Gene DAG1 Variant 1
DNA : 65.45 KbNT_022517
mRNA : 5492 bp NM_004393
CDS : 2688 bp NP_004384
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  276 bp
tgtgtcccgggacggacttccctggccgtgggggcgaggcttccataatggggcgtgact
tttagggcgggggagtggctagccaatgagcagagaggtgctggccggggcggggcttgc
gcgcgggtgcggcgcgctgcggagcggccgacgcaggcagaagccggcggcgcgcggaca
GCCAGTCGGCGCCGCGCGGAGCTGGCCGCTGGATTGGCTGCAACACTCGCGTGTCAGGCG
GTTGCTAGGCTCCGGCCGCGCGCCCCGCCCTTGCGCTCAGCGCCCTCTCACCGCCCGGTA
CGTGCTCGCGCGAAGGCTGCGGCGCGGCGCTCGCGCCTCTTAGGCTTGGCGGTGGCGGCG
GCGGCAGCTTCGCGCCGAATCCCCGGGGAGCGGCGGTGGCGGCGTCCTGGGGCCAGGAGG
AGCGAACACCTGCCGCGGTCCTCCCGCCGGCGCTGG
gtgagtgcaccgcccgccctatccgctgtgcctggctgcttgggcccccatccctgctgc
cggctgagccttccgcggaacacctgctgctgctcgctgttcggcccggggcggggacac
ggccgcggacgtccttgtgggtgaggaggcggtgccgcccgggcggagccgcccctttgc
EXON 2  401 bp
agctacatttccagtgctaaggagttgcacgaaactgttggtttctgtataagagaccat
gggggtaagaggcttgatccaactcggggtagatgtttttgacagtaactcctggaggat
agtatgtgactgaaccactggaattgctcaagtctaaacctgcttttctttttttttcag
GCTCTGTGTGCTCCGGGATGGAGCAGGTGTGCAGAGGGTGAGAACCCAGCTCTGGGACCA
AGTCACTTGCTTCCTTACTTAGCAAGACTATCGACTTGAGCAAACTTGGACCTGGGATGA
GGATGTCTGTGGGCCTCTCGCTGCTGCTGCCCCTCTCGGGGAGGACCTTTCTCCTCCTGC
TCTCTGTGGTTATGGCTCAGTCCCACTGGCCCAGTGAACCCTCAGAGGCTGTCAGGGACT
GGGAAAACCAGCTTGAGGCATCCATGCACTCAGTGCTCTCAGACCTCCACGAGGCTGTTC
CCACAGTGGTTGGCATTCCTGATGGCACGGCTGTCGTCGGGCGCTCATTTCGAGTGACCA
TTCCAACAGATTTGATTGCCTCCAGTGGAGATATCATCAAG
gtgagactggatataaagcataaatgaggaagagttctcattttccattttagttttggt
ggcttttccttttcaagtctaagcttcaccaattctgagctcagttcttccagtaccccc
ttagaagagggacagccactgatgttcataagagaatccctatatactcagaatagcatc
EXON 3  4815 bp
tagtcttgtgacaggtaaataaactcagttgtgtctctctaggggggaggaatcagcttc
cccagcaggcattctgaattataccttaaacctgtcacacaattcaggttaactgttgtg
atcatattcaggttatgcagtgacaatagtatttttaatttatgcttgtgtctcttctag
GTATCAGCGGCAGGGAAGGAGGCTTTGCCATCTTGGCTGCACTGGGACTCACAGAGCCAC
ACCCTGGAGGGCCTCCCCCTTGACACTGATAAGGGTGTGCATTACATTTCAGTGAGCGCT
ACACGGCTGGGGGCCAACGGGAGCCACATCCCCCAGACCTCCAGTGTGTTCTCCATCGAG
GTCTACCCTGAAGACCACAGTGAGCTGCAGTCGGTGAGGACAGCCTCCCCAGACCCTGGT
GAGGTGGTATCATCTGCCTGTGCTGCGGATGAACCTGTGACTGTTTTGACGGTGATTTTG
GATGCCGACCTCACCAAGATGACCCCAAAGCAAAGGATTGACCTCCTGCACAGGATGCGG
AGCTTCTCAGAAGTAGAGCTTCACAACATGAAATTAGTGCCGGTGGTGAATAACAGACTA
TTTGACATGTCGGCCTTCATGGCTGGCCCGGGAAATGCAAAAAAGGTGGTGGAGAATGGG
GCCCTTCTCTCCTGGAAGCTGGGCTGCTCCCTGAACCAGAACAGTGTGCCTGACATTCAT
GGTGTAGAGGCCCCTGCCAGGGAGGGCGCAATGTCTGCTCAGCTTGGCTACCCTGTGGTG
GGTTGGCACATCGCCAATAAGAAGCCCCCTCTTCCCAAACGCGTCCGGAGGCAGATCCAT
GCTACACCCACACCTGTCACTGCCATTGGGCCCCCAACCACGGCTATCCAGGAGCCCCCA
TCCAGGATCGTGCCAACCCCCACATCTCCAGCCATTGCTCCTCCAACAGAGACCATGGCT
CCTCCAGTCAGGGATCCTGTTCCTGGGAAACCCACGGTCACCATCCGGACTCGAGGCGCC
ATTATTCAAACCCCAACCCTAGGCCCCATCCAGCCTACTCGGGTGTCAGAAGCTGGCACC
ACAGTTCCTGGCCAGATTCGCCCAACGATGACCATTCCTGGCTATGTGGAGCCTACTGCA
GTTGCTACCCCTCCCACAACCACCACCAAGAAGCCACGAGTATCCACACCAAAACCAGCA
ACGCCTTCAACTGACTCCACCACCACCACGACTCGCAGGCCAACCAAGAAACCACGGACA
CCCCGGCCAGTGCCCCGGGTCACCACCAAAGTTTCCATCACCAGATTGGAAACTGCCTCA
CCGCCTACTCGTATTCGCACCACCACCAGTGGAGTGCCCCGTGGCGGAGAACCCAACCAG
CGCCCAGAGCTCAAGAACCATATTGACAGGGTAGATGCCTGGGTTGGCACCTACTTTGAG
GTGAAGATCCCGTCAGACACTTTCTATGACCATGAGGACACCACCACTGACAAGCTGAAG
CTGACCCTGAAACTGCGGGAGCAGCAGCTGGTGGGCGAGAAGTCCTGGGTACAGTTCAAC
AGCAACAGCCAGCTCATGTATGGCCTTCCCGACAGCAGCCACGTGGGCAAACACGAGTAT
TTCATGCATGCCACAGACAAGGGGGGCCTGTCGGCTGTGGATGCCTTCGAGATCCACGTC
CACAGGCGCCCCCAAGGGGATAGGGCTCCTGCAAGGTTCAAGGCCAAGTTTGTGGGTGAC
CCGGCACTGGTGTTGAATGACATCCACAAGAAGATTGCCTTGGTAAAGAAACTGGCCTTC
GCCTTTGGAGACCGAAACTGTAGCACCATCACCCTGCAGAATATCACCCGGGGCTCCATC
GTGGTGGAATGGACCAACAACACACTGCCCTTGGAGCCCTGCCCCAAGGAGCAGATCGCT
GGGCTGAGCCGCCGGATCGCTGAGGATGATGGAAAACCTCGGCCTGCCTTCTCCAACGCC
CTAGAGCCTGACTTTAAGGCCACAAGCATCACTGTGACGGGCTCTGGCAGTTGTCGGCAC
CTACAGTTTATCCCTGTGGTACCACCCAGGAGAGTGCCCTCAGAGGCGCCGCCCACAGAA
GTGCCTGACAGGGACCCTGAGAAGAGCAGTGAGGATGATGTCTACCTGCACACAGTCATT
CCGGCCGTGGTGGTCGCAGCCATCCTGCTCATTGCTGGCATCATTGCCATGATCTGCTAC
CGCAAGAAGCGGAAGGGCAAGCTTACCCTTGAGGACCAGGCCACCTTCATCAAGAAGGGG
GTGCCTATCATCTTTGCAGACGAACTGGACGACTCCAAGCCCCCACCCTCCTCCAGCATG
CCACTCATTCTGCAGGAGGAGAAGGCTCCCCTACCCCCTCCTGAGTACCCCAACCAGAGT
GTGCCCGAGACCACTCCTCTGAACCAGGACACCATGGGAGAGTACACGCCCCTGCGGGAT
GAGGATCCCAATGCGCCTCCCTACCAGCCCCCACCGCCCTTCACAGCACCCATGGAGGGC
AAGGGCTCCCGTCCCAAGAACATGACCCCATACCGGTCACCTCCTCCCTATGTCCCACCT
TAACCCGCAAGCGCCTGGGTGGAGGCAGGGTAGGGCAGGGGCCTGGAGACGACATGGTGT
TGTCTGTGGAGACCGGTGGCCTGCAGACCATTGCCCACCGGGAGCCGACACCTGACCTAG
CACACACTGACACAGGGGCCTGGACAAGCCCGCCCTCTCTGGTCCTCCCAAACCCCAAAG
CAGCTGGAGAGACTTTGGGGACTTTTTTATTTTTATTTTTTGCCTAACAGCTTTTGGTTT
GTTCATAGAGAATTCTTCGCTTCATTTTTGATGGCTGGCTCTGAAAGCACCATGTGGAGT
GGAGGTGGAGGGAGCGAGGAACCATGAATGAACTCGCAGGCAGTGCCGGGCGGCCCCCTG
GCTCTCTGCGTTTTGCCTTTAACACTAACTGTACTGTTTTTTCTATTCACGTGTGTCTAG
CTGCAGGATGTAACATGGAAAACAGTAACTAAAGATTAAATTCAAAGGACTTTCAGAAGT
TAAGGTTAAGTTTTTACGTTTAATCTGCTGTTTACCTAAACTTGTATGTATAATTTTTGG
GTGGGTATGGGGAATTGCTTTGCTAAAAATAAGCTCCCAGGGTGTTTCAAACTTAGAGAA
GACCAAGGGACAGTATTTTTTATCAAAGGAATACTATTTTTTCACACTACGTCAACTTGG
TTGCTCTGATACCCCAGAGCCTGATTGGGGGCCTCCCGGCCCTGGCTCACGCCAAGTCCC
TGGTGCTGGGTTTGCTCTCCCGCTGTTGCCAGGGGCTGGAAGCTGGAGGGGTCTCTTGGG
CCATGGACATCCCCACTTCCAGCCCATGTACACTAGTGGCCCACGACCAAGGGGTCTTCA
TTTCCATGAAAAAGGGACTCCAAGAGGCAGTGGTGGCTGTGGCCCCCAACTTTGGTGCTC
CAGGGTGGGCCAGCTGCTTGTGGGGGCACCTGGGAGGTCAAAGGTCTCCACCACATCAAC
CTATTTTGTTTTACCCTTTTTCTGTGCATTGTTTTTTTTTTTCCTCCTAAAAGGAATATC
ACGGTTTTTTGAAACACTCAGTGGGGGACATTTTGGTGAAGATGCAATATTTTTATGTCA
TGTGATGCTCTTTCCTCACTTGACCTTGGCCGCTTTGTCCTAACAGTCCACAGTCCTGCC
CCGACCCACCCCATCCCTTTTCTCTGGCACTCCAGTCCCAGGCCTTGGGCCTGAACTACT
GGAAAAGGTCTGGCGGCTGGGGAGGAGTGCCAGCAATAGTTCATAATAAAAATCTGTTAG
CTCTCAAAGCTAATTTTTTACTAAAGTTTTTATACAGCCTCAAATTGTTTTATTAAAAAA
AAGATTTAAAATGGTGATGCTTACAGCAGTTTGTACGAGCTCTTAAGTGTTGATTCCATG
GAACTGACGGCTTTGCTTGTTTTGATTCTTTTCCCCCTACTTTTCCTAATGGTTTAAATT
CTGGAATTACACTGGGGTTCTTTTGCCTTTTTTAGCAGAACATCCGTCCGTCCATCTGCA
TCTCTGTCCCATGACTCAGGGGCGCCCACTCTGCTTCGATTCTCCTCCTGTGGAAGAAAC
CATTTTGAGCATGACTTTTCTTGATGTCTGAAGCGTTATTTTGGGTACTTTTTAGGGAGG
AATGCCTTTCGCAATAATGTATCCATTCCCTGATTGAGGGTGGGTGGGTGGACCCAGGCT
CCCTTTGCACACAGAGCAGCTACTTCTAAGCCATATCGACTGTTTTGCAGAGGATTTGTG
TGTGCTGCCTCAGGAGGGGAGGGCTGGTAGGAGGGGGGGAGAGGTCTCTGTCCTACTGCT
CTCCAGAGGGCATTTCCCCTTGCGCCTTCTCCCACAGGGCCCAGCCCCTCTCCCCTGCCC
CAGTCCCCAGGGGGTACTCTGGAGTGAGCAGTGCCCCTGTGGGGGAGCCTGTAAATGCGG
GCTCAGTGGACCACTGGTGACTGGGCTCATGCCTCCAAGTCAGAGTTTCCCTGGTGCCCC
AGAGACAGGAGCACAAGTGGGATCTGACCTGGTGAGATTATTTCTGATGACCTCATCAAA
AAATAAACAATTCCCAATGTTCCAGGTGAGGGCTTTGAAAGGCCTTCCAAACAGCTCCGT
CGCCCCTAGCAACTCCACCATTGGGCACTGCCATGCAGAGACGTGGCTGGCCCAGAATGG
CCTGTTGCCATAGCAACTGGAGGCGATGGGGCAGTGAACAGAATAACAACAGCAACAATG
CCTTTGCAGGCAGCCTGCTCCCCTGAGCGCTGGGCTGGTGATGGTCGTTGGACTCTGTGA
GATGGAGAGCCAATCTCACATTCAAGTGTTCACCAACCACTGATGTGTTTTTATTTCCTT
CTATATGATTTTAAGATGTGTTTTCTGCATTCTGTAAAGAAACATATCAAACTAAATAAA
AGCAGTGTCTTTATT
acaacgccgttgcatctgggcatctgtttccctggcatctggagaggttcctggacatga
ggggttgggggctcatgtgacggggaagaggagactcagccaggtccacttggggttggc
ccagtggcctccatgtaagccttaccatttctgtgctgggagggctgggtgtgcactcca