Gene CASR Variant 1
DNA : 101.68 KbNT_005612
mRNA : 3783 bp NM_000388
CDS : 3237 bp NP_000379
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
caaacacatacaaaaaaactggttttctacaaaagaaattaattttccacttattcataa
aatattctagtgctgtgatgggtggcaggcaccgtgccaggggctagggacaaggataag
caaggccaggtccgggcctccaagcagcgcgctgtggagtcgggtagagtagaccaagtg
CAACAGGCACCTGGCTGCAGCCAGGAAGGACCGCACGCCCTTTCGCGCAGGAGAGTGGAA
GGAGGGAGCTGTTTGCCAGCACCGAGGTCTTGCGGCACAGGCAACGCTTGACCTGAGTCT
TGCAGAATGA
gtaagagtttgggcacgcgatttgtatttattttactgtgaatctctggccttatatcag
aaaaaaaaaaattgtgccaccctcggcacagagaacgttggtggcgtcgtaagcgcccta
agcttctttccatcgccaaggagtaggggtcagggaagaggacagcgggaacaggatttg
EXON 2  427 bp
aattgacgtttcctgtattttacatgaagtgctataaaaatgtgactccaagccaggcct
tttcagtctgccacccctaggcccctctaaatggaaattctgagccaccttagttgcagt
ggtcatcacaagatgggattgaggtttagctgaatccattttgtctttcttttcttttag
AAGGCATCACAGGAGGCCTCTGCATGATGTGGCTTCCAAAGACTCAAGGACCACCCACAT
TACAAGTCTGGATTGAGGAAGGCAGAAATGGAGATTCAAACACCACGTCTTCTATTATTT
TATTAATCAATCTGTAGACATGTGTCCCCACTGCAGGGAGTGAACTGCTCCAAGGGAGAA
ACTTCTGGGAGCCTCCAAACTCCTAGCTGTCTCATCCCTTGCCCTGGAGAGACGGCAGAA
CCATGGCATTTTATAGCTGCTGCTGGGTCCTCTTGGCACTCACCTGGCACACCTCTGCCT
ACGGGCCAGACCAGCGAGCCCAAAAGAAGGGGGACATTATCCTTGGGGGGCTCTTTCCTA
TTCATTTTGGAGTAGCAGCTAAAGATCAAGATCTCAAATCAAGGCCGGAGTCTGTGGAAT
GTATCAG
gtaagaagaggggcctaatctgccaatctcttctcttctgagtggttggagaaaagctgc
accaaacgcaaaataattttttcaaactttgtcctatcttttcaagaatagtgattgatt
ggtaatcatgctgaagcttattgcccccacaacctgccttttttttcctgaagacttctt
EXON 3  307 bp
gtgagccaccacgcccggccatgtcatccccattttaacagagagggctctgtacagagc
atgccatgaagccagagagtagtaacagttcgatgattcaaacccagctttgccaggtct
ttactctaaagtcgttgactagaaagcttcccattttcttccacttcttctttcttccag
GTATAATTTCCGTGGGTTTCGCTGGTTACAGGCTATGATATTTGCCATAGAGGAGATAAA
CAGCAGCCCAGCCCTTCTTCCCAACTTGACGCTGGGATACAGGATATTTGACACTTGCAA
CACCGTTTCTAAGGCCTTGGAAGCCACCCTGAGTTTTGTTGCTCAAAACAAAATTGATTC
TTTGAACCTTGATGAGTTCTGCAACTGCTCAGAGCACATTCCCTCTACGATTGCTGTGGT
GGGAGCAACTGGCTCAGGCGTCTCCACGGCAGTGGCAAATCTGCTGGGGCTCTTCTACAT
TCCCCAG
gtactcaagccttctcaggcggggcactgggagcaggatcagaagaagcaggcttggggg
tgccatgcccaatagccatacggtttaccatattcccatctctggcacaaaagacctatg
atttagttgatatgctgtatcatgaccatttgggatttctgaaactccagtgtccacaat
EXON 4  885 bp
ggagtggaacagatgctgcttttccttaccctttctttcatcctgtatacagtgaacagc
atagttgataaatgagaccaaggcatgctcagaaagccacctccacaacagcctggaggc
tcactcagcacctcttcactcactcactcactcattcaccatgttcttggttctctccag
GTCAGTTATGCCTCCTCCAGCAGACTCCTCAGCAACAAGAATCAATTCAAGTCTTTCCTC
CGAACCATCCCCAATGATGAGCACCAGGCCACTGCCATGGCAGACATCATCGAGTATTTC
CGCTGGAACTGGGTGGGCACAATTGCAGCTGATGACGACTATGGGCGGCCGGGGATTGAG
AAATTCCGAGAGGAAGCTGAGGAAAGGGATATCTGCATCGACTTCAGTGAACTCATCTCC
CAGTACTCTGATGAGGAAGAGATCCAGCATGTGGTAGAGGTGATTCAAAATTCCACGGCC
AAAGTCATCGTGGTTTTCTCCAGTGGCCCAGATCTTGAGCCCCTCATCAAGGAGATTGTC
CGGCGCAATATCACGGGCAAGATCTGGCTGGCCAGCGAGGCCTGGGCCAGCTCCTCCCTG
ATCGCCATGCCTCAGTACTTCCACGTGGTTGGCGGCACCATTGGATTCGCTCTGAAGGCT
GGGCAGATCCCAGGCTTCCGGGAATTCCTGAAGAAGGTCCATCCCAGGAAGTCTGTCCAC
AATGGTTTTGCCAAGGAGTTTTGGGAAGAAACATTTAACTGCCACCTCCAAGAAGGTGCA
AAAGGACCTTTACCTGTGGACACCTTTCTGAGAGGTCACGAAGAAAGTGGCGACAGGTTT
AGCAACAGCTCGACAGCCTTCCGACCCCTCTGTACAGGGGATGAGAACATCAGCAGTGTC
GAGACCCCTTACATAGATTACACGCATTTACGGATATCCTACAATGTGTACTTAGCAGTC
TACTCCATTGCCCACGCCTTGCAAGATATATATACCTGCTTACCTGGGAGAGGGCTCTTC
ACCAATGGCTCCTGTGCAGACATCAAGAAAGTTGAGGCGTGGCAG
gtgcgtccttcacttatatagcaatttgctgtataataaagcagagttgggctgcaactc
caggcaagaaaaatagtggtcatttgaaaagggcaatatttaaatgaagccactaaatgg
agctttggattcaaagtaccttttttaaatcttgagcaactgatttgaacaaaattgata
EXON 5  231 bp
ctgctgctaacaccggcaagtactttggtgtgaattagaaaaagctgtctcttcctcaag
tcacgttcctcccactttgttggaacaagatagtctaccgttgttgtgcagggcacagcc
tacctaattagttctatgtggcagccctggggcttgtactcattctttgctcctctttag
GTCCTGAAGCACCTACGGCATCTAAACTTTACAAACAATATGGGGGAGCAGGTGACCTTT
GATGAGTGTGGTGACCTGGTGGGGAACTATTCCATCATCAACTGGCACCTCTCCCCAGAG
GATGGCTCCATCGTGTTTAAGGAAGTCGGGTATTACAACGTCTATGCCAAGAAGGGAGAA
AGACTCTTCATCAACGAGGAGAAAATCCTGTGGAGTGGGTTCTCCAGGGAG
gtaggtgctgtccatcagaaaaccagatgtctccaccaggggcaggaaactgtgctgggc
tttgggagggcctttggtttccccactggacttccaaaataaagagtccacttccctgaa
ctctctggcctttgcaatcttggggctccctgtgaaatccacagtgtttagtgtaaagag
EXON 6  124 bp
cctttcacagatatcagaaccaaggacctctggacctccctttgcctggaatgggcccaa
cgtctgtcacactgattcttgtgcccaaactcctccctcttacatgttttgaagagacag
tagggctggcccctgaccctacaactacagccactcacctttgtgctgtctgtcctccag
GTGCCCTTCTCCAACTGCAGCCGAGACTGCCTGGCAGGGACCAGGAAAGGGATCATTGAG
GGGGAGCCCACCTGCTGCTTTGAGTGTGTGGAGTGTCCTGATGGGGAGTATAGTGATGAG
ACAG
gtaagggaacccctcttgggcactgtgcagggcttggtccacttcggaggcctggggtca
gtgaagcccatggaagggctgggctgagatggtgctttgcacagtttctcatttaacaaa
ggtatatctgagcatcacaaaatgttgggcatggaggtggaacagaaaaagaatgttaga
EXON 7  1679 bp
ttaaacatgtcggggttcagcatatttttgataatgtaaaaatcagaatgatttcatcaa
aatggagaaaatatgtagtgaccacatccaaaaaactatgtattcccaccaccacatgta
cactcacacattttagtctgtgccacacaataactcactcttcactgggacattttacag
ATGCCAGTGCCTGTAACAAGTGCCCAGATGACTTCTGGTCCAATGAGAACCACACCTCCT
GCATTGCCAAGGAGATCGAGTTTCTGTCGTGGACGGAGCCCTTTGGGATCGCACTCACCC
TCTTTGCCGTGCTGGGCATTTTCCTGACAGCCTTTGTGCTGGGTGTGTTTATCAAGTTCC
GCAACACACCCATTGTCAAGGCCACCAACCGAGAGCTCTCCTACCTCCTCCTCTTCTCCC
TGCTCTGCTGCTTCTCCAGCTCCCTGTTCTTCATCGGGGAGCCCCAGGACTGGACGTGCC
GCCTGCGCCAGCCGGCCTTTGGCATCAGCTTCGTGCTCTGCATCTCATGCATCCTGGTGA
AAACCAACCGTGTCCTCCTGGTGTTTGAGGCCAAGATCCCCACCAGCTTCCACCGCAAGT
GGTGGGGGCTCAACCTGCAGTTCCTGCTGGTTTTCCTCTGCACCTTCATGCAGATTGTCA
TCTGTGTGATCTGGCTCTACACCGCGCCCCCGTCAAGCTACCGCAACCAGGAGCTGGAGG
ATGAGATCATCTTCATCACGTGCCACGAGGGCTCCCTCATGGCCCTGGGCTTCCTGATCG
GCTACACCTGCCTGCTGGCTGCCATCTGCTTCTTCTTTGCCTTCAAGTCCCGGAAGCTGC
CGGAGAACTTCAATGAAGCCAAGTTCATCACCTTCAGCATGCTCATCTTCTTCATCGTCT
GGATCTCCTTCATTCCAGCCTATGCCAGCACCTATGGCAAGTTTGTCTCTGCCGTAGAGG
TGATTGCCATCCTGGCAGCCAGCTTTGGCTTGCTGGCGTGCATCTTCTTCAACAAGATCT
ACATCATTCTCTTCAAGCCATCCCGCAACACCATCGAGGAGGTGCGTTGCAGCACCGCAG
CTCACGCTTTCAAGGTGGCTGCCCGGGCCACGCTGCGCCGCAGCAACGTCTCCCGCAAGC
GGTCCAGCAGCCTTGGAGGCTCCACGGGATCCACCCCCTCCTCCTCCATCAGCAGCAAGA
GCAACAGCGAAGACCCATTCCCACAGCCCGAGAGGCAGAAGCAGCAGCAGCCGCTGGCCC
TAACCCAGCAAGAGCAGCAGCAGCAGCCCCTGACCCTCCCACAGCAGCAACGATCTCAGC
AGCAGCCCAGATGCAAGCAGAAGGTCATCTTTGGCAGCGGCACGGTCACCTTCTCACTGA
GCTTTGATGAGCCTCAGAAGAACGCCATGGCCCACAGGAATTCTACGCACCAGAACTCCC
TGGAGGCCCAGAAAAGCAGCGATACGCTGACCCGACACGAGCCATTACTCCCGCTGCAGT
GCGGGGAAACGGACTTAGATCTGACCGTCCAGGAAACAGGTCTGCAAGGACCTGTGGGTG
GAGACCAGCGGCCAGAGGTGGAGGACCCTGAAGAGTTGTCCCCAGCACTTGTAGTGTCCA
GTTCACAGAGCTTTGTCATCAGTGGTGGAGGCAGCACTGTTACAGAAAACGTAGTGAATT
CATAAAATGGAAGGAGAAGACTGGGCTAGGGAGAATGCAGAGAGGTTTCTTGGGGTCCCA
GGGAAGAGGAATCGCCCCAGACTCCTTTCCTCTGAGGAAGAAGGGATAATAGACACATCA
AATGCCCCGAATTTAGTCACACCATCTTAAATGACAGTGAATTGACCCATGTTCCCTTT
aaaattaaaaaaaagaagagccttgtgtttctgtggttgcatttgtcaaagcattgagat
ctccacggtcagatttgctgttcacccacatctaatgtctcttcctctgttctatcccac
ccaacagctcagagatgaaactatggctttaaactaccctccagagtgtgcagactgatg