--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (13434 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1618       1741   0    Initial    124    64    Marginal
agggactggcggcagcgcggtcagagccagtcagccaaagccaggccagcacaatagact
gtcccggttcccgccaggaggcggccgagcaccaactgtacggtactgcgcctgcgccgc
gaccgccaacgcgcccagtctacgcttgcgcggcgcaacagggccgactgcagctggaag
ATGGCGGCGTCCGTGGTCTGTCGGGCCGCTACCGCCGGGGCACAAGTGCTATTGCGCGCC
CGCCGCTCGGTGAGGTGGTGGCGAGAGCGCGGGGCTTCGGGACAGGGCTTCGGGAAGCGG
ACAG
gtgtgggctgttagcagtggcaggtcgaggtggggaggacgcggggtcagggccgtggga
aggtcacggcggagggcggggaaaggtatctcgccgcttgcctaggggcggggttcgggg
gtcctcctgaggacctgggaggtggggagcgatcccctgaccgagtcctcactcgcggct

Exon  2 +       1847       2076   1   Internal    230    99   Excellent
tattgcgcgcccgccgctcggtgaggtggtggcgagagcgcggggcttcgggacagggct
tcgggaagcggacaggtgtgggctgttagcagtggcaggtcgaggtggggaggacgcggg
gtcagggccgtgggaaggtcacggcggagggcggggaaaggtatctcgccgcttgcctag
GGGCGGGGTTCGGGGGTCCTCCTGAGGACCTGGGAGGTGGGGAGCGATCCCCTGACCGAG
TCCTCACTCGCGGCTGTTCCCTTCCACAGCCGGCCCTGCTGCGGACGCCAGCCTTGCGGA
GTACGGCAACCTTCGCTCAGGCGCTCCAGTTCGTGCCGGAGACGCAGGTTAGCCTGCTGG
ACAACGGCCTGCGTGTGGCCTCCGAGCAGTCCTCTCAGCCCACTTGCACG
gtgagttggggacgcttttggggagagggcctccaggttgggcctgccgtcttttccctg
gttggggtgtgaccttgggctcgagtcttcccgtttgtggtttgggttcggacccaggac
cactcaccccgagaatggccccattccctaccctagccacgccttggcttcacgggacaa

Exon  3 +       5382       5468   0   Internal     87   100   Excellent
gcccctgttttccaagcatgactgtgtccccaagcacaggggtcctgctggggcagctct
ccctgactccaggattcataagtccctgcctggggcttgtactgagtcactcaggtgggg
tgtgagtagggggctggggagtggtttgtttgtaaccttttctggtggcttcttgaccag
GTGGGAGTGTGGATTGATGTTGGCAGCCGTTTTGAGACTGAGAAGAATAATGGGGCAGGC
TACTTTTTGGAGCATCTGGCTTTCAAG
gtgaggctcttaaagtctgtctcctctgggcttagggctgcctgttgtccctcctgagga
tgaaggtcagaaaaattagcctgattatgggcctcagttgcggggctgatgtctggctgg
ctttcctaaaaggagccacatgagcttaacctctcctgagtgggcacgtatctgatgagc

Exon  4 +       6458       6587   0   Internal    130   100   Excellent
tttggtcacctcaaggcctgcttagtgcttggtaaacagactctgggatctgtgtcccca
gagtctatgctgagggaggtacctgtggaccagtggtcctgctgggtgtttagcctctga
ggacagggttcttgggttcctgtgtagctcctgattgttctggttgatatctggttccag
GGAACAAAGAATCGGCCTGGCAGTGCCCTGGAGAAGGAGGTGGAGAGCATGGGGGCCCAT
CTTAATGCCTACAGCACCCGGGAGCACACAGCTTACTACATCAAGGCGCTGTCCAAGGAT
CTGCCGAAAG
gtaacacctggaggaagaggcggggacagagggcagggaagcagaggacagctacctagg
agcccctggctgaccacagaatcatattacccttagcgtatggctttgcagctgggcaac
taggggtgggcagcaggagatgccaggcctggggattttgtgctgtcgttggtctgcagt

Exon  5 +       6807       7005   1   Internal    199    97   Excellent
agcagaggacagctacctaggagcccctggctgaccacagaatcatattacccttagcgt
atggctttgcagctgggcaactaggggtgggcagcaggagatgccaggcctggggatttt
gtgctgtcgttggtctgcagtggtccacctggcacctaaacatgtcctccttgcatctag
CTGTGGAGCTCCTGGGTGACATTGTGCAGAACTGTAGTCTGGAAGACTCACAGATTGAGA
AGGAACGTGATGTGATCCTGCGGGAGATGCAGGAGAATGATGCATCTATGCGAGATGTGG
TCTTTAACTACCTGCATGCCACAGCATTCCAGGGCACACCTCTAGCCCAGGCTGTGGAGG
GGCCCAGTGAGAATGTCAG
gtgagagttggctggccttgtggggggatgcttgctccattctggcctggccagaccctt
tccaggtcacatttttagttggctagctgtcggggttattttcctgagttatgcaactgg
agacagtttctgtatccatgtggtccagtgagtcttttttaatggctttgtgggcttcac

Exon  6 +       7595       7674   2   Internal     80   100   Excellent
ctctgggccctggaggggtgggtggcagagacaggggaagggggttggggagtgtgctag
ggcccactcttcggagaaaccatgcctctcctagtctgcctcctcagtcccattcatgca
tgtaccccaactcactccagtgtggtagaggtgttgacacactgaccatatgtcttgtag
GAAGCTGTCTCGTGCAGACTTGACCGAGTACCTCAGCACACATTACAAGGCCCCTCGAAT
GGTGCTGGCAGCAGCTGGAG
gtgagtgatggaatcactgaagtcctgggtagtggggtcccagccttggttatcaaagcc
gaggtcctggttcccaccataggggacctttcaccccaggggactctgctcccaccctaa
ccttgaggggaatgaccttcctcctgtgctctctgaggtgggataggattctaccctgcc

Exon  7 +      10083      10263   2   Internal    181    97   Excellent
gcaggagtagtgctcagctgggggcctgtgggaggacccccatgtgcatggttatcctgg
tgactccagagatacctcagcagttgggaaggggttctgtggctgctgcatcacaggcac
acatgttcacacacatacaccctctacccacacctgccaccttttctgttcccctggcag
TCTGGCTGTTCCTCAGCCTTGTCATGTACTGTTTCAGATCCGCCACCGTGATGATGCTCT
ACCTTTTGCCCACGTGGCCATTGCAGTAGAGGGTCCTGGCTGGGCCAGCCCGGACAATGT
GGCCTTGCAAGTGGCCAATGCCATCATCGGCCACTATGACTGCACTTATGGTGGTGGCGT
G
gtgagtgccagcgcgagcatgggacctcgccttcagggaagagagggtgctggggctgtg
tgctcctgtgcgtgggggtcacagtgtgcgttgaagacaagagggtgggtgctgaccacc
tatccccctggcagcacctgtccagcccactggcttcaggtgctgtggccaacaagctat

Exon  8 +      10423      10558   1   Internal    136    95   Excellent
tgcacttatggtggtggcgtggtgagtgccagcgcgagcatgggacctcgccttcaggga
agagagggtgctggggctgtgtgctcctgtgcgtgggggtcacagtgtgcgttgaagaca
agagggtgggtgctgaccacctatccccctggcagcacctgtccagcccactggcttcag
GTGCTGTGGCCAACAAGCTATGCCAGAGTTTCCAGACCTTCAGCATCTGCTATGCAGAGA
CGGGCTTGCTGGGTGCACACTTTGTCTGTGACCGAATGAAAATCGATGACATGATGTTCG
TCCTGCAAGGGCAGTG
gtaagtggcagcctggtattcctaggtgggatggcggctttaaccagcacagtgggaggc
tgagagatgacacactggctcagaatgaataccacccacccccccactttaggatgcgcc
tgtgtaccagtgccacggagagtgaggtggcccggggcaaaaacatcctcagaaatgccc

Exon  9 +      11528      11603   0   Internal     76   100   Excellent
ctgtggagatgggcggggcccatggaggtctatagcagggatcccttctgcctttcctct
tttgggctggggacagctgcatgctgcctgtgggagatctctgctagttggatgatgctg
actggctgaggtggtggccaggtgcccgttagccagtatgccctctgcctcaccctgcag
GAGGTGGATGCCAGTGTGGTACGTGAGATCTGCTCCAAGTACATCTATGACCAGTGCCCA
GCAGTGGCTGGATATG
gtaagtggcctagggggtctgctctttgtttatttcctcaggccgttctcttggcctccc
cttccacctctgctcccgcactgctgctcagcttacagagcagccagttaaggccccaag
cagctctccccagtcccctggctgccagggagttcttgctcagaaaacctgtcccagcag

Exon 10 +      12046      12110   1   Terminal     65    88        Good
aagggccagaacatgaagggacaggctcagcacccctgggggaatgttctctcctctctt
tccactcaaagcctgtcttgtgctgctctgggcagcatctccgagctgggtgcggcacag
ggccaggtgtccctgtgcaggccaggtaccccaccctgacgctccaccctatccccacag
GCCCCATTGAGCAGCTCCCAGACTACAACCGGATCCGTAGCGGCATGTTCTGGCTGCGCT
TCTAG
gcgggaagcctatgtaagcaagagggcagggccggggtttgtggtcccccccccaccaca
aacacagcacttcggctcctctaacctgtgccacaggtgaccaccaataaaatcctctgc
tgagaagtgtgtcatccctcttttggcattggcatggagtccatggggcagtagatgggg

--------------------------------------------------------------------------------