Gene CCR5 Variant 1
DNA : 6.05 KbNT_079509
mRNA : 3655 bp NM_000579
CDS : 1059 bp NP_000570
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  57 bp
cccagagggcatcttgtggctcgggagtagctctctgctgtcttctcagctctgctgaca
atacttgagattttcagatgtcaccaaccaccaagagagcttgatatgactgtatatagt
atagtcataaagaacctgaacttgaccatatacttatgtcatgtggaaaatttctcatag
CTTCAGATAGATTATATCTGGAGTGAAGAATCCTGCCACCTATGTATCTGGCATAGT
gtgagtcctcataaatgcttactggtttgaagggcaacaaaatagtgaacagagtgaaaa
tccccactaagatcctgggtccagaaaaagatgggaaacctgtttagctcacccgtgagc
ccatagttaaaactctttagacaacaggttttttccgtttacagagaacaataatattgg
EXON 2  289 bp
tcttaagataatcagaattttcttaaccttttagccttactgttgaaaagccctgtgatc
ttgtacaaatcatttgcttcttggatagtaatttcttttactaaaatgtgggcttttgac
tagatgaatgtaaatgttcttctagctctgatatcctttattctttatattttctaacag
ATTCTGTGTAGTGGGATGAGCAGAGAACAAAAACAAAATAATCCAGTGAGAAAAGCCCGT
AAATAAACTTTCAGACCAGAGATCTATTCTCTAGCTTATTTTAAGCTCAACTTAAAAGGA
AGAACTGTTCTCTGATTCTTTTCGCCTTCAATACACTTAATGATTTAACTCCACCCTCCT
TCAAAAGAAACAGCATTTCCTACTTTTATACTGTCTATATGATTGATTTGCACAGCTCAT
CTGGCCAGAAGAGCTGAGACATCCGTTCCCCTACAAGAAACTCTCCCCG
gtaagtaacctctcagctgcttggcctgttagttagcttctgagatgagtaaaagacttt
acaggaaacccatagaagacatttggcaaacaccaagtgctcatacaattatcttaaaat
ataatctttaagataaggaaagggtcacagtttggaatgagtttcagacggttataacat
EXON 3  3309 bp
agcagcaaaccttcccttcactacaaaacttcattgcttggccaaaaagagagttaattc
aatgtagacatctatgtaggcaattaaaaacctattgatgtataaaacagtttgcattca
tggagggcaactaaatacattctaggactttataaaagatcactttttatttatgcacag
GGTGGAACAAGATGGATTATCAAGTGTCAAGTCCAATCTATGACATCAATTATTATACAT
CGGAGCCCTGCCAAAAAATCAATGTGAAGCAAATCGCAGCCCGCCTCCTGCCTCCGCTCT
ACTCACTGGTGTTCATCTTTGGTTTTGTGGGCAACATGCTGGTCATCCTCATCCTGATAA
ACTGCAAAAGGCTGAAGAGCATGACTGACATCTACCTGCTCAACCTGGCCATCTCTGACC
TGTTTTTCCTTCTTACTGTCCCCTTCTGGGCTCACTATGCTGCCGCCCAGTGGGACTTTG
GAAATACAATGTGTCAACTCTTGACAGGGCTCTATTTTATAGGCTTCTTCTCTGGAATCT
TCTTCATCATCCTCCTGACAATCGATAGGTACCTGGCTGTCGTCCATGCTGTGTTTGCTT
TAAAAGCCAGGACGGTCACCTTTGGGGTGGTGACAAGTGTGATCACTTGGGTGGTGGCTG
TGTTTGCGTCTCTCCCAGGAATCATCTTTACCAGATCTCAAAAAGAAGGTCTTCATTACA
CCTGCAGCTCTCATTTTCCATACAGTCAGTATCAATTCTGGAAGAATTTCCAGACATTAA
AGATAGTCATCTTGGGGCTGGTCCTGCCGCTGCTTGTCATGGTCATCTGCTACTCGGGAA
TCCTAAAAACTCTGCTTCGGTGTCGAAATGAGAAGAAGAGGCACAGGGCTGTGAGGCTTA
TCTTCACCATCATGATTGTTTATTTTCTCTTCTGGGCTCCCTACAACATTGTCCTTCTCC
TGAACACCTTCCAGGAATTCTTTGGCCTGAATAATTGCAGTAGCTCTAACAGGTTGGACC
AAGCTATGCAGGTGACAGAGACTCTTGGGATGACGCACTGCTGCATCAACCCCATCATCT
ATGCCTTTGTCGGGGAGAAGTTCAGAAACTACCTCTTAGTCTTCTTCCAAAAGCACATTG
CCAAACGCTTCTGCAAATGCTGTTCTATTTTCCAGCAAGAGGCTCCCGAGCGAGCAAGCT
CAGTTTACACCCGATCCACTGGGGAGCAGGAAATATCTGTGGGCTTGTGACACGGACTCA
AGTGGGCTGGTGACCCAGTCAGAGTTGTGCACATGGCTTAGTTTTCATACACAGCCTGGG
CTGGGGGTGGGGTGGGAGAGGTCTTTTTTAAAAGGAAGTTACTGTTATAGAGGGTCTAAG
ATTCATCCATTTATTTGGCATCTGTTTAAAGTAGATTAGATCTTTTAAGCCCATCAATTA
TAGAAAGCCAAATCAAAATATGTTGATGAAAAATAGCAACCTTTTTATCTCCCCTTCACA
TGCATCAAGTTATTGACAAACTCTCCCTTCACTCCGAAAGTTCCTTATGTATATTTAAAA
GAAAGCCTCAGAGAATTGCTGATTCTTGAGTTTAGTGATCTGAACAGAAATACCAAAATT
ATTTCAGAAATGTACAACTTTTTACCTAGTACAAGGCAACATATAGGTTGTAAATGTGTT
TAAAACAGGTCTTTGTCTTGCTATGGGGAGAAAAGACATGAATATGATTAGTAAAGAAAT
GACACTTTTCATGTGTGATTTCCCCTCCAAGGTATGGTTAATAAGTTTCACTGACTTAGA
ACCAGGCGAGAGACTTGTGGCCTGGGAGAGCTGGGGAAGCTTCTTAAATGAGAAGGAATT
TGAGTTGGATCATCTATTGCTGGCAAAGACAGAAGCCTCACTGCAAGCACTGCATGGGCA
AGCTTGGCTGTAGAAGGAGACAGAGCTGGTTGGGAAGACATGGGGAGGAAGGACAAGGCT
AGATCATGAAGAACCTTGACGGCATTGCTCCGTCTAAGTCATGAGCTGAGCAGGGAGATC
CTGGTTGGTGTTGCAGAAGGTTTACTCTGTGGCCAAAGGAGGGTCAGGAAGGATGAGCAT
TTAGGGCAAGGAGACCACCAACAGCCCTCAGGTCAGGGTGAGGATGGCCTCTGCTAAGCT
CAAGGCGTGAGGATGGGAAGGAGGGAGGTATTCGTAAGGATGGGAAGGAGGGAGGTATTC
GTGCAGCATATGAGGATGCAGAGTCAGCAGAACTGGGGTGGATTTGGTTTGGAAGTGAGG
GTCAGAGAGGAGTCAGAGAGAATCCCTAGTCTTCAAGCAGATTGGAGAAACCCTTGAAAA
GACATCAAGCACAGAAGGAGGAGGAGGAGGTTTAGGTCAAGAAGAAGATGGATTGGTGTA
AAAGGATGGGTCTGGTTTGCAGAGCTTGAACACAGTCTCACCCAGACTCCAGGCTGTCTT
TCACTGAATGCTTCTGACTTCATAGATTTCCTTCCCATCCCAGCTGAAATACTGAGGGGT
CTCCAGGAGGAGACTAGATTTATGAATACACGAGGTATGAGGTCTAGGAACATACTTCAG
CTCACACATGAGATCTAGGTGAGGATTGATTACCTAGTAGTCATTTCATGGGTTGTTGGG
AGGATTCTATGAGGCAACCACAGGCAGCATTTAGCACATACTACACATTCAATAAGCATC
AAACTCTTAGTTACTCATTCAGGGATAGCACTGAGCAAAGCATTGAGCAAAGGGGTCCCA
TAGAGGTGAGGGAAGCCTGAAAAACTAAGATGCTGCCTGCCCAGTGCACACAAGTGTAGG
TATCATTTTCTGCATTTAACCGTCAATAGGCAAAGGGGGGAAGGGACATATTCATTTGGA
AATAAGCTGCCTTGAGCCTTAAAACCCACAAAAGTACAATTTACCAGCCTCCGTATTTCA
GACTGAATGGGGGTGGGGGGGGCGCCTTAGGTACTTATTCCAGATGCCTTCTCCAGACAA
ACCAGAAGCAACAGAAAAAATCGTCTCTCCCTCCCTTTGAAATGAATATACCCCTTAGTG
TTTGGGTATATTCATTTCAAAGGGAGAGAGAGAGGTTTTTTTCTGTTCTTTCTCATATGA
TTGTGCACATACTTGAGACTGTTTTGAATTTGGGGGATGGCTAAAACCATCATAGTACAG
GTAAGGTGAGGGAATAGTAAGTGGTGAGAACTACTCAGGGAATGAAGGTGTCAGAATAAT
AAGAGGTGCTACTGACTTTCTCAGCCTCTGAATATGAACGGTGAGCATTGTGGCTGTCAG
CAGGAAGCAACGAAGGGAAATGTCTTTCCTTTTGCTCTTAAGTTGTGGAGAGTGCAACAG
TAGCATAGGACCCTACCCTCTGGGCCAAGTCAAAGACATTCTGACATCTTAGTATTTGCA
TATTCTTATGTATGTGAAAGTTACAAATTGCTTGAAAGAAAATATGCATCTAATAAAAAA
CACCTTCTA
aaataattcattatattcttgctctttcagtcaagtgtacatttagagaatagcacataa
aactgccagagcattttataagcagctgttttcttccttagtgtgtgtgcatgtgtgtgt
gatgtatacaaagagagagataattgtatttttgtattttcttttaaataatttttaaaa