Gene EPHA3 Variant 2
DNA : 292.68 KbNT_022459
mRNA : 2546 bp NM_182644
CDS : 1620 bp NP_872585
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  175 bp
cttcccgagcagctctgggctgcagagccagctgcgtgccatcccgctctgcttcagcgc
acgctgaagacggcactaggacccagggaagtccccgagcggggttcgcggaaaggcagc
cagactcctccttatctccagtgtcaaacttgacatcagcctgcgagcggagcatggtaa
CTTCTCCAGCAATCAGAGCGCTCCCCCTCACATCAGTGGCATGCTTCATGGAGATATGCT
CCTCTCACTGCCCTCTGCACCAGCAACATGGATTGTCAGCTCTCCATCCTCCTCCTTCTC
AGCTGCTCTGTTCTCGACAGCTTCGGGGAACTGATTCCGCAGCCTTCCAATGAAG
gtaagccaggtaccgcgacgcacggagctctgccccgcggggctcacgctcttcaaagca
cgttctcaccgaagccttgcacgtcgggaaggtgcctccgaatagagcagtttgctctga
gagtgaaggaaagatgtgccttttttttttccaactgtcttctaaaacacttcaggagat
EXON 2  65 bp
ttaactttccctgtgtattttttgtaatttccttctttttatcctaattatagacttata
atgagaaggaagagttatgttttttgagcaacatcaacaacagacaatgtgaactcaaca
gaagcaaatagaaataattcactgttattaactgtgtttgtgtattatgttttattttag
TCAATCTACTGGATTCAAAAACAATTCAAGGGGAGCTGGGCTGGATCTCTTATCCATCAC
ATGGG
gtgagttcaataaactatcacaaggaaacattttctctattacctgtcttagggagcaga
tgaatttattgtattctctaaagagaactcttgtacttctggtgacaaattatacttata
ggagtattcaatatatggagtaccacagcttgacatttgtgtccaatggagctagtgaga
EXON 3  661 bp
aaattataaattactttatgtccattaactcagagaaccttgcaaataaaaactacaaac
aagaatgtttttaatgagtaaatgatgatttattatatagagatggctctgacaccctta
tgttgtattcgttattatcattaattctgcctcactctctgtttctctttgattcttcag
TGGGAAGAGATCAGTGGTGTGGATGAACATTACACACCCATCAGGACTTACCAGGTGTGC
AATGTCATGGACCACAGTCAAAACAATTGGCTGAGAACAAACTGGGTCCCCAGGAACTCA
GCTCAGAAGATTTATGTGGAGCTCAAGTTCACTCTACGAGACTGCAATAGCATTCCATTG
GTTTTAGGAACTTGCAAGGAGACATTCAACCTGTACTACATGGAGTCTGATGATGATCAT
GGGGTGAAATTTCGAGAGCATCAGTTTACAAAGATTGACACCATTGCAGCTGATGAAAGT
TTCACTCAAATGGATCTTGGGGACCGTATTCTGAAGCTCAACACTGAGATTAGAGAAGTA
GGTCCTGTCAACAAGAAGGGATTTTATTTGGCATTTCAAGATGTTGGTGCTTGTGTTGCC
TTGGTGTCTGTGAGAGTATACTTCAAAAAGTGCCCATTTACAGTGAAGAATCTGGCTATG
TTTCCAGACACGGTACCCATGGACTCCCAGTCCCTGGTGGAGGTTAGAGGGTCTTGTGTC
AACAATTCTAAGGAGGAAGATCCTCCAAGGATGTACTGCAGTACAGAAGGCGAATGGCTT
GTACCCATTGGCAAGTGTTCCTGCAATGCTGGCTATGAAGAAAGAGGTTTTATGTGCCAA
G
gtaagagccttctctatttttctttgagcaatatttctcacctatgagtttatcatagtg
tcattaaatgaaatgcactcagtctcaactcacttggcaggaaaacatgcctcaaactga
ccatagtctatttatggactaaaattaattccatttgatgtggtaattcatgctttgctg
EXON 4  156 bp
aattcaagcatttatgtagaaaaactacagtaggctctgtcatttgcttctgtaaattct
tggaggaaaaaacttgatttttatttataataaattcatattcgaacttacttaaatctg
ttttacatattttcaaaaaaattatcacagacttttaaaagagagtcattttgtttgtag
CTTGTCGACCAGGTTTCTACAAGGCATTGGATGGTAATATGAAGTGTGCTAAGTGCCCGC
CTCACAGTTCTACTCAGGAAGATGGTTCAATGAACTGCAGGTGTGAGAATAATTACTTCC
GGGCAGACAAAGACCCTCCATCCATGGCTTGTACCC
gtgagtagttttgctgcaacccatgcctccatgtttgttttgttttcttcttgttactgt
gctgtttgtttttgttttaaagcatttggcccatttccttctgttgcccgtgtgcaaatt
gaaagctttctctgcttcactccccatgcttggctcaccacaaatgcaacatttatcaca
EXON 5  336 bp
aagacagtgttcttgaatccatgtgtctataatatcatggatcctctaaggatgaactga
aagttgataataaagaaaggatagttatttacctcattcagttccattgtaaattatcta
tttcccttgtagtagaaaacagaagtgaggctcattaatctttgttgaactactttgcag
GACCTCCATCTTCACCAAGAAATGTTATCTCTAATATAAACGAGACCTCAGTTATCCTGG
ACTGGAGTTGGCCCCTGGACACAGGAGGCCGGAAAGATGTTACCTTCAACATCATATGTA
AAAAATGTGGGTGGAATATAAAACAGTGTGAGCCATGCAGCCCAAATGTCCGCTTCCTCC
CTCGACAGTTTGGACTCACCAACACCACGGTGACAGTGACAGACCTTCTGGCACATACTA
ACTACACCTTTGAGATTGATGCCGTTAATGGGGTGTCAGAGCTGAGCTCCCCACCAAGAC
AGTTTGCTGCGGTCAGCATCACAACTAATCAGGCTG
gtgagtacatactagatgcttcttactcttatcatatcacgtctgagtaatggttttgac
tctgggtggaaaactgggcggaaggaaaaaaagattttatagaaccccaggattttgcct
tctaacacatttaaacagttatggcacattaaataatttaattcttcaagtgagaataaa
EXON 6  125 bp
atatggggccagattaatattcaagagccttggaaatggaaatagtgctttcttgccaaa
aaactggaacaatgatagactccatttgcatgttcccttctccctctgttcttattcgcc
accctttctaacccattaatttgcttccttccaccttcccctcccatcctctctttacag
CTCCATCACCTGTCCTGACGATTAAGAAAGATCGGACCTCCAGAAATAGCATCTCTTTGT
CCTGGCAAGAACCTGAACATCCTAATGGGATCATATTGGACTACGAGGTCAAATACTATG
AAAAG
gtggggaaacaatgtttaagggttgggctgtgtaggcaagaagctgtttcctcatgagct
gtgctcttgcaaagaaaccagtgacattcctggtaaatggtagagcactgtttagaactg
tggccctgtgacccctttgatttattggtagaggaaggtttagaaagaatcttgttgaat
EXON 7  1028 bp
aaaatgcctaagttgcgttcagagaataaaataattgaaataatcgatatgactttttaa
atccatcctatgatttgtgttaaaatataaaagaatcaggtttgagtggttcactgttta
tcattttatagcattatgaagatttgattttaacatgaatttttttttctgacctcaaag
CAGGAACAAGAAACAAGTTATACCATTCTGAGGGCAAGAGGCACAAATGTTACCATCAGT
AGCCTCAAGCCTGACACTATATACGTATTCCAAATCCGAGCCCGAACAGCCGCTGGATAT
GGGACGAACAGCCGCAAGTTTGAGTTTGAAACTAGTCCAGACTGTATGTATTATTTCAAT
GCAGTCTAGAGGAGGGGGCAGGGATCTTGCAAAAGATGTCTGATCGTTTATTCTCACTGT
TTCTAAGTTTTAAACAAATGTGATACATTTAAGGTATATTGCTTGGGACATTGCAATTTG
CAGAGCCCTGTGTCTGTATACAGTATTTGTGTTTGTGTGGGTGTACATTTTGTGTTTCTT
TTTTTCTTGTATGCAAATCAAACATATTCTAATGCCTGAAATGCTTCTGTTTTTTTTTTT
TAGCCATAAATTGCTTTTGAGGAACATTATTTAATATAGTAACACACTTCCAGTGTCTGT
CATTTCAGATATTCCAGGTTCATTGCGTGATTCAATGAACCACAAAAAAGAAACTTGCTG
ATCCATGAGAATCTTAATTTTGTTTTAATCCTTAACACATTCAATAGCATATCACAGAGA
GAATAAGGATTTTCTAAAATGTGTTTTATCACTTCATTCACATTCAGAAGTAATTTGAAT
AGCCTGTTCCTTTAACCCCAAATTTGGCTAAAATTGGCCTAAAACTGGCAAACATTTTTC
CAGTAACTTTTCTTTTTTTCAAATGAATTTTCTTCATACTTAAAAAAGCCCTTTGCTAAA
ATATAATTTTCAAAAAGGTAAAATTATGTCTATGGCACTAATATAAAATGAGTAGAAGTT
AATGATTTTACTTAACTCATTTTTTTCTTTCTTTCTTTTTTTTTTTTTTTTTTTGAGACG
GAGTCTTGCTCTGTCACCCAGGCTGGAGTACAGCAGAGCGATCTCGGCTCACTGCAAGCT
CCTGCAAGCTCCGCCTCCTGGCTTCACGCCATTCTCCCCCTCAGCCTCCCGAGTAGCTGG
GACTACAG
gcggccgctaccatgcccggctaattttttgtatttttggtagagtccagatttcaccgt
gttagccaggatggtcttgatctcctgtcaccttgttagccaggatggtcttgatctcct
gacctcgtgatccgcccgcgttggcctcccaaagtgctaggattataggcgtgagccacc