--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (145574 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        777        835   1   Terminal     59    47    Marginal
gtttgccagtttcaagggcgcagggctacatcttccggaaaaggtggcatttgaaggtgg
taagaggccaacgactggaggtggcggcgaagggctaggtaagacagaataaatgaaaaa
gccaagacatttctggcaaataacctttcacctaggtccccgacccttccatttccccag
GCCTGAAACGCTCCCGAATCCCCGAGTCCTCCACTTTCCAAGCGCTGGGCATTGGTTAA
ggctgtaggagcagggagtcccccgctctaagagagttcctcagttccgatctttttcaa
accgctttcctcccaggcccagcctggggggcctgcggctcgggtccagcttccacggcc
accctgggctggtgacacgcaggcgccggaatcgaagccacgctgtgtctttccagccag

Exon  2 +       1127       1216   0    Initial     90    73        Good
tccacggccaccctgggctggtgacacgcaggcgccggaatcgaagccacgctgtgtctt
tccagccaggtctctgcgccagacgagggcgggcgccgcggagcgcttcccgtgtgcggg
gcttcccacaatgcaccgggccggcagtggcggcgaccgcggcggcgctctagctgcggc
ATGTCTGCGTCTCTACTGCTCTGGGAGGAGGAAGAGAAGGAGGAAGAGGAGGAGGAGGAG
GAGGGGGAGGAAGAGGAGAAAGGCGCAGGG
gtgggagctgttgccgaagctgccacagcaaaagttctcccccctccccccttcccctcc
tctcaaggcccctagaaaggttggagctgccgccgcctgcagtcggtgaccgcgcgactc
ggcgcccgcccgcggtaaagcgctcggcctggcaggcccgggcccgggggagggcggggg

Exon  3 +      11297      11375   0    Initial     79    50    Marginal
tgagaaggagggttagactggaggatactttgatggactgccagaatttattcgttcagg
gtatatttttatatttactgtatgcaatggactgccagaatttattcattcagggtatat
ttttatatttaccatgtgcaaggttctatggtagggagtgtgaaggatacatgtttatat
ATGACACAGTCCGTGTTCTTCAGGAATTTATCCAGGGACAAAACATACACATCCATCTAT
GACACAAGTACTGTGGCAG
gtttgttcaaggttggctttgtggagaaattggtgcgaagcttagaccttgaaggataaa
taagataataggcaagaaggtgagggttggctttcctagaagaaggagtgatatgagtga
cagtgagcaaagttcaggacatgtttaggggttggtggtctagattagctataatttagg

Exon  4 +      16500      16624   0    Initial    125    48    Marginal
gtagcttgcagcagagaaaatatggagagaacatatggaaaggggtttaaacaggccatg
gtttgtaggggcgaggatattgacaagcatcattaagtgtaatatttttattaaactggg
aagtagggagcccttgtattccctgggcttttgcagcccaggcccagttgtgccagctgc
ATGGGCGGGCCTGTGCTGGCGGTGCACTTAGCAGCTGGTGGAGCAGCGGCGTGGAGCTGC
ATGGTGGCGGGTGGGCTGCCGCCCACTTGGGTCTGTGTGCTCTTGGCCCATGGCAGGGCA
GGCAG
gtgggcgctcgctgaagtgagcaggaaataactgatgtcagaaacctattctttctctgt
gcaaataagaacagtctatgccacccatgataaaaggtggcagtatgtcatgccagcttt
taaaaaaatattgtcagtgatagagacattgagatctctatttgtgtgcttgagaaccac

Exon  5 +      19163      19388   2   Terminal    226    51    Marginal
agggggggaggacgggcttttgcccaccgtctggcgaaccccgcacgcctctttttgggg
ggtgtgtgtgtgtcccgcgcgagtgtgcctgtatgcagggaccagcaccttccatgactt
ccttttgtgtgtaagtgcgtgcgtgcgtgcgtgtgtctgtgcgcgtgcgcccctctgcag
GGAGGAGGAGGAGGAGGAGGCGGAGGGGCGCGGAGAAGCTGGCGCACTTTGGGCCTCGGC
GGGGTCGTCTGCGGCGGCCGGACCTCCCAGATACCGCGCCTTCTGGGCCTGCCCCGCTGG
CGCAGTCAGGACCCCTTCCCTCAACGGGATGGGAAACTTTGTGAGTGGCTTCTCCGCAGC
CACTAACAAGTGTCCGCCAGACAGCGGGGGGGCCGCCGAAGGCTGA
tgatggacacccgtttttcttcttattcctcttttacaaatcttctgttgaactgcattg
tgtttacagtttcacgtctgtgaaaaggtcagcaggtaacttgctttactagacagcttt
ttactgggtattaagagcaaaaaatgtacacctgtatccttatattaaaaaaccctgctt

Exon  6 +      29717      29893   0     Single    177    47    Marginal
tttttcccaatattaatgccatttaattcagttttttgcttaatttactgtaaattaagc
aaaatttacagtaagttttggggattagttcattctcacactgctataaagaaataccca
agcctgggtaatttataaagaggtttaattggctggggaggcctgaagaaacttacaaat
ATGGCAGAAGATGAAGGGGAGATAAGGACCTTCTTCACATGTTGGCTGAAGAGAGAAATG
CAAGTAGTGGAAATGCCAGTTGCTTATAAAACCATCACATCTTTTGAGAACTCATTCACT
ATCATGAGAATAGCATGGGGGAACTGCTCGTGTGATCCAATCATCTTCCTCCCTTGA
catgtggggattacaggtccctgtcttgatatgtggggattacaattcgagatcaaattt
gggtggggtacagaaccaaatcatatcatttaccttgctagaacctctactgtagtgttg
aatagaagtagtagcaagagtagacatccttgtcttctttctgatcttagggggaagcac

Exon  7 +      62812      63144   0    Initial    333    99   Excellent
tggaaaccgatattggtattataattttaaaattggaggcagttccaaagtacatcaata
aaatctttgtatttgaatgttcaaattcttaatttgaaaatttaaaatgaagtagtcata
taaaactaatttactatgttttgttgccaaacttggttttctaggcagttatacttaagc
ATGAACATTGACGACAAACTGGAAGGATTGTTTCTTAAATGTGGCGGCATAGACGAAATG
CAGTCTTCCAGGACAATGGTTGTAATGGGTGGAGTGTCTGGCCAGTCTACTGTGTCTGGA
GAGCTACAGGATTCAGTACTTCAAGATCGAAGTATGCCTCACCAGGAGATCCTTGCTGCA
GATGAAGTGTTACAAGAAAGTGAAATGAGACAACAGGATATGATATCACATGATGAACTC
ATGGTCCATGAGGAGACAGTGAAAAATGATGAAGAGCAGATGGAAACACATGAAAGACTT
CCTCAAGGACTACAGTATGCACTTAATGTCCCT
gtaagtaattcctttataagatattaaacttagaaacataattttttgttacgtaatact
gcaagtcatcgaagaaatttcagaaaatgtttcagggctaaatagtgttcttgaatagat
atactaaaatattgacataaatcatatttgaaaggcaaaattaagttcttgtattatatt

Exon  8 +      65413      65579   1   Terminal    167    49    Marginal
ttttgccaaaattaaacagtacagcaccaacatttcctcagtaatcttcatctatcaata
aagtgttttgcagctaatccaaaccatggagctactcttctgtaacatccagaaggaaga
gctatctgaatgtccattttccctagagctttctccataggtggtattgtatcatcatag
GCACCGTTGAGGTCATAGCCTGTGGCCTGTGTGGATCCCTGAGTCAGGGTTGTGGCCTGC
TCAGAGAATGGGGCAAAACGGAGCTGCATGCTGCCTTCCTCTGCAAACCAGCCTGTTTGC
TGGGGGTAACGGTGGGTGTCTCTTCAGAGCAGGGCATGGCAGAGTGA
aaatgcgagcagaggagagagcaacaatttttaagtgtccattttagtagtgcaaactat
attgacattgttgtacaacagatctctagaactttttcatcttgcaaaactgaaactgaa
actcatgttcgaacaactctgcatttccccctgcccagtggtagaggcttgcttatttta

Exon  9 +      67404      67436   0   Terminal     33    92   Excellent
aagtttaaagtgaaatgttcagattctgagtttgtagttcagagttttgacaactgcata
aacttgtataatccataatccatcaagataccaaatgttttagtaatcctgggaagtttt
tttgtaattcttcccagtcaattcctccacaacagttgttctgatattttttcttcatag
ATTGTCATTGTCCTTGATGAGAACCTCATGTAA
atggagttacatgtaactcttgtgtctggctgcttttgcacaacatgttttgggattcat
ccatgttggttgaatgtatcaacagttcattctttttccctattgattaatgtttagtca
ttttaattaatatcaaaatttgtttattcatcctcctttttgtggttacttgtgttgtct

Exon 10 +      67930      68007   0   Terminal     78    79        Good
aatcagtgtcacactgttttgattgctgtatcttttatagtaaatcttgaaatcaaattg
tgtatgtcctccaattttgttgttcttttgtaatactgtagtgactatgttaggtccttt
gcattttcatataaagtatggaatccaccttttaggtttttgttttttttttttttatag
AAAAGTCAACTGATTCTGATTGAGATTGCATTGATTCTGTATATTGACTTGACTGACAAA
CCAACATCTAAACAATAA
tggctcccagtccatgaatgtagtacacctttacttttatttaggttttctttatttcag
cattgttctgtagttttcagtgtaaagttattgggcacattttgttaattttatccttaa
gtatttcatggttttggttggatgctatcataaatggtatgttttaaaatgtcaaattct

Exon 11 +      71568      71679   2   Terminal    112    72        Good
tttgctgggttaaaatctattactgtgattattttaatactcagtttgtttaagatttgg
ctaacagaagccttttcaagcaggttttatgttcttggacatatctcgtcagtcgttgag
tacttctttgctttttggcacattatgttctaggcttatcttgtcctttttctgctttag
TTCTGGAGTCAGCCATTTCTCCAAGGACCCCCTAGTTCATTTTAGTGGAGAATGGTATTT
AGAAGCCAAGGTCTGGGTGCTGAACATGCTGCTCCTTGCAGTTGGGATATAG
ctgctcctaggcctctcaatggacagagctagagaatgtatgtatgtatataatgatgta
catttacatatagtgcacatattcctttctataatttccatatctatcaatattgaaaac
catgagttcctactgctacctcccattacaagtccagcagagtacattagacggtgagaa

Exon 12 +      88224      88335   0   Internal    112   100   Excellent
tattacccactgcctattaatgaattctatagcactgtatatagttaggacacacacaca
tagatcatcattctggaagcacctgtatgtgggtttagcaaaggattaaacataaaatgg
ccttttgtcacaatgaactttttatttatgtctaaaattggcttttctttttttaaacag
ATAAGCGTAAAGCAGGAAATTACTTTTACTGATGTATCTGAGCAACTGATGAGAGACAAA
AAACAAATCAGAGAGCCAGTAGACTTACAGAAAAAGAAGAAGCGGAAACAAC
gttctcccgcaaaagtaagacaatgtattaaggtggtaatcacaacctcttaattccaac
tgttggttaattctataggcaagaacctggctggaccctaaggcagatgtagaagtcttg
tgtggtttagtaggagggggtgcgtgcctgcatggaggtggtgggccttgctttcaattt

Exon 13 +      92927      93000   1   Terminal     74    66    Marginal
catgttaccttgatttaggaagaagtagctttaaagatgaactgattataagacggagga
tgcaaacaggaagtatggaatagtaagaaaatgaaggaagaagattggcaaaataataga
gttttatttatctaattttcccaggaaattgtgtgtcttgtataaattgtttttccatag
AACTGAACCCTAACTTTGAAAAAAAATCTGATGTAAATCTTTCTTTAGAAAATATCACCT
ACTTCTTTGCCTAA
tattcaggaaacagggaagaaacagcctttttctaaaacccagggtcattttgctgaaca
tagttgttgtgccatgcttatgatacagtgaatttcttgttctggtgctgtcaaaagctt
accatttaaaaaggaaatttggtgatgagaaaaatctagtactgagaaacaataaaaaat

Exon 14 +      97205      97328   0   Internal    124    64    Marginal
ttgtactttcctacagttaatgataacattattctaatagtcttttcaagatcatttaag
aacaaaatatttcataatctgtggtgaccgttgtttgcattatcttttttttaaaattac
tatttaattacattttaaaaacttatttcttttgtttttgcctttttttttttgaactag
ATCCTTACAATAAATGAGGATGGATCACTTGGTTTGAAAACCCCTAAATCTCACGTTTGT
GAGCACTGCAATGCTGCCTTTAGAACGAACTATCACTTACAGAGACATGTCTTCATTCAT
ACAG
gtatttcttgaattaaaatgggcttgtggccattaaagttattatctttgttattttcat
cttcgtgtaactgtcattcattcctaagaccatagctaatctggcattccaaatcagaga
ttttgtaggccagaatgtcagaaggaaaccaggaaaaactcttaagtgagaaaacaatta

Exon 15 +      98675      98726   0    Initial     52    76        Good
aaattctgttaataacattaaaaatttgtatggctattttgtaattttccaaaatttggg
catctaagatttttctttcctcagaaacagtaactaaaaaccgttgttttattcagtaac
taatttgtggatgtgaaattattttaaggtgaaaaaccatttcaatgtagtcaatgtgac
ATGCGTTTCATACAGAAGTACCTGCTTCAGAGACATGAGAAGATTCATACTG
gtgagtgttaaccacccttactaggttcattaaaatgattatttcaaatggagggaagaa
tttttaataagtggcagtgacttgctgccatttccattggtttagactataaatcacagg
ttatcttttttctcccttcaataaatcaatgttaactgttaagacttaactttaatgtcc

Exon 16 +     107745     107826   0    Initial     82    71        Good
ttttgctatgcagaaactctagtttctttaagtcccacttgtcaatttttgtttttgttg
cagttttttttgtagagatcaggtcttgccatgttgcctaggctggtcttgaactcctgg
cctcaagcagtcctcttactttggcctcccaaagtgctaggattgcaggtatgaaccact
ATGTCCTGCCTGTCAGTTTTCATTGTTGTTGCAATTGCGGGACTTAGTCATAAATTCTTT
GCCAAGGCTTATGTCTGGAAGG
gtatttcctaggttttcttccaggatttttatagtttttgttttacatttaagtctttaa
tttgtcttgcattaatttttgcatatggtgataggtagaagtccactttcattcttttgg
atatggttagctagtttccactgcaccatttattaggggtcttttccccattgattattt

Exon 17 +     108733     108762   0   Terminal     30    56    Marginal
gttgattttgtatcctgaaactttactgaaattgtttatcatgtctaggagccttttggc
agagtctttagggctttctagatactgaatcatatggtcagcaaagagagataatttgag
tgtctcttttcctatttggatgtcttttatttctttcccttgcctgattactctggctag
GACTTCCAGTACTATGTTGAAGAGGAGTGA
tgagaataggcgtccttgtcttgttccagttcttagggggaatgtgtccagcttttgcct
gttcagcatagtgttgattgtggtttgtcatagatggctcttattattgtgaggtatgtt
cctttgatgcctagttttttgagggtttttataatgaagggatgctggattttatcaaaa

Exon 18 +     125902     125928   1   Internal     27    50    Marginal
aataatgcaaaaaacaaaaacaaacaaaaaaccccagaaaacttaggttcaacttattcc
aactgctgtcatctacctggaagaagaccagacactagtaacaacttaatacttgctaaa
taaattaatgactggggtgccatttggcatattattggtctacattttttttaactatag
AAAATATTGATCATGAGTTTCTTACAG
gtaagttacagattatttgaaagaagtatgtacatgtaatcagaggtccacactcaggga
tgctctgagataagctatgtcagatgaataaggcactgaagcagcttttctggagatgaa
aggcagccagccagcgttgattcccaggcttggtttattagcatcatgacctgggcaaaa

Exon 19 +     128419     128465   0    Initial     47    52    Marginal
attctaactcatttgtgtttggtaagaattcactggtgcctacatatccagccattttac
taattttacatacgtcatatttagatggtgtttacagtaactgctgttgctttaatttag
gtcttgtactgcataggtgccatcattggaacatcaattatttagtgttaatatgcttag
ATGCTAGTACCAGTTGTGTACCGAGTGTATAACTGGCTGATAGAAAA
gtgagatgtggaagtgtcataaatatatggtgttcagcttattttggaattaggacaatg
gtttttttgttttgttttgtatttttcatgtatacttcctagatcaactctcagatcttt
aatttgtgcatagggcttcctgaggatgttgctcttactagaggtaattgatcagttttc

Exon 20 +     133424     133506   1   Terminal     83    70        Good
gatgtagaaaatcccatatgaggaaatcattcaaagcactacggaggatacaaaggtttg
tgaaatgggaaggcgtatcttttttcttcctaggtgaaaagagtaaacatggtaaataat
atcaaattgttcataagttaacataaacacttcagagaactctcctccctctaattctag
ATAAGCTAATTCTGAAATTTATATGGAAAGTGGTCCAGCAGGACAAACGAGAAGAATGCA
GAAAAAGCAATGAGGAAGATTAG
ccttaccaacaataaaggatattataaaggcttatgaattgaaacattttggttctggct
tatgaacagtcacactagtggaacagatgagcaggtctagggatagacccatggaactta
attagtgtgtgattatgataaaggaatggtaagtgtgatcaagaaaagctgaacttttca

Exon 21 +     140835     141033   0    Initial    199    69    Marginal
caaaggacatgaactcatccttttttatggctgcatagtattccatggtgtatatgtgcc
acattttcttaatccagtctatcgttgttggacatttgggttggttccaagtctttgcta
ttgtgaatagtgcagcagtaaacaactcagtaatttgaaatttaaaaaaagtttaactca
ATGATTATTGAGTTGAAAGTACTGAGTGCCATAGAAGAGGTACAGATAGAATTCTGTGGA
AACTTAAAGATACCTTTCACCTGGGAGAAAAGGACAGAGTATCCCAAAGGAGATGGGTTG
GGTCTCAAAGGGAATATAGTATTTGAACACCCAAAGGTGGACATTCCCAATCGAAGGAGC
AGCGTGAATCAGGGCAAAA
gtaggaaagcatgagatggtaggtatttcggtttgtctgaaagggttaccaagagaaaga
gtgaaatataaagatgtaaaagtaaatcagaatagacatagtgttgttagttgtcttttt
aaaatgtgtgtatcttgttttcccaattatgttataaactttgaagacaagtagtatgtc

Exon 22 +     142123     142241   1   Internal    119   100   Excellent
tccttttctttccaatagcatatgctaatccttttcatttttataaagcaaaatatattt
gacaaatgaaattggaagttacaactttcaaaagccatttattttagagattcttatggc
aaagcaattcattattttacaatatttgttttgttttaaactttctatattatgtgctag
GTGAAAAACCATTTCGCTGTGATGAATGTGGTATGAGATTCATACAAAAATATCATATGG
AAAGGCATAAGAGAACTCATAGTGGAGAAAAACCTTACCAGTGTGAATACTGTTTACAG
gtaagagagatggcttgaaattcttctactgtaattaaattatacaataattataaatta
gattagaaaatattacaacttagagctatttaaggggccttctaactcttacagattaga
tttataatagaaaattggctcagtgaatttgtttggaattatgtatgttattgcattaat

Exon 23 +     143798     144111   1   Terminal    314    90   Excellent
tgactgataaccagaccctcccaaatcagccagcattctcttccatagacaagcaggtct
atgccaccatgcccatcaatagctttcgatcaggaatgaattctccactaagaacaactc
cagataagtcccactttggactaatagttggtgattcacagcactcatttcccttttcag
GTGATGAGACAAACCATGCTTCTGCCACATCAACACAGGACTTTCTGGATCAAGTGACTT
CTCAGAAGAAAGCTGAGGCCCAGCCTGTCCACCAAGCTTACCAAATGAGCTCCTTTGAAC
AGCCCTTCCGTGCTCCCTATCATGGATCAAGAGCTGGAATAGCTACTCAATTTAGCACTG
CCAATGGACAGGTGAACCTTCGGGGACCAGGGACAAGTGCTGAATTTTCAGAATTTCCCT
TGGTGAATGTAAATGATAATAGAGCTGGGATGACATCTTCACCTGATGCCACAACTGGCC
AGACTTTTGGCTAA
aaaaaaaaaaaaagtgtaaataatactggcactttagaacagattaatcaagagtggggt
tactctgtgtaaatggagtgctgtacagatttaagagcaatgcgtaataacaagttaagc
tgatatgaatagcaagataatccaataactgcatttcgtttggttagtcagcattctttg

--------------------------------------------------------------------------------