Gene BAP1 Variant 1
DNA : 8.98 KbNT_022517
mRNA : 3582 bp NM_004656
CDS : 2190 bp NP_004647
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  152 bp
ccgcccctccccttcgcccccgtccctccccttcgcccccgtccctccgcgcgtgcgcgt
tcgccttcgagcgcatgcccgcatctgctgtccgacaggcggaagacgagcccagaggcg
gagcagggccgtcgcgccttggtgacgtctgccgccggcgcgggcgggtgacgcgactgg
GCCCGTTGTCTGTGTGTGGGACTGAGGGGCCCCGGGGGCGGTGGGGGCTCCCGGTGGGGG
CAGCGGTGGGGAGGGAGGGCCTGGACATGGCGCTGAGGGGCCGCCCCGCGGGAAGATGAA
TAAGGGCTGGCTGGAGCTGGAGAGCGACCCAG
gtgaggaggggaccgggagggccaggggctggggaggccggatgggcccgggacgcgcct
gcctgaccatcaccccctcctcttgtcgccccacccaggcctcttcaccctgctcgtgga
agatttcggtaagagccttttctccctgccggaccggggctgtggcggcccacccctgcg
EXON 2  30 bp
gagggagggcctggacatggcgctgaggggccgccccgcgggaagatgaataagggctgg
ctggagctggagagcgacccaggtgaggaggggaccgggagggccaggggctggggaggc
cggatgggcccgggacgcgcctgcctgaccatcaccccctcctcttgtcgccccacccag
GCCTCTTCACCCTGCTCGTGGAAGATTTCG
gtaagagccttttctccctgccggaccggggctgtggcggcccacccctgcgccctcact
catcaggggctgtccttccctactgctttcctttcctcatcgcaggtgtcaagggggtgc
aagtggaggagatctacgaccttcagagcaaatgtcaggggtgagtggctgtacaccagg
EXON 3  55 bp
cgcgcctgcctgaccatcaccccctcctcttgtcgccccacccaggcctcttcaccctgc
tcgtggaagatttcggtaagagccttttctccctgccggaccggggctgtggcggcccac
ccctgcgccctcactcatcaggggctgtccttccctactgctttcctttcctcatcgcag
GTGTCAAGGGGGTGCAAGTGGAGGAGATCTACGACCTTCAGAGCAAATGTCAGGG
gtgagtggctgtacaccagggctgccccttacacccagagtgctggggaaggtcccagag
aacagggccccttagggaagacagtgccaggaaccctacgttgtaaaatctcacagaaag
cagcagccttgctctctgagtgcccgctcctgatcaaactgatactttcttttctcccaa
EXON 4  133 bp
ggtgtgtgagggcacaaggccacttcagacacagtgttgggaagaagccaggggagaggg
gggatcacagcaaggacacctgagtgatgacgcagtgcaaaggattaatgggagaaagaa
gggaatgctgattgtcttctcccctttggctgatctggctctgccccttacttcccccag
CCCTGTATATGGATTTATCTTCCTGTTCAAATGGATCGAAGAGCGCCGGTCCCGGCGAAA
GGTCTCTACCTTGGTGGATGATACGTCCGTGATTGATGATGATATTGTGAATAACATGTT
CTTTGCCCACCAG
gtctgctggactctgtgctttgtttggagggtgggatgctgccatgtttttgcttgggaa
gtggaaatggaggaagacaggaggaggagataggcagattctaggggtggtagctacaga
aatcctctggcagaacgaactgaactcttaattcattaaagggaacagctttagagtagg
EXON 5  120 bp
ccagtgggtatttggtaggtgcttgttaaatgaataaacattaggcaaagatgaaaggag
ctgagaaggggagttgtccagatatgactgacctgctctggatccccattcttgatgtat
atgggcttggggcttgcagtgaggggtgctgtgtatgggtgactattcttggtttcacag
CTGATACCCAACTCTTGTGCAACTCATGCCTTGCTGAGCGTGCTCCTGAACTGCAGCAGC
GTGGACCTGGGACCCACCCTGAGTCGCATGAAGGACTTCACCAAGGGTTTCAGCCCTGAG

gtaggctgcagtgccttcatcctggctcacagccaactgggcagatctgaccctgagggc
cactgggaatgctaccacatgatattgggtactattaggctgtttctttttcaaatgatt
gtttatgttacatttgactcttaaataaattgtgtaaggccattgtttttagatgcagtt
EXON 6  62 bp
agtccatctctttggggctccagagctcttttctgcccccaccagccttttaagaaagtt
cgtctgtgttccttccgattcctggaatgcctccaggctgctctctgaagctttgccttc
cacccatagtcctacctgaggagaaattattctgatacggccttattttcttccccgtag
AGCAAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAATAGCCATGCC
AG
gtgtgtgggagctgtgggagctgatgtggggtgggagtagggggagtatcattttttggg
ccctgactctgtttttccccaggcccgagccacgccacctccctgagaagcagaatggcc
ttagtgcagtgcggaccatggaggcgttccactttgtcagctatgtgcctatcacaggcc
EXON 7  143 bp
aattattctgatacggccttattttcttccccgtagagcaaaggatatgcgattggcaat
gccccggagttggccaaggcccataatagccatgccaggtgtgtgggagctgtgggagct
gatgtggggtgggagtagggggagtatcattttttgggccctgactctgtttttccccag
GCCCGAGCCACGCCACCTCCCTGAGAAGCAGAATGGCCTTAGTGCAGTGCGGACCATGGA
GGCGTTCCACTTTGTCAGCTATGTGCCTATCACAGGCCGGCTCTTTGAGCTGGATGGGCT
GAAGGTCTACCCCATTGACCATG
gtaggcaccatgagctggaggcctgttgggtgtctctgcctacctcctagggagctgggg
ctcagggccctctggtatgtggtacccagtggcaggggttgtcggtaccgacacccggct
ctggctggggtttcaccctacaccatattgcccgaccagctcctgattccctggctcaac
EXON 8  79 bp
cagtggcaggggttgtcggtaccgacacccggctctggctggggtttcaccctacaccat
attgcccgaccagctcctgattccctggctcaactgctcttctctgtcttccttcccact
cctggcctgcccaaactcagggtttccttctcgctgattccttgtcttggtctccactag
GGCCCTGGGGGGAGGACGAGGAGTGGACAGACAAGGCCCGGCGGGTCATCATGGAGCGTA
TCGGCCTCGCCACTGCAGG
gtaagggccctgtgcctgccctgttctactctctggagctgtacctactttgggagggac
agagagtatccaggtgatttgtaaattgcaaggccatatggtgaatctggcaagatcagg
cttagatcatgggttctcaacttgttgtcttatttcctgcctgggctgcctgtggcctgc
EXON 9  124 bp
tgttggaaggtaccagctcaggtgcctggcatgtatggctagtcgctgcctgcctgttgg
ggtggggcctatacctacagctgcaggtgtgactgcagggagccctgccaggatatctgc
ctcaacctgatggcggggccggggcgggagctgctctcacggctgcggctgtgactgcag
GGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAA
GTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCA
GCAG
gtaggtgccctttcttcctggcctctgcccagcccaaccctccctgcattcctcctccct
tcccccacagcatttgtctctgattcgtgaacatactctcttgtagatctgggcttcagc
taaccacatcttttctttgcccccattgtgggaaaggtgggacttggagtggggagggag
EXON 10  148 bp
gacttggagtggggagggagaatagcttctaaaaggaagtttgggtttgggtgttttatt
tccctgtgagtgaatgggtagagccaaggccattattcctttaggtcctcagcccttagc
tatttaaggtagaagcccgggtctaccctttctcctctgagccctggattctgttgttag
CTGATAAGAGTAACACAGCCAGAGCTGATTCAGACCCACAAGTCTCAAGAGTCACAGCTG
CCTGAGGAGTCCAAGTCAGCCAGCAACAAGTCCCCGCTGGTGCTGGAAGCAAACAGGGCC
CCTGCAGCCTCTGAGGGCAACCACACAG
gtactggggggtttgggacctcttgtggacctcagagccacccgctaatgtctgacatgg
gaggcctaaacagggaaagtctttttctggggatgtccttgggcagtgttcttcccccgt
cagaaggtagagggagagcagtccttccctaaagaaaggcacctgtaaagggccgctgtt
EXON 11  185 bp
ccatctcattctttgccctgtctcattgcgggatcatgacttagagcttgctgactccca
ttgcaccagctggctgggctgttcttctctgggaagtgctggttcacagggccggggaga
ctgtgagcttttcttggagatcctactggaggtcctgcctgtgttcttgccctgtctcag
ATGGTGCAGAGGAGGCGGCTGGTTCATGCGCACAAGCCCCATCCCACAGCCCTCCCAACA
AACCCAAGCTAGTGGTGAAGCCTCCAGGCAGCAGCCTCAATGGGGTTCACCCCAACCCCA
CTCCCATTGTCCAGCGGCTGCCGGCCTTTCTAGACAATCACAATTATGCCAAGTCCCCCA
TGCAG
gtaagctgggagcacccttgcaggattctctacttgattctcttgagaggctgcaacagg
caattttcccatgtggttccttggtgttcatccttggcatggctgggtcaagctgcctgg
gcctgggttgctaggttcctctgcctgatatgaaaaggcccccacaacagcaggagctta
EXON 12  134 bp
tctatccagtgtaagtgggtggcagcctccccacaagccaaggacaggccatggaacagc
tggaggggttccgctgactcagtctggaaaaccatgttggctttctctctggctgtgagt
gtctaggctcagcctgggccgagcagcacttgtttgtaactgccctggtctttgtcccag
GAGGAAGAAGACCTGGCGGCAGGTGTGGGCCGCAGCCGAGTTCCAGTCCGCCCACCCCAG
CAGTACTCAGATGATGAGGATGACTATGAGGATGACGAGGAGGATGACGTGCAGAACACC
AACTCTGCCCTTAG
gtcagcccagctttctaaggctaccaggttctaggtgcttcggatcccatcctgaatatc
tcagtctgtgtctgagaatgccctgcagcagataatgttgagcacctgcggagtttgggg
ccctgggggaggctggcatgatggggctgaccccaggtccccaggaagtttttggtgggc
EXON 13  479 bp
ggctgcagctgtcagaacttgatgccaggcttagcatggctagttcaagttgcttggacc
aagtataaggagttttagggtcagcccctggaggtcgggatgtatttaagccattctggg
tactgctgggtatggtcacctggcccgttcccttgcttcacatcttctcgggccccacag
GTATAAGGGGAAGGGAACAGGGAAGCCAGGGGCATTGAGCGGTTCTGCTGATGGGCAACT
GTCAGTGCTGCAGCCCAACACCATCAACGTCTTGGCTGAGAAGCTCAAAGAGTCCCAGAA
GGACCTCTCAATTCCTCTGTCCATCAAGACTAGCAGCGGGGCTGGGAGTCCGGCTGTGGC
AGTGCCCACACACTCGCAGCCCTCACCCACCCCCAGCAATGAGAGTACAGACACGGCCTC
TGAGATCGGCAGTGCTTTCAACTCGCCACTGCGCTCGCCTATCCGCTCAGCCAACCCGAC
GCGGCCCTCCAGCCCTGTCACCTCCCACATCTCCAAGGTGCTTTTTGGAGAGGATGACAG
CCTGCTGCGTGTTGACTGCATACGCTACAACCGTGCTGTCCGTGATCTGGGTCCTGTCAT
CAGCACAGGCCTGCTGCACCTGGCTGAGGATGGGGTGCTGAGTCCCCTGGCGCTGACAG
gtgggccttggactggctcactggccacttggtgcacccaggagggaggagggaagtggc
caagtgaccacaaagtgtcctgcactctgatgattttcttgtgacctctcttcccagagg
gtgggaagggttcctcgccctccatcagaccaatccaaggcagccaggggtccagcagcc
EXON 14  161 bp
tcatcagcacaggcctgctgcacctggctgaggatggggtgctgagtcccctggcgctga
caggtgggccttggactggctcactggccacttggtgcacccaggagggaggagggaagt
ggccaagtgaccacaaagtgtcctgcactctgatgattttcttgtgacctctcttcccag
AGGGTGGGAAGGGTTCCTCGCCCTCCATCAGACCAATCCAAGGCAGCCAGGGGTCCAGCA
GCCCAGTGGAGAAGGAGGTCGTGGAAGCCACGGACAGCAGAGAGAAGACGGGGATGGTGA
GGCCTGGCGAGCCCTTGAGTGGGGAGAAATACTCACCCAAG
gtgagcctccgttgtggttttctcctttaatcctggcagagggtaaggcctgagctcctc
ctgcccaggtgccaagttcttgattggaactttggtgtgaagattggtggctggagccat
gtgccagaagactttctgggttgggtggtggcaggggccttgataggcatggactcgctg
EXON 15  93 bp
gaactttggtgtgaagattggtggctggagccatgtgccagaagactttctgggttgggt
ggtggcaggggccttgataggcatggactcgctgctcatccttgcctctagctgcctatt
gctcgtggggctttgttgctggcccgccccgatcagaggtgcaatgctgggttttggcag
GAGCTGCTGGCACTGCTGAAGTGTGTGGAGGCTGAGATTGCAAACTATGAGGCGTGCCTC
AAGGAGGAGGTAGAGAAGAGGAAGAAGTTCAAG
gtgggtgatttctccagttgcctgatctggcctctcccgaggtccactggtggctgctct
ggcaagattggctccagtgctctcagtcttcttctctcctacagattgatgaccagagaa
ggacccacaactacgatgagttcatctgcacctttatctccatgctggctcaggaaggtg
EXON 16  73 bp
gaagtgtgtggaggctgagattgcaaactatgaggcgtgcctcaaggaggaggtagagaa
gaggaagaagttcaaggtgggtgatttctccagttgcctgatctggcctctcccgaggtc
cactggtggctgctctggcaagattggctccagtgctctcagtcttcttctctcctacag
ATTGATGACCAGAGAAGGACCCACAACTACGATGAGTTCATCTGCACCTTTATCTCCATG
CTGGCTCAGGAAG
gtgaggggatgcgctgctgtcttaactggaatgccctgctgagggccgtgtccttcagct
cccctcccctggcctctcctgaggcttgagcagaccttggggcacagggagggccatgag
agcctcagctcctggcctgaggcagccagcacctgctcaagggtctctacctcttcgcag
EXON 17  1411 bp
gtgaggggatgcgctgctgtcttaactggaatgccctgctgagggccgtgtccttcagct
cccctcccctggcctctcctgaggcttgagcagaccttggggcacagggagggccatgag
agcctcagctcctggcctgaggcagccagcacctgctcaagggtctctacctcttcgcag
GCATGCTGGCCAACCTAGTGGAGCAGAACATCTCCGTGCGGCGGCGCCAAGGGGTCAGCA
TCGGCCGGCTCCACAAGCAGCGGAAGCCTGACCGGCGGAAACGCTCTCGCCCCTACAAGG
CCAAGCGCCAGTGAGGACTGCTGGCCCTGACTCTGCAGCCCACTCTTGCCGTGTGGCCCT
CACCAGGGTCCTTCCCTGCCCCACTTCCCCTTTTCCCAGTATTACTGAATAGTCCCAGCT
GGAGAGTCCAGGCCCTGGGAATGGGAGGAACCAGGCCACATTCCTTCCATCGTGCCCTGA
GGCCTGACACGGCAGATCAGCCCCATAGTGCTCAGGAGGCAGCATCTGGAGTTGGGGCAC
AGCGAGGTACTGCAGCTTCCTCCACAGCCGGCTGTGGAGCAGCAGGACCTGGCCCTTCTG
CCTGGGCAGCAGAATATATATTTTACCTATCAGAGACATCTATTTTTCTGGGCTCCAACC
CAACATGCCACCATGTTGACATAAGTTCCTACCTGACTATGCTTTCTCTCCTAGGAGCTG
TCCTGGTGGGCCCAGGTCCTTGTATCATGCCACGGTCCCAACTACAGGGTCCTAGCTGGG
GGCCTGGGTGGGCCCTGGGCTCTGGGCCCTGCTGCTCTAGCCCCAGCCACCAGCCTGTCC
CTGTTGTAAGGAAGCCAGGTCTTCTCTCTTCATTCCTCTTAGGAGAGTGCCAAACTCAGG
GACCCAGCACTGGGCTGGGTTGGGAGTAGGGTGTCCCAGTGGGGTTGGGGTGAGCAGGCT
GCTGGGATCCCATGGCCTGAGCAGAGCATGTGGGAACTGTTCAGTGGCCTGTGAACTGTC
TTCCTTGTTCTAGCCAGGCTGTTCAAGACTGCTCTCCATAGCAAGGTTCTAGGGCTCTTC
GCCTTCAGTGTTGTGGCCCTAGCTATGGGCCTAAATTGGGCTCTAGGTCTCTGTCCCTGG
CGCTTGAGGCTCAGAAGAGCCTCTGTCCAGCCCCTCAGTATTACCATGTCTCCCTCTCAG
GGGTAGCAGAGACAGGGTTGCTTATAGGAAGCTGGCACCACTCAGCTCTTCCTGCTACTC
CAGTTTCCTCAGCCTCTGCAAGGCACTCAGGGTGGGGGACAGCAGGATCAAGACAACCCG
TTGGAGCCCCTGTGTTCCAGAGGACCTGATGCCAAGGGGTAATGGGCCCAGCAGTGCCTC
TGGAGCCCAGGCCCCAACACAGCCCCATGGCCTCTGCCAGATGGCTTTGAAAAAGGTGAT
CCAAGCAGGCCCCTTTATCTGTACATAGTGACTGAGTGGGGGGTGCTGGCAAGTGTGGCA
GCTGCCTCTGGGCTGAGCACAGCTTGACCCCTCTAGCCCCTGTAAATACTGGATCAATGA
ATGAATAAAACTCTCCTAAGAATCTCCTGAG
aaatgaaccctcctgtggttgctggcctgagatatggaggctgggccttactagacctca
tgggcctagggccctgggaccagaaaggtaagaagtatatgatccttgagtgtccagctg
tcttgggccagagatccttggaatcctaggcctgggatttaggacctgagctgaggaggg