgcactgtgacaagaaccctagct
gattgttacgcgctttaattaagtttgagggagcgctgttctaagcgtgaatggtttcat
atgccctctagtggctgtccagcaacttgcagggagctttaaaatgttttctcattttag
GACCTTTGCACAGAACTGCCGAAACATTGAACATTTGAACCTCAATGGATGCACAAAAAT
CACTGACAG
gtaagtaatgaagattaattggtgaccaaatagccacggggagagagaagggagagaaac
gtggttgaaaatatctttagtgcgtctgctctttttcagcacgtgttatagccttagcag
attctgttccaagctgaaacatctggatctgacctcctgtgtgtctattacaaacagctc
EXON 7  96 bp
ttctcattttaggacctttgcacagaactgccgaaacattgaacatttgaacctcaatgg
atgcacaaaaatcactgacaggtaagtaatgaagattaattggtgaccaaatagccacgg
ggagagagaagggagagaaacgtggttgaaaatatctttagtgcgtctgctctttttcag
CACGTGTTATAGCCTTAGCAGATTCTGTTCCAAGCTGAAACATCTGGATCTGACCTCCTG
TGTGTCTATTACAAACAGCTCCTTGAAGGGGATCAG
gtaagagtgcccattgtttgtgtcaagagaaatacccaaagctatgaacattctggaaac
cttcttaatggtcacgttggatccagcaagaaataggtgactccaagaggtcccaggcat
ggtctccccttcggaatttcttgtgatgtactaaactcagagttggtcattaactctcta
EXON 8  127 bp
tatgaacattctggaaaccttcttaatggtcacgttggatccagcaagaaataggtgact
ccaagaggtcccaggcatggtctccccttcggaatttcttgtgatgtactaaactcagag
ttggtcattaactctctacaggagagactgcacataagtttttgtttcttgttctctcag
TGAGGGCTGCCGAAACCTGGAGTACCTGAACCTCTCTTGGTGTGATCAGATCACGAAGGA
TGGCATCGAGGCACTGGTGCGAGGTTGTCGAGGCCTGAAAGCCCTGCTCCTGAGGGGCTG
CACACAG
gtaccagagggttgatacagctgtttgtgttatgtgtcaggtgtgggcacatcatccaga
aagctgcttttgcatttttcttggtgtcccactgttccctcacctggattccagctgtct
tttgttttctctgtccactcagttagaagatgaagctctgaaacacattcagaattactg
EXON 9  75 bp
gaggcctgaaagccctgctcctgaggggctgcacacaggtaccagagggttgatacagct
gtttgtgttatgtgtcaggtgtgggcacatcatccagaaagctgcttttgcatttttctt
ggtgtcccactgttccctcacctggattccagctgtcttttgttttctctgtccactcag
TTAGAAGATGAAGCTCTGAAACACATTCAGAATTACTGCCATGAGCTTGTGAGCCTCAAC
TTGCAGTCCTGCTCA
gtaagtagcgtgcctttcctgaacactgtttgctctatcttgtctcccaaagcagtctgc
ctcaggcctccctgcagccccctaggcacctgagatgggctgtgttgccacaccctgatt
tccatcctgtgtccttatataacctaccaatttgtcacaagctggaacaacaacaacaac
EXON 10  131 bp
taaagctgtgcagagataacacaagtacctgtctaccctctacttattttgttgaagtta
tttggataaaatgctagtaatcagcaaccaaaactgaacaacagcagatacttttctgct
gctcccgttttggtattgctggtgtcctctgacttttctttctgtgctgcttttcctcag
CGTATCACGGATGAAGGTGTGGTGCAGATATGCAGGGGCTGTCACCGGCTACAGGCTCTC
TGCCTTTCGGGTTGCAGCAACCTCACAGATGCCTCTCTTACAGCCCTGGGTTTGAACTGT
CCGCGACTGCA
gtgagtacactgcactttttgctttgcagctcagagtttggctgagttaaccaagagggc
ttccttcaggagaggacaggcttgccaggtagtggtggtggaggcagtagttatgttgtt
gttggcttttgttgggtaaattggggtggggcgtgtataaatccagttcattggaggatg
EXON 11  61 bp
tactttccaagtttgggatggaacttcggggctttgggcaggtcacattccctaagggct
gttaacagaggcaaaagcatgtcaaagagcagaaaagactcaagtatgcatcataaaata
tgtgtttccattattaactagttggtaccgttttctcccctgtacccactttctcctcag
AATTTTGGAGGCTGCCCGATGCTCCCATTTGACTGACGCAGGTTTTACACTTTTAGCTCG
G
gtaaggcatagatttaaagaatacaaccaaactctaattcacctcccgaattcaaagtga
cttggagtggttttgggtgtgcaaaagactaccttcagaaaagacaggcacaaagtagag
tagaacccttggggtgtgtactgcagtttttccagttagccagaaatctagggaagtcct
EXON 12  45 bp
tgtaactcaaaaggcagctgttcagaagtgctggtttactgggtagctttaggaagaggg
catacttcttaacagaagagaacaaggacactgggccaatactcagagggatagggcaag
ccaccattgttgctgtcaccactgactcacatgtggggtgtgtcttgtggactcttccag
AATTGCCACGAATTGGAGAAGATGGATCTTGAAGAATGCATCCTG
gtgagtggactcctgacagccctgcagggcagcctgctccttagtcattgctggccagtg
cagcacagccagagacactgactcgctatcatcctgaccctccttgatcaacctcagtgg
cagggcttggaaacctgtgaaggccatggcagtggatgcgtgaacttttggccattctca
EXON 13  57 bp
gcatctctagaagtgggcagattttagagtgctggtgaagagaggagctcccagccccag
agtgtttgagatgagtttttaattcttttacaccttttgattctcgtgttcaggagaagc
caggattaggtattaagttctggtgtagaagccacactgacacagcatgtttctctccag
ATAACCGACAGCACACTCATCCAGCTCTCCATTCACTGTCCTAAACTGCAAGCCCTG
gtgagtctgagtttttctgacattattcacctgttaaagatgaaagagccctcccaccac
aacaagaagctgtttgggttctctttctgtaaggtatcatctctcttgatttcaaaaatc
tattaattgggctaacttgggaggcaaggtatctaaatatttgattactgctttcattga
EXON 14  213 bp
gaacagaaacttctcatagttctgaaggctgggaagtccaggggctggcatctgctgagg
gcattcttgctgtgtcatcccattgcagaagggcaaaaaggctagcttccagcttttttt
taggacttgagccttggaataagggtcctgcaaacatttactcatgtcttcctgttccag
AGCCTGTCCCACTGTGAACTCATCACAGATGATGGGATCCTGCACCTGAGCAACAGTACC
TGTGGCCATGAGAGGCTGCGGGTACTGGAGTTGGACAACTGCCTCCTCATCACTGATGTG
GCCCTGGAACACCTAGAGAACTGCCGAGGCCTGGAGCGCCTCGAGCTGTACGACTGCCAG
CAGGTTACCCGTGCAGGCATCAAGCGGATGCGG
gtaggtatggggcaggggagtcagtcacacctgacatttctaagcaccaaaggaaaacat
caagaatcagaccggggctaggcacgcggtggctcacgcctgtaatcccaacactttcag
aagccaaggtgggtggaccacttgaggtcaggagttcaagaccagtctggtcaaaatggt
EXON 15  1125 bp
ggtactaatggggggcagacggtgcggggagtaacaggagtagctctaatctatagcata
aattctacttcaactaaggtgaagatttttaatagaggactataggtttttctagaatta
tgactataatcctaaaaatagtaatgtgtaaagactccacttttttcttcatccttccag
GCTCAGCTCCCTCATGTCAAAGTCCACGCCTACTTTGCTCCCGTCACCCCACCGACAGCA
GTGGCAGGAAGTGGACAGCGACTGTGCAGGTGCTGTGTCATTCTCTGACAGCAGCTGCCT
GGGCCCAAGGGGTGATGAGGCATCCTTTCCTCTAGAAGACCTGAGTCTTCCTGACCGACT
CCACCATCACCCAATCTGTTGATTCTCCATTGGGAAAGGCATTTACAGGTAAAAGACTTC
TGTATGGATTGCAGTTACTCTGGTGATAGTTTTCACCTTTATTCTGCTGTGAAACAATCA
AATCAAAGCCTTGTGTCAGTTAACACATGACAAGTGGTCTCAATGCAGCTAGGACCATGC
CAGAAACCTGGATCTCTTAAGAGATTGGTACCTACCTAGGTACGAAAGTTCTACCCTTGG
CATACTCAGCATTCCTCAAAAAGACCATCAGTGTTAGCACAAACTGAGCAGAAAAAATAA
GCTGTTGATTTTCTACCTGATACTTAAGCCAGTGGCCTACTTTAATTCACAATTCCATTT
TGATTAGCAGGACTTTTCCACTTTGAAGATAAATAGCAACTTTATCAAAGTGACTGTACT
GCAAATTAATTCATAATGCCTGATAGTTTTATATATAGAGACTTATGTGGAAGGCATGTT
AATAGGTTTCCATGAGACACCAAAGAAAAGAGGACTCTATACTGGGTGGAGCAGGGTCTT
CACCTTTTTGTTTCTGTCAACTTGTCATATACACCTCCAGGGACCAAAAACAAAAGCAGC
TCGGAGTCTGTGTTGCCTGATTGGAAAGTAGAAGCTCTGGTGTATGCTACAGCACATAAC
ACATTTTTACTAAAGGAAAAAAGCTAATTATGTCCATGCCTCTCGTAAAACTGGGGGGAA
CCTTAAAGAGAAAGAACTAAGGCTTAAGTTATCTGTAGTATAATCAATTAGAAGTAATGA
ATGGATGCATGTAAAATGGATGTGATTTTTTTTCAAGCTTATTTTGAAATCTTAAAAATC
AGGTTACACCATAGCTACTCAAAAGTTTTACACACTTAAAACTCAGATCAGTAAGTGTTG
GTACCTTTTAGACTCATAAAATTGAATAAACCATTGCAATGCTTT
aaaaaaaattaagtcagagggttttattgctatgattttatggcagacacatccaagcaa
aaccattttccaaatgcagaccttcctgatgttatctgaaatctgataaaatgaccctac
tctctgctgtggttcattcttgctccatgctgtccatatttatgatctttattaagaacc