Gene ENTPD3 Variant 1
DNA : 41.42 KbNT_022517
mRNA : 2772 bp NM_001248
CDS : 1590 bp NP_001239
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  60 bp
tctctcccttccccttccatcgagggctgggtgtgaaggtgagagcaatcagaaaagaag
gtgaagaggtacttggccttgacacggacggggggggcggtcccaggccgaggccgcccc
gcccccgccccgctatacccggcgccgcctcccggcgtctgagctgacacctccttagcg
CTGGCCGCGGGCCGCCTCTGCGGCAGCGCTAGTCGCCTTCTCCGAATCGGCTCCGCACAG

gtaagatcaggggacccggcgcctgagctgccgaggaaggagtcgggggtgctgcgtgag
actgagagttgggaggcaaagaaacaaaatcggatttcctcagagggccagaggaagaga
ctgaaacacggtagccccaaatccttgggcggctgggaggtggtccctgtcatgcccacg
EXON 2  52 bp
gaaatttaagctccagctttggggctgtctctgaagttctggggttcggcttacctttcc
cgggatgaggttttgatttggaggaagtaaaatgggttttgtcttaacctgggctcgttc
tttaaacttgtgaggccggggcggtggacttactgacatcctgtattctctcacctgcag
CTAGGAGAAAAGATGTTCACTGTGCTGACCCGCCAACCATGTGAGCAAGCAG
gttagtatctctcagcaggtagcaagcgtggttttgccaaatcgcaagagaaccccagct
tcggcctacagtttttcatccatatcccctgcaaatgattgtttaactttattggtttga
gactcagtactcagctgggtttcaacaccggcattcctcaaataaaagtaatgcttttca
EXON 3  128 bp
cccaaaactggggagaaggggagcttatttgctactccatcttagaagtgtgggtctcgc
taacaccagagaaggtggtttatgcacctgattatggggccagtccatcaattctacaaa
gaataccagtgcctggtttttacctccccctcaagtgtcttctgggtcttctcattttag
GCCTCAAGGCCCTCTACCGAACTCCAACCATCATTGCCTTGGTGGTCTTGCTTGTGAGTA
TTGTGGTACTTGTGAGTATCACTGTCATCCAGATCCACAAGCAAGAGGTCCTCCCTCCAG
GACTGAAG
gtaagtgtgaagggactggcaacaaagggaagaaatgagcataaaggggaagaaatcaat
tattccaaaaccatgagttagaagagcagaaaatcctttccccccatctctggctgaagc
caggagaagttagtgtaagacgcaagggagaaggtctggacatgctgggtttgtgatatt
EXON 4  118 bp
cttccctcacaatccaaggagacaaaattggtttggagaaaataatttttcttattgatt
agcccttccctaagcgaagcagtgtggattaaggtactcagggttctcagtggcccactg
agaaagcagtcctcagaggagtcccgcccattctgactctccctttccctttttattcag
TATGGTATTGTGCTGGATGCCGGGTCTTCAAGAACCACAGTCTACGTGTATCAATGGCCA
GCAGAAAAAGAGAATAATACCGGAGTGGTCAGTCAAACCTTCAAATGTAGTGTGAAAG
gtaaggactgaagtgtgtctgggagtcacaatgggcagcaaggtagagttctaagtgttt
tggaggcctggagaggtcctgagatgttgcttggaggcagggaatgagcattggactggg
agtcaggaaataggagatcgtgtgctagtgctgctactcatcagtggaataaacttgctc
EXON 5  151 bp
cttttagaggttgcaagtatactgatcagtgtgaccatacgggacttaccacatccagct
gttttcgaccccctaccaaaccccaataattttcaaagccaatttgttttttatttaaaa
gttgtatcactgcgattggttcctggaaatgctgacagatgctgactgcttgcttttcag
GCTCTGGAATCTCCAGCTATGGAAATAACCCCCAAGATGTCCCCAGAGCCTTTGAGGAGT
GTATGCAAAAAGTCAAGGGGCAGGTTCCATCCCACCTCCACGGATCCACCCCCATTCACC
TGGGAGCCACGGCTGGGATGCGCTTGCTGAG
gtaaaggctaagtggcacaaaggagcccatttgaccaaaataaccaagaatatgttgaat
cttgccaagaatgtaactctatttctgggaacaaccctcgccccccaaaaagaagcccac
attctgccataaatttgggctttaaaggttgggaaacttttagtttttattttaataccc
EXON 6  160 bp
agttgccccagaaggcttcaacttgcaaaagggattgtggtgtacagcacacatctggaa
aatcattcatccccaccagcagggagacggtgaagtttgcattttcacctgagtgagact
atgtattttaagactgtattgtctgggcactcagacttgtttgttctgtgccttgtacag
GTTGCAAAATGAAACAGCAGCTAATGAAGTCCTTGAAAGCATCCAAAGCTACTTCAAGTC
CCAGCCCTTTGACTTTAGGGGTGCTCAAATCATTTCTGGGCAAGAAGAAGGGGTATATGG
ATGGATTACAGCCAACTATTTAATGGGAAATTTCCTGGAG
gtgtgtgcaaacaaatgcatggtttttaatcttactgtttatcctatcccctgtgagtga
tagcctaagtagaggtacatgccatcagggatatctgccctgtatcactcctaccatgta
acgcattagggaaatacctatgagacaatagctaagaaagacatatatagctggggagaa
EXON 7  234 bp
ctgcccagttcctgtaagcattttaattcaccacctctaaaagaaaaggaaagaattggc
ctcacatgctccctctgtcctacttcttagtaataggagacgaggcttgggtggagaact
ctgggcaaacagagatggtgcctttggctttctttctcacttccttttcccactgtgcag
AAGAACCTGTGGCACATGTGGGTGCACCCGCATGGAGTGGAAACCACGGGTGCCCTGGAC
TTAGGTGGTGCCTCCACCCAAATATCCTTCGTGGCAGGAGAGAAGATGGATCTGAACACC
AGCGACATCATGCAGGTGTCCCTGTATGGCTACGTATACACGCTCTACACACACAGCTTC
CAGTGCTATGGCCGGAATGAGGCTGAGAAGAAGTTTCTGGCAATGCTCCTGCAG
gtacttgagtcgggggtagggggtggcaggtgttctcttgagggtttgagctgaggggag
aatgccctgccttctggggtctgtcctctccacttcaattgaaaggtagatggaaataac
agcattttccaatttactcctgggggtccaagtccctttcctctctgtctctttcttccc
EXON 8  273 bp
ctacaaaggacatgaactcatcatgttttatggcttcatagtattccatggtgtatatgt
gccatattttcttaatccagtctatcactattggacatttgggttgattccaagtctttg
ctattgtgaatagtgccgcaataaacatacgtgtctaacaccttactcttatacctacag
AATTCTCCTACCAAAAACCATCTCACCAATCCCTGTTACCCTCGGGATTATAGCATCAGC
TTCACCATGGGCCATGTATTTGATAGCCTGTGCACTGTGGACCAGAGGCCAGAAAGTTAT
AACCCCAATGATGTCATCACTTTTGAAGGAACTGGGGACCCATCTCTGTGTAAGGAGAAG
GTGGCTTCCATATTTGACTTCAAAGCTTGCCATGATCAAGAAACCTGTTCTTTTGATGGG
GTTTATCAGCCAAAGATTAAAGGGCCATTTGTG
gtaagagcaaaaccttctgaaagattcctttccccattgaatattcatttctcacttttc
tgtttctcctctgctgacttgttagccaccttcttattcctcacccataaacctttctat
tataccccattctgagaactaattttcttctgtattacttatttccaggcttttgcagga
EXON 9  111 bp
gggccatttgtggtaagagcaaaaccttctgaaagattcctttccccattgaatattcat
ttctcacttttctgtttctcctctgctgacttgttagccaccttcttattcctcacccat
aaacctttctattataccccattctgagaactaattttcttctgtattacttatttccag
GCTTTTGCAGGATTCTACTACACAGCCAGTGCTTTAAATCTTTCAGGTAGCTTTTCCCTG
GACACCTTCAACTCCAGCACCTGGAATTTCTGCTCACAGAATTGGAGTCAG
gtcagtatttaaagagaagggatcaatgtcagtacaaaaaaatatggtagaatctattct
atgtgtgtgtattctgaatttagcctttatgctcttctatttccatcacatctgtaaaat
aaaaggaataagggaatctactcccacacctgtggtgtgaattaatgttataactacatg
EXON 10  138 bp
gtgatattatatagggatattttcataattatattgtgtgattatatgattgtattataa
agtattttctattatgaaattatgggtgataagattctttaaaacatgacttttaaccca
aggtgttcattttaaaacatacctgcctgccctgcctctcagatgttttaaacctttcag
CTCCCACTGCTGCTCCCCAAATTTGATGAGGTATATGCCCGCTCTTACTGCTTCTCAGCC
AACTACATCTACCACTTGTTTGTGAACGGTTACAAATTCACAGAGGAGACTTGGCCCCAA
ATACACTTTGAAAAAGAA
gtaagttaagcacaaatcattttctcttcttcttcccaacagagaggtttgtatgtgtgt
gtggaacaaatgtagaaggtaaaagggtattaatgagttaaactcactgggtggaagctg
atcagactgatcccttgtgagtttcccagaagaggtcatggagaatttagaagagttgct
EXON 11  1347 bp
tgagatttccccaagcctttgtggctacagtgtggtgtcttaacttgggcaagtcctttg
acctctttgggccacaatttcccatgggagctttgtgaggttgatagcagtatgactccg
gtatgtgattgcagccttgagccttgccctgagcgctgagccatctcctctactccacag
GTGGGGAATAGCAGCATAGCCTGGTCTCTTGGCTACATGCTCAGCCTGACCAACCAGATC
CCAGCTGAAAGCCCTCTGATCCGTCTGCCCATAGAACCACCTGTCTTTGTGGGCACCCTC
GCTTTCTTCACAGCGGCAGCCTTGCTGTGTCTGGCATTTCTTGCATACCTGTGTTCAGCA
ACCAGAAGAAAGAGGCACTCCGAGCATGCCTTTGACCATGCAGTGGATTCTGACTGAGCC
TTCAAAGCAGCTCCTGGAGTCCAATGGCTGCTTAGAGTCAGCCTGGGTGGCACCAGGCAA
TGCAGGTGAAGTGGCTGCCTTCAGGAAATACAACTAACTAAAATCAAACACCTAGGTCAC
GTGCCTCTCAAATACTGATTTCTGCCACAGCACCTCTTGAGGCATCCCTTGGCTATTCTG
TGCATATTGTTCTTCAGAGACCTCACTACCCACATGCTGATCTATTGGGGAACAGAGAAG
AGACAGGCCACGAAGGTCAGGCTCTTTATATTAAGTTCCCCAGAGGAAGAGTAAGTTGAG
AAGGTATCAGTTTAATGTTGAAGAATTGACCTCAGGGCTCAGTTTCCATTTCCCTCCCTC
AGTATTCTTCCTGGCAAGATACCCATTAAGCATTTCGCCAATCAGAATCTCATTTTATAG
TTTTTCCCATTGGTCTTTAACTAAGACTTTCTTGTAGCAATCTCGTAAGCAGTGAACCCC
CTCAGATCAGTAGAATATAGTATCTGGGGGAGAAGACTTACTTCCTTCAGGGCAGCAGCC
ACAGCCAGGCTTCTGTCATACAGGTAGATCCCGAAGCACAGAGACATAAAAAAGGTCTCC
CAGAAAACTATAGACCATTCTCCAAGTGGAATTCCCACTTAGGGCTCTGGTCACTAGATT
GCAACCTGTGTGTTTGTCATCATCCTCATCTCACCATTGTATTGCTATGCCCTCCCATAA
AAACACATTGATCCCTAGCAAGATTATTGCATTCCAGATTTTACTGCCTTTGCTAGGCTT
TTGCTTAGCAAAGGGCTGACTTTCCATTGTTATCATGGTGTATATATTTTTGTCACCATT
CCCACAAGTATACTTGATGTTGTCATAGAACGAACATCCTACTCTATGATTTACTAACCA
ATTACTTTCCCAGATCATAGACCTCTCTGCATAGTAGTCATAGGTCTTGACTTTGGGGAA
AGAAAAGGAAGCTGCAGGAATATTTATCTCCAAAGTCGAATGAGAAAGAACTCCAGCAAA
TCCAATGGCTACAAACTAAAAATCAGCATTATTTCATATTGCTGTTTCTTAGCTGAATAT
GGAATAAAGAACTATTATTTTATTTTG
acttgcaaggggtgtgtgtgtgttaacttccatatggtactctttctcctaaggacccta
ggtgatatttatgagagaaatttttttccctagcaaattaagaaacccattcattaatat
cacctttattccagagagttcaaagtgcttttactttgataaacctttgactgcttgaga