--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (10959 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        495        703   1   Internal    209    96   Excellent
ccagtagtgttgactatacattagtgggctgagatgaggagcctccaaggaagctttagg
tctgggtgtttgctacacaaggaatgcatagctggacccaccttggtcatgctcttggtg
cctatgaggccaagctctggccagcccagcctaggatctcacgtcaccctcctcttctag
GTTGGGTGGGTGACGTAGACGACTACTCGCTGCACGGGGGCTGCCTGGTCACGCGCGGCA
CCAAGTGGATTGCCAACAACTGGATTAATGTGGACCCCAGCCGAGCGCGGCAAGCGCTGT
TCCAACAGGAGATGGCCCGCCTTGCCCGAGAAGGGGGCACCGACTCACAGCCCGAGTGGG
CTCTGGACCGGGCCTACCGCGATGCGCGC
gtggaactctgagggaagagttagccccggttcccagccgcgggtcgccagttgcccaag
atcaggggtccggctgtccttctgtcctgctgcagactaaaggtctggccaatgtcttgc
cccaccccgccagccgcgatacggcgcagttcctatattcatgttatttattgtgtactg

Exon  2 +       1240       1339   0    Initial    100    73        Good
atgagctggattgcgtgggacgaagggtcgtcattggacaaccgccgcgggcgccctggt
ctctgctacctgtagctgagggcgctgttgatgggcagcgcggcgcgctgggaaggctcg
ttctcgcgagagttcagctcccttcttagccgtggctgcctcagcacctcgaggatcgac
ATGGACGCTCTCGAGGACTACGTTTGGCCGCGGGCAACCTCGGAGCTTATACTCCTCCCA
GTGACGGGTCTGGAGTGCGTGGGGGACCGGCTGTTGGCGG
gtgaggcttggcttgaggcacgcctggtggaaagggggaaagaaacagcgcctcccaggg
gcggtgccacagggacaaaaggggtgccctgaggagaaggacgggcagcaggttgaggcc
gatcggaggtgggaagggagccccggagatggcggggacgagggccaacctgaagagggc

Exon  3 +       5443       5599   1   Internal    157    92   Excellent
caggcgtgagccaccgcacccggccgagaccaaggattttctaagattcaagctgcagga
ttgtgtgtcctgatgcattcataggctacatgccgagaagtttccctgatccccatctct
tccctgtgggtcatcagagttaggtacctagctctgacatggctctttgcctctatctag
GTGAGGGTCCCGATGTCCTGGTGTACAGCTTGGACTTTGGTGGGCATCTGCGGATGATAA
AGCGAGTGCAGAACCTGCTTGGCCACTATCTTATCCATGGCTTCCGGGTACGGCCAGAGC
CTAATGGAGACCTTGACTTGGAGGCCATGGTGGCTGT
gtttggaagcaagggactccgagttgtgaaaattagctggggacagggccacttctggga
gctttggcgctctggcctgtggaacatgtctgactggatttgggatgcacgctggcttga
gggaaatatagccttggccctgggccacaactcagtggtgctatatgaccctgtagtagg

Exon  4 +       8018       8101   2   Internal     84    76        Good
catgcacctttcgtcccaccggctagatgagtattgggaccggcaacgcaatcggcatcg
gatggttaaggtagacccagagaccaggtaatatatgctcctgggcagggtgtggtatgg
gtcatgcagatgctcccaggcttgcaggctccacctgacagctgcatgttgtctctgcag
GTACATGTCCCTTGCTGTGTGTGAACTTGACCAGCCCGGCCTTGGCCCCCTTGTGGCTGC
AGCCTGTAGTGATGGGGCCGTAAG
gtgagagcatagggcccagtgggacaggagacaaaggaagtaaggttgtctaggatgcgt
tctgagctgggccaccccccgccccccaggctctttcttttgcaggattctgggcggatt
ctgcagctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactccttt

Exon  5 +       8207       8307   0   Internal    101   100   Excellent
ccttgctgtgtgtgaacttgaccagcccggccttggcccccttgtggctgcagcctgtag
tgatggggccgtaaggtgagagcatagggcccagtgggacaggagacaaaggaagtaagg
ttgtctaggatgcgttctgagctgggccaccccccgccccccaggctctttcttttgcag
GATTCTGGGCGGATTCTGCAGCTCCTTGCTGAAACCTTCCACCATAAGCGATGTGTCCTC
AAGGTCCACTCCTTTACACACGAGGCACCCAACCAGAGGCG
gtgagaggggctggatgatggtcctgcatgggctgggttggggggttcctgttgagcttc
atctctgttattgaccaggctgtcttttcctggctctcaggaggctcctcctgtgcagcg
cagctactgatggcagcctggctttctgggatctcaccaccatgctagaccatgactcca

Exon  6 +       8408       8504   2   Internal     97    58    Marginal
ctccttgctgaaaccttccaccataagcgatgtgtcctcaaggtccactcctttacacac
gaggcacccaaccagaggcggtgagaggggctggatgatggtcctgcatgggctgggttg
gggggttcctgttgagcttcatctctgttattgaccaggctgtcttttcctggctctcag
GAGGCTCCTCCTGTGCAGCGCAGCTACTGATGGCAGCCTGGCTTTCTGGGATCTCACCAC
CATGCTAGACCATGACTCCACTGTCCTGGAGCCTCCA
gtggatcctgggcttccctaccgtgagtagctaatgtgcaaccatggctacccctcctca
cctgtcacatagccctcacacatgtggcaggcggggccctgacaactaccctcttcctct
tccttcagggcttggcaccccctccctgactctccaggcccacagctgtggtatcaacag

Exon  7 +       8662       9061   0   Internal    400    85        Good
actccactgtcctggagcctccagtggatcctgggcttccctaccgtgagtagctaatgt
gcaaccatggctacccctcctcacctgtcacatagccctcacacatgtggcaggcggggc
cctgacaactaccctcttcctcttccttcagggcttggcaccccctccctgactctccag
GCCCACAGCTGTGGTATCAACAGCCTGCACACCTTGCCCACCCGTGAGGGCCACCATCTC
GTGGCCAGTGGCAGTGAAGATGGATCCCTCCATGTCTTCGTGCTTGCTGTGGAGATGCTA
CAGCTAGAAGAGGCTGTGGGAGAGGCTGGGCTGGTACCCCAGCTGCGTGTGCTAGAGGAA
TACTCTGTCCCCTGTGCACATGCTGCCCATGTGACAGGCCTCAAGATCCTAAGCCCAAGC
ATCATGGTCTCAGCCTCCATTGATCAACGGCTGACCTTCTGGCGTCTGGGGCATGGTGAA
CCCACCTTCATGAATAGCACTGTGTTCCATGTGCCTGATGTGGCTGACATGGACTGCTGG
CCTGTGAGCCCTGAGTTTGGCCACCGTTGTGCCCTTGGGG
gtcaggggcttgaggtttacaactggtatgactgaggtatcctgcggtggctggcgtgct
gggcatggggcctgctcacagacagcatggagcagggatgggctgtctgtgcccatgctc
agcatgccttgaggggaggaggtggtggccgtgggttcctgatgtcggtgcaggagctga

Exon  8 +       9148       9243   0    Initial     96    78        Good
ttcatgaatagcactgtgttccatgtgcctgatgtggctgacatggactgctggcctgtg
agccctgagtttggccaccgttgtgcccttgggggtcaggggcttgaggtttacaactgg
tatgactgaggtatcctgcggtggctggcgtgctgggcatggggcctgctcacagacagc
ATGGAGCAGGGATGGGCTGTCTGTGCCCATGCTCAGCATGCCTTGAGGGGAGGAGGTGGT
GGCCGTGGGTTCCTGATGTCGGTGCAGGAGCTGAAG
gtgagtggagtgctgccaagaatatgcccgactccccatgacaagacagaactttgtaac
aaacagtaccaatttattttggccgtgggtttttgctttttttccagttgatgactttgt
gaacattcccaggtattggagcctctgtggccttaaatgtggctcagtggagggagaccc

Exon  9 +       9376       9500   1   Internal    125    95   Excellent
ggaggaggtggtggccgtgggttcctgatgtcggtgcaggagctgaaggtgagtggagtg
ctgccaagaatatgcccgactccccatgacaagacagaactttgtaacaaacagtaccaa
tttattttggccgtgggtttttgctttttttccagttgatgactttgtgaacattcccag
GTATTGGAGCCTCTGTGGCCTTAAATGTGGCTCAGTGGAGGGAGACCCAGCATAGCCAGG
CCAGTATGGAGCACCTCACGCACAGCTCTCAGAAGCTGCAGGCGGACGAACATCTGACCA
AAGAG
gtgtggtcgaggctcctgaaagagaaagggcctgctggtctcatcctctgcttcctttgc
ctttaccctatacctctctgcacgtcccaccccattttgctgtgtgctcacccccaggat
gtgtacccggttgtagtaggagctgaaatccatgctgagctgtaccaggaacttgcatat

Exon 10 +       9376       9755   1   Terminal    380    61    Marginal
ggaggaggtggtggccgtgggttcctgatgtcggtgcaggagctgaaggtgagtggagtg
ctgccaagaatatgcccgactccccatgacaagacagaactttgtaacaaacagtaccaa
tttattttggccgtgggtttttgctttttttccagttgatgactttgtgaacattcccag
GTATTGGAGCCTCTGTGGCCTTAAATGTGGCTCAGTGGAGGGAGACCCAGCATAGCCAGG
CCAGTATGGAGCACCTCACGCACAGCTCTCAGAAGCTGCAGGCGGACGAACATCTGACCA
AAGAGGTGTGGTCGAGGCTCCTGAAAGAGAAAGGGCCTGCTGGTCTCATCCTCTGCTTCC
TTTGCCTTTACCCTATACCTCTCTGCACGTCCCACCCCATTTTGCTGTGTGCTCACCCCC
AGGATGTGTACCCGGTTGTAGTAGGAGCTGAAATCCATGCTGAGCTGTACCAGGAACTTG
CATATCTAGAGACAGAGACTGAGTCACTGGCCCATCTCTTTGCTCTTGTGCCCCAGGCCA
GAATAAAGAATAGAGTGTAG
agtgtcctggttgtctatgcctcaccatctctgtgcgtacagcaatgtggagccccgggg
ctgtgcagtccagcactgctgtccggctcagcagatccggaaaggggaggatactgttga
agagcaacaaccactcaccctgttggggagaaaggtgctgggaggggaagtccaggcctc

--------------------------------------------------------------------------------