Gene DZIP3 Variant 1
DNA : 88.54 KbNT_005612
mRNA : 4247 bp NM_014648
CDS : 3627 bp NP_055463
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  57 bp
cttctagaatggtaaaaacctttgggttattttagcagctcagtggtgacatttcaggct
gactgcttccttttggttgctaggcacttcgcctttctcgcaacagaggctgtaaagtgc
tactgctgttgctattgctggtagtgtttgccacacatacctgtttagctcctgggaaat
GATGAGATTGATGATTCTTTCTCCTGGAAAACCTTTCATCACAGAGATTCATCTCAG
gttgtattttgagcaagctgaaaaagccctagcctttcttaactctgttaattcgggatc
caagtatctttttgatttgttgattaattttccacccatttctttttcaagctgaacact
gaacagcttagcagaggccttctgtcctctcttatctcatcaccagaggattttcctccc
EXON 2  104 bp
ttggtaaaaaataagcatattaaaggatgagtagtgattatgtttgggtggcgaaactat
gattcattttcttcttttagagcagtttcagattttcttcaaatgatcacgttctgtttt
catagtggggagaaagagtgtaactttcctatcttcataaaaatattattttccttacag
CATTAAAGGGCAGTATTTAAAGTCAGTTGGCAAGCAGTGGAATAAGATTTTTGTAAAGAA
ACCTTGTGCAGCATGGATTCTCTACCAGATGAATTTTTTGTGAG
gtaaggccacagtccccaacctttttggcaccatggactggtttcgtggaaaacaatttt
tccacggatggtgggggtgcggggaatggttttggggtgaaactgttcgacttcagatca
tcaggcattagattctcacaaggagtgggcaacttagatccttcacatgggcagttcaca
EXON 3  70 bp
ccaattcgtcttctttaacatgagtctctaaagagatatggcacctaccaccattaccag
tctttgatacattttggttacactttcagacaataattcaattgttagattctttactac
tacaatttgtgttctttgtgagaagatgctcttaatatacctcattttcatttaaaatag
GCATCCTGCTGTGGAGGATCAGAGGAAGGAAGAAACTGAGAATAAGCTAGAAAAATCATC
TGGTCAACTG
gtaagagaaagtttaattttcattaactgttagttaattgataattaattatatatgcaa
atgcagtaatacatctagtcagtttaattacgtgttaaaattttttgagtgagcctactt
tcctaccttcataagtaaaatggtcacagttaaatcttgctttgatgattgatactgtat
EXON 4  156 bp
gttcctagagagcagagaacatattattcttccttagattttttataattctgtcataga
agctaggagaacaagggaaaatgagctttgttccttttttaatgctttggctgatcttag
aattaagagtgaatgagaatatgcaaactgtgtaaatttttaatcaataatgtcttctag
AACAAACAGGAAAATGACATACCTACTGATCTTGTCCCTGTTAACCTACTATTAGAAGTG
AAGAAGTTATTAAATGCAATTAATACTCTACCAAAAGGTGTGGTTCCTCACATTAAGAAG
TTCTTACAAGAAGATTTTTCCTTCCAAACTATGCAG
gtaacgtcataagttgttatttggggcagaagtgcagctgtctgtatatgacttttttaa
ttaaaattctttttaaaccacacagtatagccaaggtcttgaaaaaaatctccatcttac
ttcttgtaaagggctttgttgtcaaccttgactgtagacttctaaaaagttgaacaaata
EXON 5  117 bp
tacttaaaagcaaacatatgagaacagtgtatctggttggtatggattttttttttttaa
accgtctttatctctatttttaaaattttctccaatgagcatgaattatttgtataatgt
aaacatatgtagatgtttgttcagacttatagacatttttaactgaataattttccacag
AGAGAAGTTGCAGCTAACAGCCAGAATGGTGAGGAAATTGTTCCTGCTTTGACTTTACGT
TTCTTGATTACACAGCTAGAAGCAGCACTTAGGAACATTCAAGCTGGCAATTATACC
gtaagtgttttctttttggaaatttgatataatggacttggtcaacatttctcagtgaga
aaacagccaatgcatgcttattttaaggtgtgggccaatttttatttttttcttttacct
ctagaaaagggtatgtataaattgattgccttcctgtgtcttgtactttcttatatgact
EXON 6  81 bp
gggtcaaattatcaaatatatctaaaatacattatcgttattattagatgactgataatg
ttttgataatttttacttgttttaataattattaattaagcttaggatatttaattaagc
ttgttgtactgaaaagtagcttagtctaaataaccaattaacatatttttttctttgtag
GCACACCAGATTAATATTGGTTATTATTTGACATTACTGTTTTTATATGGAGTAGCACTC
ACTGAAAGAGGAAAGAAAGAG
gtatgtaacatgttatttgccctttataaatctttttacatcttggaataatcaggccaa
agattataatatgaaactaaaaatattaaaaaaggaaacttaatattagcttataacttc
atttcttttatttatcttttgaatgcttaccattcatgtaaaataaaaaattatttagct
EXON 7  125 bp
actacatgatctttgtaatcacatgcagagatgccaggattcagaatgtgaataaatgac
cagatgattgtattatttttaaagctgccctaatttctccagtttgagaagtaattgttt
attgtaaaaaaaaaaaaaatgacttttacagtagccaaacctagttttatgttactacag
GATTATACAGAAGCTGAGAATAAATTTCTGGTGATGAAGATGATGATCCAAGAAAATGAA
ATTTGTGAAAACTTTATGTCTTTAGTTTATTTTGGACGTGGTTTACTGCGATGTGCTCAA
AAGAG
gtaaggattttaattaacgggtagatgttgcctgtgaagtctcagcattgtgaaatggaa
gtaagtgtgcacagtatatcaggcattgtgacatttgtgctctactgttttatccttttc
ttctttgcctatttgtatagataatttctttaatgtagttgagaatattaaatagcaaac
EXON 8  115 bp
ccacctgtatttcatgccaatctgccacaggtgagagtgctagtatttgtatttctatgg
catgccagaggttatcaccaccctatttaccacaaaaaaagggttatttgttgtctcatt
ggtaaaccatgcatctacacagtcccgttcaaactaaccttattttaaaatgcctttcag
ATATAATGGAGGACTGCTAGAATTTCATAAAAGCTTACAAGAAATTGGAGACAAAAATGA
CCATTGGTTTGACATAGATCCTACAGAAGATGAAGATTTACCTACAACTTTTAAA
gtaagaaattatttaagagtaacattttatttgtaactaatcagaataaccaactatatc
atattcttacagcaagcatgttcttttattggcacataactttttatacaagaaacaacc
tttattgcattacctagtgcagaacgtatgattcaacaaggagggagaagtgaggtggca
EXON 9  120 bp
acattgtttactttgaattagggaaatgttttattactattaaaaaaatacatatataca
agtacttcgaaaagggatatgatatggacatattaccaaggtaaaacatgggtagtctta
attgtggtgttaatttattattagtaattcatgagaattctttctgtttttaaaatctag
GATCTTCTTAATAATTTTATCAAGACAACTGAAAGCAATATAATGAAGCAGACGATTTGT
AGTTACCTAGATTGTGAACGATCTTGTGAAGCTGACATTTTGAAGAACACCAGTTATAAG

gtactgtaattgtcaattaacagtatttttaaaaagtaattgaaaaattatatataacta
tataaaataataaaaattatattatgtataaaatattttaaaagagcatttagtttaatt
acaatggtaaagcagttgaaaagttattttactatgagaacttagattcagagtgatcag
EXON 10  102 bp
tagtgatgtaaaaatgacttgtaaagttatttggtgatctctgatttctgttgataaatt
ttgaatgccatgtaaaatctatctaattatagaataatttttaaagtgacaatataattt
tttttatctatacaagaatcaccatgtccttattgataacttacttttatttttttccag
GGATTTTTTCAGTTAATGTGCAGTAAAAGTTGCTGTGTTTATTTCCATAAAATTTGCTGG
AAAAAGTTCAAGAATTTAAAGTATCCAGGTGAAAATGATCAG
gtattatattcgttcttaaaactacaacagcatttcttcctctaccctttcctcttttgt
tctcttccccatcgtttcttcctgttcataacttccctcctgctttttacttcctccttt
ttttctttttcttttacttccttctttgttctttcccaattctctctgatgcttatctcc
EXON 11  93 bp
aaataggatatccattgatatatgaaatggaccatcttttaacagctacatgtcaaatat
tcacatcttccagtttactgtctagcaacatttgcttctaactacatttatttaaatata
atcagatttgcacatcagtgatttttttctatttttatttttttctattaataaatttag
AGTTTTAGTGGGAAAAAATGTTTGAAGGAAGGATGTACAGGTGACATGGTAAGGATGCTG
CAATGTGATGTACCTGGAATTGTTAAAATTTTG
gtgagtatcttgttttgtccttttttttttttcttgctttccttccttggaaaaatattt
ttgacttgaaacagacctggggatcatcataattagattccagccatattgcctttaatg
gtgactgagctcttgaacctttttattaccatgatttatacaaagtaatgtttaagtggt
EXON 12  53 bp
ctagttcgtttttttgatcaggattatttattacttaccttgttattcatgttttgtttg
ttttatattcactgtggcttcactctcattgtatgtttcaaatgttaagctaagaaataa
cattaaacattttgaaaattgaactactttagggctattttttttccccattacttgcag
TTTGAAGTTGTGAGAAAGGATGAATATATCACCATTGAAAATTTAGGAGCAAG
gtaagcttaaaataaaatactctgttaccttttttggaatatgcatatattttttggttg
cttaattcttctgtgtttctgtcacctaatagagctgcattaaattttaaggtatgtgaa
aaaatcatatttaattgccatttctttccctctctatcaccacttattgtagacatttac
EXON 13  77 bp
aaagtgacagtgtagggttttcattgttggtgagctctatttgttcattattttttctcc
ttcttgaattatttctaggagaagatgaaaatactcacttagccatgctcatactagaaa
tcttgactgactttggtattattttatttccactataacttaatttttttccttttgcag
TTATAGAAAGTTGATATCTCTGAAAATAACTGATACTGATATAAGACCGAAGATCAGTTT
AAAATTTAATACAAAAG
gtattattttatttttatatgccttctgttgaaaagtatgttaaaatttttgacttctct
gtcaactttcatgccattaacaaccacgtctttactgtgtttgtcattcactgagcttgg
gtttataccagcaagcagcgcttggtgtaggctggaaatcacagacaggaagatcagcac
EXON 14  618 bp
gttttttgacaggcagaaagcagcatgctaattgagcactggctgtggcaaagcactgta
ctatccttcattcttttggaatagtttttatcctacaggagcttaggatacaatgtgaga
gaccaaatagaaaatgagcattaatgtggaatgtcttgacttctcaaaatttattttcag
ATGAAATGCCTATCTTCAAGCTTGATTATAATTATTTCTATCATCTGCTTCATATAATTA
TTATTTCTGGTACTGACATTGTTCGACAAATATTTGATGAGGCTATGCCACCTCCTCTTT
TGAAAAAAGAGCTTCTTATACACAAGAATGTGCTGGAATCCTACTACAACCATCTTTGGA
CCAATCATCCTTTGGGTGGATCATGGCATCTGCTTTATCCTCCTAACAAGGAGTTACCGC
AATCCAAACAGTTTGACTTATGCCTCCTGTTAGCTCTTATAAAACATTTAAATGTGTTCC
CTGCACCCAAAAAAGGATGGAATATGGAACCGCCATCTTCTGACATCTCTAAATCTGCAG
ACATCCTGAGACTGTGCAAATACAGGGATATCCTCCTTAGTGAGATTTTGATGAATGGTC
TCACTGAGTCACAGTTCAATTCAATTTGGAAAAAAGTTTCAGATATTCTTCTGCGCCTTG
GGATGATGCAAGAGGATATTGACAAAGTGAAGGAGAATCCCATTGAGAATATCTCCCTTG
ATTACCATCAGCTATCTGTCTACCTAGGCATACCAGTACCAGAAATCATACAGAGGATGT
TATCCTGCTATCAACAAG
gtactaaatgattatttacttcagccaataaacttccattgattgaatgtctgctctgtg
ccaggcacagtgcaaagggcaagagattcagtgagctcatggttttgggaaaatggactc
atcaggaaggtaatagaaattatagtgctagagatgtttccagaataccatgggaaatcc
EXON 15  33 bp
atgtgataatctaaagattgtgccttgtctaaactggattgatgagcaaagctggttatt
tttccagttacttacagaataaattggtgcaatataaaaatattctgccttaatcctagc
cagacattcatttgttgcgtttgcaattgtacatctaaaatttttctttatgtattatag
GAATTGCTCTACAGTCAATAACAGGCAGTCAGC
gtaagtatatttagaaataaaatgtgtaaatgactttttaacaagggatacctatgaaat
ttttatttgttcagataaactaaatgataaactataattgtgaagaacttgggccaggcg
cagtggctcacgcctataatccctgtactttgggaggctgaggcaggtggatcacaaggt
EXON 16  176 bp
tgtacatattatttggtaactgataaatgaacatcacattttcatcgagtaattgaaaag
agtaagatatattttatttctgttttgtgaatgttgcttttttgggcaaacattataaca
ttgataagaagctgaaattgctttcatctagattttgagaattttgtcttttatgtttag
GTATTGAAATAGAAGAGTTACAGAATGAGGAAGAAGAACTAAGTCCACCTCTCATGGAGT
ACAATATAAATGTGAAATCACACCCTGAGATACAGTTTGCAGAAATTAATAAAGATGGGA
CCTCAATACCCAGTGAATCTTCAACAGAATCTCTTAAAGATCTCCAGGAAGTATAA
gctctcattaatatttgagttagaagaacttattctgggcctttaatttgttgcatgtgc
tgtacttaaagcatcccagataattttagcttatattttcatagtgtttatacagagctt
gaattggaatggtcctttccttccttgcctcagtacttccttccataatctttcctgcca
EXON 17  40 bp
taggattaaaataaaaatgataaaaacaaaaataattgtttccatagaatctagaaagaa
atacctataatattagaaaacaaaagatctcagtggtgagaggaaatatattttgcaaaa
taacccattgggcaatttgaattacatatttaataaataattttttacctactaggttaa
GAGTAAACAAAGGAAAAAGAAGAAGACTAAGAATAAAAAG
gtaagagactataatagcattataatactgattatgaacacttgagttaaatacatgaat
tcattgttagaacttaaattagttcaagtagacatatagcacaaatgattcaatagctta
ctgagtatatgattatagagaagtctacatatgttatatcctgaatgattttgaagtacg
EXON 18  26 bp
atttcagttttatacttaggtataaaagtatatgcataagtgcatatgacatcatgatat
atatttctttagttatgatcaaaaattttttgagaaacactgacctaaatgtaattatat
tactagtatgttgttttgatatagttgatatagattactaattcttatgttatttttcag
AATAAAGACTCAAAAGAAGACCAAGT
gtaagtattagtttatttaatttttaaatttttcttagtatttttaaggcatactttcct
aatatgacacaggcttccttcctttgggaagttttctcactaagagaagaaggatagttc
cttgtcttaataattaacaagttgctgcttttttatagaaagtaacaaaaagttaaatga
EXON 19  166 bp
cattatgaatcttcaaaagaaagactcagtatgagcactatccaaacttcctttgatcat
gaacccttctaatgctgagcatcttatgaaaccagtacaatactaactttggaagcaata
gcttagatgaaaattactatacaattgtaaaagctcacattgattatgtcacgactacag
CCCATATGTGGTAGAAAAGGAAGAGCAGTTGAGGAAAGAACAAGCAAATCCACACTCAGT
CAGTAGACTTATAAAAGATGATGCAAGTGATGTTCAAGAGGATTCTGCAATGGAAGACAA
GTTCTATAGCCTGGATGAATTGCATATTCTGGACATGATAGAGCAG
gtaagcatgattagagagggtgcctgccttctcttattgttatctggtttttcctgtgac
tctttaaacagcatcaccctttgaaaagcccagtggtttatactgtttgtgaggagaaag
agaaaagcataaaaggtaaggagggatatatgaaggaaaatagaataaggaaaaaaaaga
EXON 20  96 bp
caagtaactggtactgtttattaaatgctgtaattgaggggaggtgggtttatctaaatt
gagtgtttgacttgagacaaaaaacgtgaaaggagttagatggcaactttaaatcccttt
caaataactaaaatttttttttgaggaaaataatacatgcatatttcctgtgctcaatag
GGCTCAGCTGGCAAAGTAACTACAGACTATGGAGAAACTGAAAAGGAAAGGCTTGCTCGT
CAAAGGCAGCTTTATAAATTGCACTATCAGTGTGAA
gtaagtatttttgccattagatctgatggaagtgagaagtatttcaaatattaaacttac
tggtgctttctgtttgaaaagaacttagtttgcttttttctttcaatttctggtgacttg
aacataattatctgaaataatattttttattgatcaggatttcaaaagacagttgagaac
EXON 21  128 bp
ataaattgcactatcagtgtgaagtaagtatttttgccattagatctgatggaagtgaga
agtatttcaaatattaaacttactggtgctttctgtttgaaaagaacttagtttgctttt
ttctttcaatttctggtgacttgaacataattatctgaaataatattttttattgatcag
GATTTCAAAAGACAGTTGAGAACAGTGACTTTTCGGTGGCAAGAAAACCAAATGCAGATT
AAAAAGAAAGACAAAATTATCGCATCTCTTAATCAACAAGTTGCTTTTGGAATCAATAAG
GTTTCCAA
gtaagtgtaaatcttttgataaagggaaattctgcgccgtaataaacagtatctttaata
gttaatctctgcataaccactaggtggcactgtgactacacattaggaacctcaaccaca
cgactgcacttgtttaaaaaccaaccatatttttgtcttgccaactggattgagaaataa
EXON 22  69 bp
tcagaaacaagatacatttcaaaaggaccaggtataggagttcagttgtattcaggctca
agatttgtggccccaaatggacatactttatctcctccacagctgtagttagagctcttc
tgactgtgttaatgagaaataatttctaacatcttttgactttcttgcttgtttgcttag
ATTACAGCGTCAAATCCATGCTAAAGATAATGAAATCAAGAACCTTAAAGAGCAACTTTC
TATGAAAAG
gtacaaacttagctttttctttgggtgcactctctctgaaactgtatttcactcaacact
ttctggctggcatattgatgtaatttatcattcaaaccggggtacttttgaggctgatat
tgaacagtactaataatacactgggacaaaaggtgtaaactgggagtatcttaggcaaat
EXON 23  97 bp
gatagtaaaggataacagtagggattgaacaatgtatcttctcttgtttctatgtgctct
atacttttccaagaaataatttcctactgattgtataacttatctttcttcctcctgaat
tagatgaaaaaggctctgcttgatgtaatattgcgagtctttaatgatcatgtatttcag
ATCTCAGTGGGAAATGGAAAAACATAATCTGGAAAGCACAATGAAAACATACGTAAGCAA
ACTGAACGCAGAAACTAGCAGAGCTTTAACAGCCGAG
gtaacaacaaaacggggacaggggtatggggtgaggggaaaagttttacttgtataccat
catactaaagaatttgtaaaagattgttttttgtataaacagaaataagacatcttagga
tcagccaggaaaatacagttgaaagtcttgtgcttttttgactcattggcaaatcatgtg
EXON 24  104 bp
gaattgcagaggtggcattgatttaaaagcttttgtaatgtatcttgaatggtcaaggaa
cctagatgctattggaagaaattgagaaatagctttaaatttacttgagatgattgagaa
gagaatgttcctttacaagcacaccttcaacttctttctctttctctcaaaaacctgtag
GTGTATTTCTTACAGTGTCGTAGGGATTTTGGTTTGCTTCATCTAGAGCAGACTGAAAAG
GAATGTCTCAATCAGCTTGCCAGGGTGACTCACATGGCAGCAAG
gtaacctttccctcttccttaatgcatcttaattttagagatgttagcaagtgtctccac
ggttgaatataatctgtgatgtgttttacatatgtgacatcagagttcttaaagaagctc
ttgtggtttttttgggttttttttcatttttttccccctgaaattccttttaccagaagc
EXON 25  88 bp
ttgttatttttagtaacaaacctgtccatacctctttatgtccatttgaagtaattgttg
gtgatgggggtaattttgttttttgttgacatatatgctagaaagcgtgatagacatgtt
tggaaacctaagtgttataaaaagaaagagttttcttttgtgtctccttttctacaacag
CAACCTAGAATCACTTCAATTAAAGGCTGCGGTAGACAGTTGGAATGCCATTGTGGCAGA
TGTTAGAAACAAGATTGCATTCCTCAGG
gtaagtcctgaagtatatttggagaaaattggcttaatgttataggtggtgtaaagttag
aagacatattagtagaaaaatttaaggaagaacatattttccattttagttataaaagtt
tatgccttcactttgagattacttccatgtggttggttgtagataacatcctagactcac
EXON 26  102 bp
tgtggggatggtctatagaatttttttttttttttggtcagaacctgtttttatattatt
tctgacaggttggcaaccactcttgtatgttgtattattcaaaactacatcagatattcc
catatgctgtctctttaaagttggttgttctctaaagtatttttagtcttcttctaccag
ACACAGTACAATGAACAAATAAACAAAGTCAAGCAAGGATTTGCCTTGAGTACCTTGCCT
CCAGTCCAGCTTCCTCCTCCACCACCCAGTCCTGAGATACTG
gtaagaaatacaacattttgaataattgcccttttcattttgacaaaatggtaagggctg
tgaaacactgaatatgcagtatgtttaacgtgtgttcaaaatggaataggcacatattgt
gagtatcacttgtaattatgaccataccttcgagtcaccagatgatataattagatgggt
EXON 27  126 bp
tttccaatattcatatgtttcattttctgacatacattgtttctaatgtgctttgtatct
tgagttcaaatgagtgttccccccgccatattgctgtatgaatttagatgattgcctaaa
taaatatataaatatgtgggggggggtgttgtttattattgtttatattttctattttag
ATGCAGCAGTTCTTAGGAAGACCTCTTGTGAAAGAATCTTTCTTTAGACCCATACTTACT
GTTCCTCAAATGCCTGCAGTTTGCCCGGGAGTCGTCTCTGCAACTGGCCAACCTAGAGCC
CCCCTG
gtaaaagctttcttggtggaatagatgttaattagtttttttattactctagtgggcttc
ctgaatgagtatcttcattttgttcattcatttgatatgataatgatgggggtggtggtg
ataattgaatgaatacttcctgtgaagcactgtgctcagggtgttacatatattatttaa
EXON 28  140 bp
ttgtcctatttttaaaataagtttaaaatagttacaaacaattagaaatattaagagaaa
aactgtaaaaattgaatgtgtatgccagtacgcttcttcattgtacccattttctgaggt
ataggaatgtcacttcttaataattaaacctgctgggctatagctctctgcctcttacag
ATGACTGGCATAGCCTGGGCTCTGCCAGCGCCTGTGGGAGACGCTGTGCCTCCCAGTGCA
GGTCTGCGGAGTGATCCCTCCATCATGAATTGGGAGAGAATTACAGACAGGCTGAAAACT
GCCTTTCCACAGCAAACCAG
gtaccttagtttttatttattggtgggtacagatcatattctccagttttcatagccata
attgtggcaatgaaacatttcagagaaacataacaaacacaaaaaaagtacagatgtttc
cttaccttgaccttggtaaggaaaaagaaatttaccaagaagagacagtgttcaatggtg
EXON 29  121 bp
tggtttaagataaatgcagatggacctgtgatcacttttttagatcaaagacctaaagag
tcctgtctgtatgctacatatcaatcatgcgataggattttatatctcctttggtgggta
catcctcaaaggtactaaggaaaatcattactgccctttcctttccttgatctcttgcag
AAAGGAACTTACAGATTTCTTACGGAAATTGAAGGATGCTTATGGAAAATCCTTGTCTGA
ACTGACATTTGATGAAATTGTTTGCAAGATTTCCCAGTTTATTGACCCCAAAAAGTCTCA
G
gtaaaatgcaaaaacaaccaaaaaacctgtatctctctgcccttaactctagtagttaac
tgttttaaatatctccataacctgttcagaaaatcagtaacttgtaatcatattaaatca
tctattaacagtaaataacaacttcaacttaacaaatgatatcagaagtctttttgaaat
EXON 30  144 bp
tttttgtttttacctagctctgagtatataagtattgccaccattttgttcaagatttct
cacaaatctgattatttacccttttgctagttcttactataccccgttctgtactaatgt
ttcagctcttactgttttaggataattctgaaaaaataaacattatgttcttattttcag
AGTCAAGGAAAATCAGTGTCAAATGTTAATTGTGTTTCACCTAGTCATTCTCCATCACAG
CCTGATGCTGCCCAGCCCCCAAAACCAGCCTGGAGGCCACTCACTTCACAGGGTCCTGCC
ACATGGGAAGGAGCCAGTAATCCA
gtgagactgaaatttttgattctgaacacatttagatttgggagaaaacaatgagctaaa
tttaacattttctgtattttccctaggatgaggaagaggaagaagaagagccttgtgtga
tctgtcatgagaatctgtctccagaaaatctttcagttttgccttgcgctcacaaattcc
EXON 31  102 bp
tccatcacagcctgatgctgcccagcccccaaaaccagcctggaggccactcacttcaca
gggtcctgccacatgggaaggagccagtaatccagtgagactgaaatttttgattctgaa
cacatttagatttgggagaaaacaatgagctaaatttaacattttctgtattttccctag
GATGAGGAAGAGGAAGAAGAAGAGCCTTGTGTGATCTGTCATGAGAATCTGTCTCCAGAA
AATCTTTCAGTTTTGCCTTGCGCTCACAAATTCCATGCTCAG
gtaacactttaaattttcccattaatcagctaaatgagattcatactgccttacttatta
tcatatacatgtatcattatccattgttgtctcacaagttccactggatataactctgag
cttttgggtaccacacagaaacatttatgcttttcccatacatagccatggattgcattg
EXON 32  601 bp
ttttgtttagcaaaccacagggaaggtgccatggttgcagcaattggtttgacgatccac
agcgtaaggctttaaagatccaccagaagacatgttggttggtaaccctgatgcatagag
tgacaactgcctctgctaggctacatctgagagactgacataaatctttttgctccttag
TGCATTAGACCATGGTTGATGCAACAGGGGACATGTCCAACGTGCAGACTCCACGTTTTG
CTACCAGAAGAATTCCCTGGTCACCCCAGCCGGCAGTTGCCCAAGATCTGATACAAGGTC
GGGGTGTCTATGCAAAGGAAGCTCAGTTTTCTTTTATTATGAGCTGCTTGTTTGAGTGGT
GTAAAACTATGTGCTCTTCAATATAGTGCTAAAGAAGCCAGCTAATTTTATCAAAGCAGC
AGCCAAAGAAGTCAGGACAAATCTTCAGGACTTGTGAAATGAACTGAAAGAGCTTGAAGC
AGATGGAATTTTAATAGTTACACTATATATGCTCTTAGTAGGTTTTTTTCTTGTAGTGGA
AACATAACTGTTAGCATATTTCTTAGGATGTTTTTTCTTGTCTTTTTAAATTCTTATTTC
ACTCATCCTTTACTCTCCCCTCAAGTATTCTACACTTTAATTTCCTGAAATAAATTTAAG
GAAAAGGGAAATAGTAAAGAAGTAGGAATGGGTGCAGCACACCAGCATGGCACATGAATA
CACATGTAACTAACCTGCACATTGTGCACATGTACCCTAAAACTTAAAGTATAATAATAA
T
aaaagaaaaaaaaaagaaagtaaaaaaaaaaaaagaagtggatattcacggagagctatg
aggggataaaagggtatgatctaatggtaagaaactggaagaaacatagcaagtcatttg
ttcagattcttctctgtgtccctgtgtctccagagataaggatgtccttttcctccaggt