Gene EPHA3 Variant 1
DNA : 374.61 KbNT_022459
mRNA : 5807 bp NM_005233
CDS : 2952 bp NP_005224
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  313 bp
agagcatggatagcaaacaataaaacagctacttttcatgcaacacaaaagagggagcat
ttttctcagcaccgcggcctcatcacatcttctgtgtttcctgtcccatgggcgacgccc
ccactcccacccggtctccttcccgagcagctctgggctgcagagccagctgcgtgccat
CCCGCTCTGCTTCAGCGCACGCTGAAGACGGCACTAGGACCCAGGGAAGTCCCCGAGCGG
GGTTCGCGGAAAGGCAGCCAGACTCCTCCTTATCTCCAGTGTCAAACTTGACATCAGCCT
GCGAGCGGAGCATGGTAACTTCTCCAGCAATCAGAGCGCTCCCCCTCACATCAGTGGCAT
GCTTCATGGAGATATGCTCCTCTCACTGCCCTCTGCACCAGCAACATGGATTGTCAGCTC
TCCATCCTCCTCCTTCTCAGCTGCTCTGTTCTCGACAGCTTCGGGGAACTGATTCCGCAG
CCTTCCAATGAAG
gtaagccaggtaccgcgacgcacggagctctgccccgcggggctcacgctcttcaaagca
cgttctcaccgaagccttgcacgtcgggaaggtgcctccgaatagagcagtttgctctga
gagtgaaggaaagatgtgccttttttttttccaactgtcttctaaaacacttcaggagat
EXON 2  65 bp
ttaactttccctgtgtattttttgtaatttccttctttttatcctaattatagacttata
atgagaaggaagagttatgttttttgagcaacatcaacaacagacaatgtgaactcaaca
gaagcaaatagaaataattcactgttattaactgtgtttgtgtattatgttttattttag
TCAATCTACTGGATTCAAAAACAATTCAAGGGGAGCTGGGCTGGATCTCTTATCCATCAC
ATGGG
gtgagttcaataaactatcacaaggaaacattttctctattacctgtcttagggagcaga
tgaatttattgtattctctaaagagaactcttgtacttctggtgacaaattatacttata
ggagtattcaatatatggagtaccacagcttgacatttgtgtccaatggagctagtgaga
EXON 3  661 bp
aaattataaattactttatgtccattaactcagagaaccttgcaaataaaaactacaaac
aagaatgtttttaatgagtaaatgatgatttattatatagagatggctctgacaccctta
tgttgtattcgttattatcattaattctgcctcactctctgtttctctttgattcttcag
TGGGAAGAGATCAGTGGTGTGGATGAACATTACACACCCATCAGGACTTACCAGGTGTGC
AATGTCATGGACCACAGTCAAAACAATTGGCTGAGAACAAACTGGGTCCCCAGGAACTCA
GCTCAGAAGATTTATGTGGAGCTCAAGTTCACTCTACGAGACTGCAATAGCATTCCATTG
GTTTTAGGAACTTGCAAGGAGACATTCAACCTGTACTACATGGAGTCTGATGATGATCAT
GGGGTGAAATTTCGAGAGCATCAGTTTACAAAGATTGACACCATTGCAGCTGATGAAAGT
TTCACTCAAATGGATCTTGGGGACCGTATTCTGAAGCTCAACACTGAGATTAGAGAAGTA
GGTCCTGTCAACAAGAAGGGATTTTATTTGGCATTTCAAGATGTTGGTGCTTGTGTTGCC
TTGGTGTCTGTGAGAGTATACTTCAAAAAGTGCCCATTTACAGTGAAGAATCTGGCTATG
TTTCCAGACACGGTACCCATGGACTCCCAGTCCCTGGTGGAGGTTAGAGGGTCTTGTGTC
AACAATTCTAAGGAGGAAGATCCTCCAAGGATGTACTGCAGTACAGAAGGCGAATGGCTT
GTACCCATTGGCAAGTGTTCCTGCAATGCTGGCTATGAAGAAAGAGGTTTTATGTGCCAA
G
gtaagagccttctctatttttctttgagcaatatttctcacctatgagtttatcatagtg
tcattaaatgaaatgcactcagtctcaactcacttggcaggaaaacatgcctcaaactga
ccatagtctatttatggactaaaattaattccatttgatgtggtaattcatgctttgctg
EXON 4  156 bp
aattcaagcatttatgtagaaaaactacagtaggctctgtcatttgcttctgtaaattct
tggaggaaaaaacttgatttttatttataataaattcatattcgaacttacttaaatctg
ttttacatattttcaaaaaaattatcacagacttttaaaagagagtcattttgtttgtag
CTTGTCGACCAGGTTTCTACAAGGCATTGGATGGTAATATGAAGTGTGCTAAGTGCCCGC
CTCACAGTTCTACTCAGGAAGATGGTTCAATGAACTGCAGGTGTGAGAATAATTACTTCC
GGGCAGACAAAGACCCTCCATCCATGGCTTGTACCC
gtgagtagttttgctgcaacccatgcctccatgtttgttttgttttcttcttgttactgt
gctgtttgtttttgttttaaagcatttggcccatttccttctgttgcccgtgtgcaaatt
gaaagctttctctgcttcactccccatgcttggctcaccacaaatgcaacatttatcaca
EXON 5  336 bp
aagacagtgttcttgaatccatgtgtctataatatcatggatcctctaaggatgaactga
aagttgataataaagaaaggatagttatttacctcattcagttccattgtaaattatcta
tttcccttgtagtagaaaacagaagtgaggctcattaatctttgttgaactactttgcag
GACCTCCATCTTCACCAAGAAATGTTATCTCTAATATAAACGAGACCTCAGTTATCCTGG
ACTGGAGTTGGCCCCTGGACACAGGAGGCCGGAAAGATGTTACCTTCAACATCATATGTA
AAAAATGTGGGTGGAATATAAAACAGTGTGAGCCATGCAGCCCAAATGTCCGCTTCCTCC
CTCGACAGTTTGGACTCACCAACACCACGGTGACAGTGACAGACCTTCTGGCACATACTA
ACTACACCTTTGAGATTGATGCCGTTAATGGGGTGTCAGAGCTGAGCTCCCCACCAAGAC
AGTTTGCTGCGGTCAGCATCACAACTAATCAGGCTG
gtgagtacatactagatgcttcttactcttatcatatcacgtctgagtaatggttttgac
tctgggtggaaaactgggcggaaggaaaaaaagattttatagaaccccaggattttgcct
tctaacacatttaaacagttatggcacattaaataatttaattcttcaagtgagaataaa
EXON 6  125 bp
atatggggccagattaatattcaagagccttggaaatggaaatagtgctttcttgccaaa
aaactggaacaatgatagactccatttgcatgttcccttctccctctgttcttattcgcc
accctttctaacccattaatttgcttccttccaccttcccctcccatcctctctttacag
CTCCATCACCTGTCCTGACGATTAAGAAAGATCGGACCTCCAGAAATAGCATCTCTTTGT
CCTGGCAAGAACCTGAACATCCTAATGGGATCATATTGGACTACGAGGTCAAATACTATG
AAAAG
gtggggaaacaatgtttaagggttgggctgtgtaggcaagaagctgtttcctcatgagct
gtgctcttgcaaagaaaccagtgacattcctggtaaatggtagagcactgtttagaactg
tggccctgtgacccctttgatttattggtagaggaaggtttagaaagaatcttgttgaat
EXON 7  163 bp
aaaatgcctaagttgcgttcagagaataaaataattgaaataatcgatatgactttttaa
atccatcctatgatttgtgttaaaatataaaagaatcaggtttgagtggttcactgttta
tcattttatagcattatgaagatttgattttaacatgaatttttttttctgacctcaaag
CAGGAACAAGAAACAAGTTATACCATTCTGAGGGCAAGAGGCACAAATGTTACCATCAGT
AGCCTCAAGCCTGACACTATATACGTATTCCAAATCCGAGCCCGAACAGCCGCTGGATAT
GGGACGAACAGCCGCAAGTTTGAGTTTGAAACTAGTCCAGACT
gtatgtattatttcaatgcagtctagaggagggggcagggatcttgcaaaagatgtctga
tcgtttattctcactgtttctaagttttaaacaaatgtgatacatttaaggtatattgct
tgggacattgcaatttgcagagccctgtgtctgtatacagtatttgtgtttgtgtgggtg
EXON 8  103 bp
aaatgtctatttttttaaacattaagtaaagaatactttcaacattgtatcagacattaa
gccatacttcaggtaaaagtagaacacatattaattaattaatgaatcaatcaactgttc
catgtagatgttagtcatgattataatacctgttcttattttttctcttcaacctcacag
CTTTCTCCATCTCTGGTGAAAGTAGCCAAGTGGTCATGATCGCCATTTCAGCGGCAGTAG
CAATTATTCTCCTCACTGTTGTCATCTATGTTTTGATTGGGAG
gtgagttcacagtctgtttcactattcactttctttgttgctttgtttgctgccactgat
tgctgttaaaatgtgaagagtgtgctcaataaaatattttaacaaataagaatgtctcca
cttgtagtttaggtcctctctttctcctccttttctttgtttctccatccttagttttga
EXON 9  65 bp
gttcccagagagaggggctttcttcagaggattttgaaaatatgaagttattaaactttc
actaaagcatttaattgtttgaggaaaatgttttatttttatgctttgcacattctgagc
ataggtaactattttaaatatattcctcttatgtgttcgctttccttgatttacctccag
GTTCTGTGGCTATAAGTCAAAACATGGGGCAGATGAAAAAAGACTTCATTTTGGCAATGG
GCATT
gtaagtttctaaacttggctttttgttttgcttcaccgttttagctttagcagttattga
tttacaattggttaacttcctcctgacaaagagacttcaaaagtagttttatggaaaaac
tgagtacattaaatttattttagaaaaagagggaaattcatggttctgcattaaataatt
EXON 10  126 bp
cttaaatttttcaacacagtccaatgtcactgccagtttctgtgatactacagaataaac
tgaaggttgtgcaccttatggggtagggatttttttaaaccaataatgccataaaatttg
atctataattgtttgtacaaatctagctacaattgcgcctttctttctttcctcaaacag
TAAAACTTCCAGGTCTCAGGACTTATGTTGACCCACATACATATGAAGACCCTACCCAAG
CTGTTCATGAGTTTGCCAAGGAATTGGATGCCACCAACATATCCATTGATAAAGTTGTTG
GAGCAG
gtaaccacaatgaccctactgccaacttagtactgtatgtgaatcacgattgctcagtct
ctgaaacctaagtatattgctaaagaaatgggaattttctgatttcatgatcaaaggcaa
gtaataaataagtgcaatatttaatggaatgtaatgagttcaaaggtgccagacttaccg
EXON 11  186 bp
ttttctaggcagtttcatatgattatctttcaaaataatttggagtactagagtgtacat
cttgcaggtcaaaggcacaaatattttaaatggaaattttgaaataaaacagttgctctc
tactgatgaatttttattatagaattccttacattttgttgctgttctgctttataacag
GTGAATTTGGAGAGGTGTGCAGTGGTCGCTTAAAACTTCCTTCAAAAAAAGAGATTTCAG
TGGCCATTAAGACCCTGAAAGTTGGCTACACAGAAAAGCAGAGGAGAGACTTCCTGGGAG
AAGCAAGCATTATGGGACAGTTTGACCACCCCAATATCATTCGACTGGAAGGAGTTGTTA
CCAAAA
gtaagtaaagtagtcataagacctgtgtttccgtatgttgagcaaaggttgtttaaaccc
aaccccaaccatttaagaattttggctttttttcataagtatctcagttttaccaaaaag
aaaagtttaggaatagcatgcctttctttgacagtagagcagacctttaaataatattct
EXON 12  62 bp
tggtttttaaagttttattttctaatgaaacctagggctttttaaaatttttaaaaatta
gaagacaggcaaagttcttacatctctataatcctcaggtaaatccaactatattatata
tgttcattgtataatacttgaactgtactgattattatttattatttactgtatatctag
GTAAGCCAGTTATGATTGTCACAGAATACATGGAGAATGGTTCCTTGGATAGTTTCCTAC
GT
gtaagtaagatgcacacacatacatatatatgaataaattgctgaaaacattagagacac
cctccaatattgtgccaagcaattcagtaatctaagtttaaagtaaaactgaaatcttct
gaggctaaatagacagagaagggctgtaaaattgcatctttttttgcagcattcaaatgt
EXON 13  210 bp
gtgtgttattttgtttcagccttgtatccatttgccacatatctttgtcttgagtgctta
ggactaaagtgtgtatagtcagtcttgttacaaaattcaatatgtgagattttaaccaat
aaagatatatctttaagaaataggaacgtatcttaattgtacatttgaaatgcttcccag
AAACACGATGCCCAGTTTACTGTCATTCAGCTAGTGGGGATGCTTCGAGGGATAGCATCT
GGCATGAAGTACCTGTCAGACATGGGCTATGTTCACCGAGACCTCGCTGCTCGGAACATC
TTGATCAACAGTAACTTGGTGTGTAAGGTTTCTGATTTCGGACTTTCGCGTGTCCTGGAG
GATGACCCAGAAGCTGCTTATACAACAAGA
gtgagtaacttagattttctccttttttatcattgttttccatcttgtatcatgttgatt
tgtaaataagtagaaatcatgacccaaaacgtgttgtcaattatgctttccacaatagaa
aacatatcttaaaattaaaatattattatttattctgggtaaatagatggtcactgttta
EXON 14  150 bp
aatggtatgctacttctgcttggtattgaaatagaataacatcaaaatgtttcacagaaa
tgcatattccatttcagaacagaaatactatgagaaattctgtccggtttcagattatgt
tatgtatattatatgttctatgcattgctgatttatgtagacatgattttatattcaaag
GGAGGGAAGATCCCAATCAGGTGGACATCACCAGAAGCTATAGCCTACCGCAAGTTCACG
TCAGCCAGCGATGTATGGAGTTATGGGATTGTTCTCTGGGAGGTGATGTCTTATGGAGAG
AGACCATACTGGGAGATGTCCAATCAGGAT
gtaagtatttgtggtctatgagttatgagttcagatgaaaagatcaagctgtgcaaggaa
gtggaacataatgtaactgggtggctcctggtttataacactgaaataaaatatttagca
gcaatgaaactgtttccaagtcttgcaaggatattatattaattgaattgttcttacaga
EXON 15  194 bp
taggcatacataacgtcttatttatttgatcagttgttatccttttaggcaactaaaaat
gagaagttttcccacttacctttaaaataagcatatttgtgagccccgcccatgaaaacg
taaactaagtgacacttcctgaaaacttcctggttcctgaaaactttgcttctcacacag
GTAATTAAAGCTGTAGATGAGGGCTATCGACTGCCACCCCCCATGGACTGCCCAGCTGCC
TTGTATCAGCTGATGCTGGACTGCTGGCAGAAAGACAGGAACAACAGACCCAAGTTTGAG
CAGATTGTTAGTATTCTGGACAAGCTTATCCGGAATCCCGGCAGCCTGAAGATCATCACC
AGTGCAGCCGCAAG
gtgacacattcaatttgttatctggcattcactctgaaatttgtgtttgctatctccaag
atgttaatttttttagcccacccccaaaatgcattatttgaagcttgtattccaccatat
tagagagatgtatttcccctttcttttttaatctttagaactaattctcgtcctccttaa
EXON 16  156 bp
acggcgttcctccaagctgccagcttgaacagatgaagctttcatggcagataaattcca
caaatgaaaggaacaccatatgaagtctggaagttcctgccgatgttagtgtcaaatttt
gacacacagcaactctgctgactcctgatctgtctccctttggtgttttttttcttgcag
GCCATCAAACCTTCTTCTGGACCAAAGCAATGTGGATATCACTACCTTCCGCACAACAGG
TGACTGGCTTAATGGTGTCTGGACAGCACACTGCAAGGAAATCTTCACGGGTGTGGAGTA
CAGTTCTTGTGACACAATAGCCAAGATTTCCACAGA
gtaagaaaaaaaaattcattaagaagaatgaaggattcttttgaactttcttggcttgac
atgaaagatttgtaacatcttggcttgacatgttacaaatattagtggtagatctgaggt
actgactaccgcctggaactgctaatcagggccctgggtctccttgtggcccacagcttc
EXON 17  2736 bp
catctatatagccttctacaagatggtggaacggtccggacataacacagatgatgcaaa
tatcagacaattaggtccacagtactagaatataacatcgtgcaaattgtgctaattgaa
aatctcctgcttatacactatcgaggaaaccgattcttatattgttttctttttttacag
TGACATGAAAAAGGTTGGTGTCACCGTGGTTGGGCCACAGAAGAAGATCATCAGTAGCAT
TAAAGCTCTAGAAACGCAATCAAAGAATGGCCCAGTTCCCGTGTAAAGCACGGGACGGAA
GTGCTTCTGGACGGAAGTGGTGGCTGTGGAAGGCGTAGCATCATCCTGCAGACAGACAAT
AATTCTGGAGATACTGGTGGAAGTTCCAAGTCCAATAAGACACTCAAATATGAGTACAAA
TGCCTTAAAATGGAATTGAAAAACTCTTTATTTTCCCCTATCATTTATTGGATGGGTGGG
TGGGGTATTTTTTTGTAATTGCTTTTTTAAATATTAGTTAATGGATTAAATTTAATTCTT
CAGCGTAAAATGGTGAAGAACTAGCATATAGCCATTGATCATAAACTGACTATCATAAAA
TCAAAACAAGTGAAATAACAAAATGGACATGGTGGCTTTGTTTAGGTAGAGCCACAAAAG
AAAAGACTTGTAATATTTTTATATACAGAGGAAATCTGTAACAGGTATTTTGTTTCTTTT
AAAGCAAGCAACACAGAGGAATTTATACCTCAAACTATCTGGCCATATTTACTACCTTAT
CACTGCATTATTCTCTTTTATCTGTTTAAAGCATATAGAGATGAAGTTTGTAGTTGTTTT
AAGTACTACACATTTTTAAATTGTTAGCTTCCTTAAGTATATCATGTAAAGAAATGTCTT
AATTTTTGAAAAAAGTACATATTTATTTTCTTTTGAATTGTTTTTATTGTTTTCTATTTA
TGCCTTGATGATTTAATATGGATTTGTTACAGCCAAGTGCCAAATGCTCTCTCAAATTGT
CAGCAATTTAACTAGACACAGATAATAATGGGTTTCTTTCAGATTTTTTGAACCATCCAC
TTACATATATTTTTAAAAAATGAAATCCTTTTCCTGTTCATACACTAACCAAATCTCTCA
AATCTGTTATCCCAATCATTGTTGCCTCTCCGTTTATTATAAACTGTATGCTCACAACTT
AGTGTAATATACCAGCTTGTATGCAATGGATTTTCAACCAGATAACATACCTTTCCTGCT
CTGGTGCTTAGAGACTATCAACTCCCTCCTTTAGTGAAGGAGCCGTGTTAGAGCTTCCGA
GAATAGCTCCACTGGAGAGAAGTGGAATCCTATATAGAATGCTGCACTAATTGACAACAC
AGCCTATAGGCCAATGCATGAGTAAAAAAAAAAACAATTACTGGCTCACTGGCTTTGAAA
AGTCACTTACTATTGTTGCTGAAACTTGCTGAGCTGTTTATAGAGAATGATGATAACAGA
ACTTTTCCTCTGTATCACTGGTGTTTAGGTGAATTAATTAAACATTGTGATCATTAGTAC
CAGGTATTATTATCTTTAAGAGTCTTCCACTTCAATGCACATGGTGCAGTTTTGGTGTGT
AACTTAGAAGGATTGAACTTCTTTGAATTTACTGGACATAACATTTTCAGAATAGTTGGT
CATCTAGCAACCGCCTCAAAATGTGTAAGCAGGAGAGAAATTTCTCATCACAGGGATTTA
GACTTACTATTACATAAAGGCTAACTATGAGCTTGCTCATTAATTTTGAAAAGATGTACC
TGGTGGATATCTAGCTAGTAATATATTCTGAAGCAACATTTTAGCTCTATTGATACTCTT
TCTAATGCTGATATGATCTTGAGTATAAGAAATGCATATGTCACTAGAATGGATAAAATA
ATGCTGCAAACTTAATGTTCTTATGCAAAATGGAACGCTAATGAAACACAGCTTACAATC
GCAAATCAAAACTCACAAGTGCTCATCTGTTGTAGATTTAGTGTAATAAGACTTAGATTG
TGCTCCTTCGGATATGATTGTTTCTCAAATCTTGGCAATATTCCTTAGTCAAATCAGGCT
ACTAGAATTCTGTATTGGATATATAAGAGCATGAAATTTTTAAAAATACACTTGTGATTA
TAAAATTAATCACAAATTTCACTTATACCTGCTATCAGCAGCTAGAAAACATTTTTTTTT
TAAATCAAGTATTTTGTGTTTGGAATGTTAGAATGAGATCTGAATGTGGTTTCAATCTAA
TTTTTTCCCAGACTACTATTTTCTTTTTTAGGTACTATTCTGAGCATACTCAACAAAACC
CATGCATTTCATAAACTAATAGAAGTTGAGGATTGTTGAATCTATTTCACTTATTTTGGC
TGTGGTTTCCATCTGAAAGTAGAGGTTGTATACACCATATACTGTTCTTCATTTTATTAA
TATTTTTCTCCTTGACCTCTCATAAATTTACTTTACACAATTCTTACCCTGTACATATGT
AAACATAAGTGTACGATTCTTAACCATGGAGTAGAGGTACTAGAATGCTTACGGCCATCT
CTTTGTACAGGAACTGCATTGACTTTCAGTAAACATAAAGCCACAACTCCTACATGATGT
TATGTACCATATGATCTGTTTTGTATCTTAAATTTGATTTACATATATTATTTATTTCTG
GTAACTCACTCAGTTTATGCTGTGCTAAATATCAATCAAGCCATGTATAAATGTGATATG
ATTGGCAATATGTGTTTACTTTAAACTTGTCTTTTCAAAATATTACTCAGTTTATGTTGT
ACAATGTAGATGGCCTCTTACTAATGTAAAATGATTTGTAGTGGAAACATTTATATTTTT
ATAATAAACATAATGAAAATATTTTTTACAGATTGG
aatacagaagtggtctttgaagttttttaaaaatatataaaactatgtgcttatttaaac
agcaaaataatgaaatttacataagtcacaaaaatatgcttctgggcttttattctccat
tagtgaggagggatttacattgtataatccacatgtttttggtctacatctcattatgaa