Gene COLQ Variant 8
DNA : 48.46 KbNT_022517
mRNA : 2856 bp NM_080538
CDS : 1338 bp NP_536799
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  84 bp
cccaggagctcaggactggctccagacccctggcatctggagcagaagcaacatcaaagc
agggattggccaactcccacccctaatgccaaacaggccaggcactgggagcactcagag
gcgtgacgaatctcagcctgtctccggctagtgttccctggccagtccgctttgggccct
GCCTCACAATGACGGGCTCATCATTCAGCCTCGCTCATCTGCTCATCATTTCAGGACTGC
TCTGTTACTCGGCAGGCTGCTTGG
gtgagttgtgtgtgcgtgtgtgcacgtgtgtgtgtgtgtgtggatgcacatgcattgttt
tggaaaaaagactcttggaaagcagactgtactaggaggttttagcagcctttaaatttt
ttttctttttaagtttttctttcacagggctgtttctcattgtgaaagcctttaaatttt
EXON 2  113 bp
gcaagggcaagggaataattgctatgtcaagtagccaacaggaggcctatccacatctaa
caggctagaaattagatgtggaagtctggggtggcaggatgggtcttccctgggcacggt
gggtgtgacagaggcccagcactgaccacatgctaacgagcggcagttttctctgaacag
CCCTTCCCAGCCTGGATCAGAAGAAGCGTGGTGGCCACAAAGCATGCTGCCTGCTGACGC
CTCCTCCACCACCACTGTTCCCACCACCATTCTTCAGAGGTGGCCGAAGTCCG
gtgagtactttgggatttatgagaggaaaaaaagtgcaggctactcagtgcacaccacgc
agccccacctgcctgccccactccacctgagctgcctccggaatcttttctgagagcctc
aaccctccactgtcacccagaagttgagccccggaatggacattttgcagttcctggggt
EXON 3  102 bp
gagcagatgagagaacagaaactggtagcccaaggtgtcatcttcttggggcagtcattg
gggtgtcagggaactgccaggcttagagacctgatcccggagcaggtctgtgtccaggat
ggtgacccttcctctgtcccctacgcctgacctctaactctgtgttgctttgtactgaag
CTTCTCTCCCCAGACATGAAGAATCTCATGCTGGAACTGGAGACCTCGCAGTCCCCGTGC
ATGCAAGGCTCGCTAGGCTCCCCTGGGCCTCCCGGCCCCCAG
gttggtgcactctaccggacccctctcgctgtcttctgtttagagcaggaaagcccactg
cacagagcctcttagtgtctgctctttctcatgtgatacaaagctgtttttccttctctc
gcttacttcctgctccaaagccacttggatagaacactgactctttgctaggtaaattct
EXON 4  45 bp
gaggaacagaggaggggactgggctggagggcaaaggaaaagcctccatgggtccctgga
gccctacatctgcccagagaatgatgttgctgctgtaggagcccagtgcaccaagagcct
cacacccatccagcttcagactgatatatactttcttcactttttatcttgattgattag
GGTCCACCGGGGCTTCCTGGCAAGACAGGACCAAAGGGAGAAAAG
gtatggaccactactttcttcaacccttctttccttggcaattccagcctgttttctggg
catcccactgagaatttcctagttgagatttccaaacatgtgctaactctgccttggtga
gaggctgggttccatgatggctgggctgctgcagcacatatgggataccactggtgtatt
EXON 5  27 bp
cacatatgggataccactggtgtattttgacgtggcctatcgacatggcagaggggccgt
gagcagcagccaagcaactgagccacatggccatgcccagtcatcagctctactaaggct
tctgcttccagaacatctcttccaaagcagcctctccttacctgtcttctccatccatag
GGGGAGCTTGGCCGACCAGGAAGGAAG
gtatggtctgcgctgttctgtgagtgtcacatgagcgtctgtgcttcatgtgtgtgcatg
cactcctagggaggggggaacagcaatgcacttcagtggtcactgatacccaggtggaca
gtgatggtgctgctgtctcgatggtgacagtagtaaccttgccctttctgtcaacttctt
EXON 6  72 bp
atgatacagtgtgacaccaagggcttgtcaggccatcagtcttcggagagtggggatgag
ggtcatagtagccatgcctagagaacccactgtctcctctgggccccagagacaaaacat
atttattagaagtaaagaaacaaacccagttgccctgacttttgttcttggtctttgaag
GGTAGACCTGGCCCCCCAGGTGTTCCTGGCATGCCTGGGCCCATCGGTTGGCCAGGCCCT
GAAGGACCCAGG
gtaagtgtggcatgctctcagggctcatgcggtgtcaaaacaagaggggggaagatggca
gctttcctggctcctggcacatagtcagggaatcccttcttcaagagggggaagaagaag
agagcttaaggactggccacagggccccagatacttcctccttcacttggcctgcaagac
EXON 7  63 bp
tgaaatgtggagtacggagttttgggacctcaggagggagaaagtgggtgcatctggggt
cctcagatttacaagccagccctgatatccccagttccttcccaatcttgcctgtgactt
cctggttcagtttctctaaaaaatatcaccgtgggtcttttcttcttctaattcccacag
GGTGAAAAAGGTGACCTGGGTATGATGGGCTTGCCAGGGTCAAGAGGACCAATGGGCTCC
AAG
gtcagtgtggggtccaaatggacgttcccagatctctgtcaggctctggagcagctgctg
tctacaaacatagggactgggtggggctgcagtcccggactagggaatgtcgcggatatt
ggagagcctgcctttaccagccctttggagaacatcatgccctgggatgcaggggcatag
EXON 8  27 bp
ggcctggtataaccacaaccctctgggacatctttgtgtttggtgctgcaaccccactaa
aactcacagtgcaatgtggagacataccttaccaccacattcagggattccttctattct
tccaccaaactcagaagtcctacagggctgattgtaaatgtaccttctgctttcttttag
GGCTACCCTGGATCCAGAGGGGAAAAG
gttagtgcttttcttggatggtgtcctagagcctggtctgggctactggctctggaatca
gagacatgcagagaatgggtccaggtctctctttagtctgcaactgaagccaccatccct
agctattccccaccctttgtcagtggactgagagagaagtgagggacctcctgaagcagg
EXON 9  45 bp
ggttcaacaagaagtagatcacaaagcattccttccctggagaagtcacctgacatatct
gagcctatttcttcacttgtaaaatgagggttttggtttagggagcttttcagtttgaaa
tgcttgaatttccctcccaggatattaactcattgactttctcctatggtttcttcctag
GGATCCAGAGGTGAAAAGGGTGACCTGGGTCCCAAAGGAGAAAAG
gtaatggagaaaacctttccatagaaatgataaatgtcagtgcaagtagcagcccccacc
cacccccatccgtggactgatgatggactgatggacaggcctccatcttgaaaatgacca
acaaagcctgtccacagccatttcaggtgttatttcagaggtgatcacaattatttgttg
EXON 10  36 bp
acctttccatagaaatgataaatgtcagtgcaagtagcagcccccacccacccccatccg
tggactgatgatggactgatggacaggcctccatcttgaaaatgaccaacaaagcctgtc
cacagccatttcaggtgttatttcagaggtgatcacaattatttgttgctcttttcacag
GGTTTCCCAGGATTTCCTGGAATGTTGGGGCAGAAA
gtaagtaaccttgaggtagtgaaaataggcctcaataaaaatatcaggtcctccaagcac
aacaaaaagaactctgcctccttgtctatcaggcagggatggtgggtttaaccatggaaa
cttctattttgggacgggaagcaagttgcttttcaccctggggagagggtggcaggatgg
EXON 11  81 bp
agacatgtctgcctttctcatgacttcctcactctgctaaccttgcagggcagcccagtt
ggcatagattcggaatgatcaagtagactgccctcgtagccaatgactggctagacctgt
gtagatgtgcccactccacatgccctaagtcctctcttgcttctctttccttctttccag
GGTGAAATGGGTCCAAAAGGTGAACCTGGGATAGCAGGACACCGAGGACCCACAGGAAGA
CCAGGAAAACGAGGCAAGCAG
gtaaggatcccagggcttaccacccgcctgaggtcagaacttcctgacctggcagtgtgt
ggagtggcaggcaggtggcgttaatcagagatattctgtagaccttgactccagcatcct
ctgggctagcagacgggagcagcaccacttccagaagctgctggcatctctaggctagcc
EXON 12  97 bp
tatctcaaatgtcacttgccctaagcttattaagagctcgatggtcaagacctctggagc
tgcatcccccactgggctcttgctccttaagtgcaaggtgatctctgatttggtgataaa
tggggcgggaagcttgctatgtcatgctttcataacaggctctgcctttctctctgtcag
GGACAGAAAGGGGATAGTGGAGTTATGGGCCCACCAGGCAAGCCTGGGCCTTCTGGTCAA
CCTGGCCGTCCGGGGCCCCCAGGCCCCCCACCTGCAG
gtaagagctacactgcttcacttgatccactgttggagtactggccagcctcccagagag
ggcacaaggagatgccagcagagatgccttgtgtttcaagttagaaactaccagagacac
tccaatatctttgtaatttctccacgatttagctcattcaacttttatgcaagagagata
EXON 13  140 bp
tcttaccttagctcctccatgtcttggatcaaaagcatctctttgaacctctccctcagg
cataccctgaaatgctgtggactttaaccttttttctgttgcaaaggtcgctcacatctc
cctggttgtttggtcttctcttccttggctctagtaacacagcagtctgttgcttcctag
GACAACTTATAATGGGACCCAAAGGGGAAAGAGGATTTCCCGGGCCTCCAGGAAGATGTC
TTTGTGGACCCACTATGAATGTGAATAACCCTTCCTACGGGGAATCTGTGTATGGGCCCA
GTTCCCCGCGAGTTCCTGTG
gtaaggctttctgggagaagtctggggtggttatccgtgaggacctctcacctgatcctt
atggggctttgtaaaatcctttcagtaaaactaactttttttcacgactctgagtacacc
ctcattataggaaattggaaaatatgagaaaatcaagaggaaaaccaaattgtccatttg
EXON 14  120 bp
agaagatgagggaatcaagacactcctctcacttcagaaggaatgctagagtgtagtgtg
caaacccctcttcccactgttgagcagcccaaggatagagattctgtttcctcctccagc
ttttttcctgccccctgcagaagtgttttctggaatcctcaccagtgtgttctctggcag
ATTTTTGTGGTCAACAACCAGGAGGAGCTTGAGAGGCTGAACACCCAAAACGCCATTGCC
TTCCGCAGAGACCAGAGATCTCTGTACTTCAAGGACAGCCTTGGCTGGCTCCCCATCCAG

gtacccccaggccattacctcaggacatactccctgcccaggagagagatgcatccatta
aaggaagggaaggccaccccactgggcctggggagggctttctacagtctgtctgcatgg
gagggctgagcatcctccctcaaactctctctgagcagccctccattcccccaccctgac
EXON 15  121 bp
acccaacatttaaccagctacagagctctgggcaacaggaaaggagtacctttcccaccc
ctgggaggaagtcaaggcatgccccccagcagtgcctttggaccaaaaccaatgacctcc
ctgcctgcggctgcctgggtatgccatgctccagttaatgctgtgtgcttctttggccag
CTGACCCCTTTCTACCCTGTGGATTACACTGCAGACCAGCACGGCACCTGTGGGGATGGG
CTCCTGCAGCCTGGGGAGGAGTGTGACGACGGTAACAGCGATGTGGGTGACGACTGCATC
C
gtgagtgaggcccagaccaggaggacctgaggcctgaacagcaggggggtgggactcagg
gccagccctggacaccagctgtggtgctttgggacctttctagagccagagaagggtata
cccaggccaccttgtgccacccaccccagtccctgctgccccagtttcagcccaaatatt
EXON 16  103 bp
atcgctgtgggaccagagcctgtgggcagtccctggaggagtgtgaagcttaatggaggt
cagttctttaaggggtgcagcacttaggttggatcccttgggccgcatggtccttacaag
ctgaggcaagcctatcgcctctgctccttctcaagactgcacctccttatgtcccctcag
GCTGTCACCGTGCCTACTGTGGAGATGGTCACCGGCATGAGGGTGTGGAGGACTGTGACG
GCTCTGACTTTGGCTACCTGACATGCGAGACCTATCTCCCTGG
gtagggatgactcccctccctccctctcccccttctttctccctccctcctctttgcttt
ccttctttccttcacaaatattttgagtgcctctccactttgtggtgccttctagacact
gaggtatggtgatgaatgacacaacacgtgctccctgcctaccacgtgccctcttggtca
EXON 17  1580 bp
agacctcaaggcaaaaatcccagagacatgattcaactcccccaggcctctcactccaaa
tgagaatgggaaaaagttcttgtagagccattggcccttggccgctgtttgataaggttt
gaccggaagtcaccagcatataagaggtggccttttagaacgtgtctttgcctccctcag
GTCATATGGAGACCTGCAATGCACCCAGTACTGCTACATCGACTCCACGCCCTGCCGCTA
CTTCACCTGAGGGCCGTGAGGAGAAGGTGGGCTGCGCCCCACAGAACTGGCAGCAGCTTC
TCCACTGTCATCAAACTGGCCATGTCCTGGCCCCGTCTCCACCAACCTTTGTGTGACAAA
AACAAGGACAAATTCCTGCTACTAAGACATGCTGTTAACTCAGTCTGACTGGAAGAATTT
AGGACCACTGCATCCTGTCTTAATCCAAGGTACTGGAAAACCTTCCACATGCCCAACCTG
AGACCTGTTCCCCATCGCTACCATTTGGCCAAACAACCGGCTACAATGCTCTTCCTCTTC
TGGAATGTTGCTGACCCAGGCCGTGGACTTGGCTGAGCACTGTTAGACACACACAGACCT
GCAGGCTGTTTTAGAATGTTTTGATCTCTTTGGGGAATCTGGAGTACAGGCCTCTCCGCC
CCTGACCACCGAAACGTGCAGGCATTCTCACTCACACTGGGCAGCCCGCTGTCGGGTCTC
TCTAGGCCTATGAACCACAAAGCAGGGAAGTGGGCACGTTCTCTCGGGGTGGCTCACAGC
TTTGAACCTGCCAAAGGACCCCTCGACTGGCCACAGCCCAGCCCAGCCTGACGTGGATGT
GGCTGCCCAGGAAAAGACTTAACTGTGAAAAAGTACTGAGAACCCACCTGACCCAGGCTT
GCCCCAAGCAGAGGCTAGAGAAGAGGCTCCTCTTCTCAGTGTTTCCCAAAGGGGCGGCTC
TTGTGGTTTCAAAATCTCTGGCACCATCTTGACCTCTTGGCTCTCTCTGCACTTTGCCCC
CTGTCTCAAAAATGTCCCTCATGTCCATTTCCTGTCCAGGAGACTCATGAGGACTGTGTG
ACCTGCACAAGCCCACACCTGGGCAGGCTGTTGGTGTCTCCTTGGTCCTTAGGCAGATAC
TCCCCTGAGTCCCCGATCTAGGGCCAGCTGCAGAGGGCTCTCTCTAGGCAGAGCGTTCCT
GGCCAGAGCTCTACCTCTTTGCCTCCTGCTGACCCCTGACAGCGTCCCGTGGCATTTCTT
TCATGTCTGCATATTGCATAGCCTTGTCCTCCTGTGTGCCTGAGCTCCTCCCTTTTCAAT
AAGATTATTAGTCGTGCATGTCTGTGAGCTGCCTTTCATCACCATTTTTCCTGAGTAGGG
CTTAGTTTTATTCTGGAAAGACATCTCCAAGGTGAGGTCCACCCCCACAGCAGACCTCAA
GTAGAAATTGCCCAATTTTTACCAGCTGGAGGGACACCCTTGGGTTTTTGTACGAAGCTA
TTTAATGAGCCTGTGTCTTGGGGACTCAGCAGGCTGGAGCTTGGGGCCTGGTGGACCATC
ACCTGGTGTCTGTAGGTGGACCCGGTCTCCCACAGGTGACATCAACCTGAGGGTGGCGTC
TTTAGAGACAGGCACATGGGCAGCCCTGTTCCCTTCGCCTCTACTGCGAGGCCTGGGGAG
ATGTTGTTTTCATGCTGCTTCCACCATCACACTGGGGTTTCTGGATGGGAAATAAAAAAA
TAAAGGCAGTTCATTTCCCC
actgtggctctctcttccgttggtggtgggggtggggccggtgtctcagcattgccagat
ggagggaggagtctaaattcaaatctgcttcccaaactctgtggagggttctacaatgtg
gaagcattccagttccctcaggcacaagggaggaaacagatccagagatgtcatggactt