Gene CLDN1 Variant 1
DNA : 16.72 KbNT_005612
mRNA : 3429 bp NM_021101
CDS : 636 bp NP_066924
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  443 bp
tcctgccgggtggtccccacgccgccagccgcgcgttccccaaccgggcgctcccggcgc
cctctcggtgagccgccctgaaaccgccagggggcgctccccggctgccggggctgaggc
gggcggagctgctttaaatcgcggcgcccagcggttctgcgtctcagttcccgagcctgg
GAGCAACCGCAGCTTCTAGTATCCAGACTCCAGCGCCGCCCCGGGCGCGGACCCCAACCC
CGACCCAGAGCTTCTCCAGCGGCGGCGCAGCGAGCAGGGCTCCCCGCCTTAACTTCCTCC
GCGGGGCCCAGCCACCTTCGGGAGTCCGGGTTGCCCACCTGCAAACTCTCCGCCTTCTGC
ACCTGCCACCCCTGAGCCAGCGCGGGCGCCCGAGCGAGTCATGGCCAACGCGGGGCTGCA
GCTGTTGGGCTTCATTCTCGCCTTCCTGGGATGGATCGGCGCCATCGTCAGCACTGCCCT
GCCCCAGTGGAGGATTTACTCCTATGCCGGCGACAACATCGTGACCGCCCAGGCCATGTA
CGAGGGGCTGTGGATGTCCTGCGTGTCGCAGAGCACCGGGCAGATCCAGTGCAAAGTCTT
TGACTCCTTGCTGAATCTGAGCA
gtgagtgcacccccacctcacagcggccgtccagaggccccagtccccctgcagctccct
tatgggctcattctgttgtgtgattccatggttatcagtcttcagttgatcaagtcttct
gatcatgtgctctgtcataaggaaatgaagagaatcctggtttgaggaaagcgacgccca
EXON 2  165 bp
ttttctggagaagatactgtatattgggttaccagcggaaacatcagtatgactggggtc
tctagattcctagtccagttttctctcttccatacaacagtgacatatacttggtcttct
tccatttttctcttgttggtccaagcatatttttacatgttttaaaatgttttctgccag
GCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAA
TCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGA
AGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAG
gtaatagaggctgtgcccccctttcaccttactaacctgttcctggtatgatttgaaatc
tattacgttggattcattatacttgatttcagtctctaaggcaaactgcaaacatagacc
tgaagtccagttgactttcatgttctcaaacacaaactaaatgaaaatgtgagagctctg
EXON 3  85 bp
ttttaatagatacttggaataaatcatatctggacttctaatctccctaataccaaaata
aaaatgtcaacactattgatgagatttaattcttgcaaaatatgttttggtttaacaggt
tgtgtatttaggctcagtgttccatggtgattaacagtcttttgttttgaatttctatag
GTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATG
ACCCTATGACCCCAGTCAATGCCAG
gtaacgctattcaggcgtaaaatagtttgttttctgagaaaatgccctttttatattcta
caaagtcctgctagtgccatcatttcccagatttgctttcaagaattttatgtcaaacct
acaaacaatttaaatgatctctgacttatgtcaaaatgagtttgataattgctttaacac
EXON 4  2736 bp
ttgcaatataaacattctttggcgtgtatgttcagaaatcttaaagtacttcccaaggga
tattcaggggttattttcaatgaaaaaaatacaatgagtattgattttttttccttttat
tatattagaaaagttgccaataattcactgattaacaagcacatgggtttttccttttag
GTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGG
AGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCC
CTATCCAAAACCTGCACCTTCCAGCGGGAAAGACTACGTGTGACACAGAGGCAAAAGGAG
AAAATCATGTTGAAACAAACCGAAAATGGACATTGAGATACTATCATTAACATTAGGACC
TTAGAATTTTGGGTATTGTAATCTGAAGTATGGTATTACAAAACAAACAAACAAACAAAA
AACCCATGTGTTAAAATACTCAGTGCTAAACATGGCTTAATCTTATTTTATCTTCTTTCC
TCAATATAGGAGGGAAGATTTTTCCATTTGTATTACTGCTTCCCATTGAGTAATCATACT
CAACTGGGGGAAGGGGTGCTCCTTAAATATATATAGATATGTATATATACATGTTTTTCT
ATTAAAAATAGACAGTAAAATACTATTCTCATTATGTTGATACTAGCATACTTAAAATAT
CTCTAAAATAGGTAAATGTATTTAATTCCATATTGATGAAGATGTTTATTGGTATATTTT
CTTTTTCGTCTATATATACATATGTAACAGTCAAATATCATTTACTCTTCTTCATTAGCT
TTGGGTGCCTTTGCCACAAGACCTAGCCTAATTTACCAAGGATGAATTCTTTCAATTCTT
CATGCGTGCCCTTTTCATATACTTATTTTATTTTTTACCATAATCTTATAGCACTTGCAT
CGTTATTAAGCCCTTATTTGTTTTGTGTTTCATTGGTCTCTATCTCCTGAATCTAACACA
TTTCATAGCCTACATTTTAGTTTCTAAAGCCAAGAAGAATTTATTACAAATCAGAACTTT
GGAGGCAAATCTTTCTGCATGACCAAAGTGATAAATTCCTGTTGACCTTCCCACACAATC
CCTGTACTCTGACCCATAGCACTCTTGTTTGCTTTGAAAATATTTGTCCAATTGAGTAGC
TGCATGCTGTTCCCCCAGGTGTTGTAACACAACTTTATTGATTGAATTTTTAAGCTACTT
ATTCATAGTTTTATATCCCCCTAAACTACCTTTTTGTTCCCCATTCCTTAATTGTATTGT
TTTCCCAAGTGTAATTATCATGCGTTTTATATCTTCCTAATAAGGTGTGGTCTGTTTGTC
TGAACAAAGTGCTAGACTTTCTGGAGTGATAATCTGGTGACAAATATTCTCTCTGTAGCT
GTAAGCAAGTCACTTAATCTTTCTACCTCTTTTTTCTATCTGCCAAATTGAGATAATGAT
ACTTAACCAGTTAGAAGAGGTAGTGTGAATATTAATTAGTTTATATTACTCTCATTCTTT
GAACATGAACTATGCCTATGTAGTGTCTTTATTTGCTCAGCTGGCTGAGACACTGAAGAA
GTCACTGAACAAAACCTACACACGTACCTTCATGTGATTCACTGCCTTCCTCTCTCTACC
AGTCTATTTCCACTGAACAAAACCTACACACATACCTTCATGTGGTTCAGTGCCTTCCTC
TCTCTACCAGTCTATTTCCACTGAACAAAACCTACGCACATACCTTCATGTGGCTCAGTG
CCTTCCTCTCTCTACCAGTCTATTTCCATTCTTTCAGCTGTGTCTGACATGTTTGTGCTC
TGTTCCATTTTAACAACTGCTCTTACTTTTCCAGTCTGTACAGAATGCTATTTCACTTGA
GCAAGATGATGTAATGGAAAGGGTGTTGGCATTGGTGTCTGGAGACCTGGATTTGAGTCT
TGGTGCTATCAATCACCGTCTGTGTTTGAGCAAGGCATTTGGCTGCTGTAAGCTTATTGC
TTCATCTGTAAGCGGTGGTTTGTAATTCCTGATCTTCCCACCTCACAGTGATGTTGTGGG
GATCCAGTGAGATAGAATACATGTAAGTGTGGTTTTGTAATTTAAAAAGTGCTATACTAA
GGGAAAGAATTGAGGAATTAACTGCATACGTTTTGGTGTTGCTTTTCAAATGTTTGAAAA
CAAAAAAAATGTTAAGAAATGGGTTTCTTGCCTTAACCAGTCTCTCAAGTGATGAGACAG
TGAAGTAAAATTGAGTGCACTAAACAAATAAGATTCTGAGGAAGTCTTATCTTCTGCAGT
GAGTATGGCCCGATGCTTTCTGTGGCTAAACAGATGTAATGGGAAGAAATAAAAGCCTAC
GTGTTGGTAAATCCAACAGCAAGGGAGATTTTTGAATCATAATAACTCATAAGGTGCTAT
CTGTTCAGTGATGCCCTCAGAGCTCTTGCTGTTAGCTGGCAGCTGACGCTGCTAGGATAG
TTAGTTTGGAAATGGTACTTCATAATAAACTACACAAGGAAAGTCAGCCACTGTGTCTTA
TGAGGAATTGGACCTAATAAATTTTAGTGTGCCTTCCAAACCTGAGAATATATGCTTTTG
GAAGTTAAAATTTAAATGGCTTTTGCCACATACATAGATCTTCATGATGTGTGAGTGTAA
TTCCATGTGGATATCAGTTACCAAACATTACAAAAAAATTTTATGGCCCAAAATGACCAA
CGAAATTGTTACAATAGAATTTATCCAATTTTGATCTTTTTATATTCTTCTACCACACCT
GGAAACAGACCAATAGACATTTTGGGGTTTTATAATAGGAATTTGTATAAAGCATTACTC
TTTTTCAATAAATTGTTTTTTAATTTAAAAAAAGGA
ttattggcttgttttctaatcatttattgcaagattgccattcttggtagaggaggtggc
ttgggacaggatctgactcaccatgatcctgggaaagaactatgatgcctctggcccatc
tatcaaatttgagtggctccacccactagaatgccctatttctctcaaattgagttcctc