--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (25510 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        956       1028   2   Terminal     73    45    Marginal
ggtgatatctctttaaatatggcattgctattatttgtaaacactgtcctttgttcaaat
agaattctatcaattcctctaacatgtggaaaaccatgtgaatctacttttctaattaac
catacccaagcctttcagtctacgaagacataatctgaagtccacttgtccaaattgcag
GCAGAACACCAAACAAGGAGAAATAGCTTCAGAAATCTACTCCATTATCCAAAAGGTGAC
AAATGACAACTAA
acttccaggatgctcattgcatcaccactcctctacagctggttccatggaagcatggag
tttccaccaacataccagctaccacccacaaggccgcatcctgctatctacctagcatgg
tagagagacagggattgtgacataagcaaataccctcagactgatatatgtaaatgccag

Exon  2 +       1492       1732   1   Internal    241    84        Good
ccactggagaactgatagcagtattctggtagaggaggcatcaagagtcctgggaggccg
gtggtaatcatgtaggcaccatggaaactgctatgtgcgtttgctgtccatgttgtacat
ggcagagatgttgtcctcagttatgctcctgtctgtgctgcaagttcatcttcacctcag
AGCGGAACTGCACCTGCTTCCCCTGCCCTTACAAAGATGAGCGGAACTGCCAGTTCTGCC
ACTGCACCTGTTCTGAGAGCCCCAACTGCCATTGGTGTTGCTGCTCTTGGGCCAATGATC
CCAACTGTAAGTGCTGCTGCACAGCCAGCAGCAATCTCAACTGCTACTACTATGAGAGCC
GCTGCTGCCGCAATACCATCATCACTTTCCACAAGGGCCGCCTCAGGAGCATCCATACCT
C
gtaagtgccaggcaccagatgtggggccgcattgggtcatgaaaactagggaccacttgc
cagctgtgaagtctacagggcaggccagtgagcctctgagttcatttctttatctaaaag
gaggagccaagaattttgtagcaattaattgtatcctaaatggtcactatgtatgtagac

Exon  3 +       5624       6321   2   Internal    698    96   Excellent
gtcaccccgctgaaaaacggtggagacagattgagaacgcaggcaccttagcgcccagct
caggctcctcaccaccacactagactgcccctcaggaaccaagagttctttcagaggtag
agaagcagagcaagctcttgagcctgcctcctgaaaccctgcctttgcttctcctttcag
CTCCAAGACTGCCCTGCGCACTGGGAGCAGCGATACCCAGGTGGATGAAGTAAAGTCAAT
ACCAGCCAACAGTCACCTGGTGAACCACCTCAATTGCCCCATGTGCAGCCGGCTGCGCCT
GCACTCATTCATGCTGCCCTGCAACCACAGCCTGTGCGAGAAGTGCCTGCGGCAGCTGCA
GAAGCACGCCGAGGTCACCGAGAACTTCTTCATCCTCATCTGCCCAGTGTGCGACCGCTC
GCACTGCATGCCCTACAGCAACAAGATGCAGCTGCCCGAGAACTACCTGCACGGGCGTCT
CACCAAGCGCTACATGCAGGAGCACGGCTACCTCAAGTGGCGCTTTGACCGCTCCTCCGG
GCCCATCCTCTGCCAGGTCTGCCGCAACAAGCGCATCGCTTACAAGCGCTGCATCACCTG
CCGCCTCAACCTGTGCAACGACTGCCTCAAGGCCTTCCACTCGGATGTGGCCATGCAAGA
CCACGTCTTTGTGGACACCAGCGCCGAGGAACAGGACGAGAAGATCTGCATCCACCACCC
ATCCAGCCGCATCATCGAGTACTGCCGCAATGACAACAAATTGCTCTGCACCTTCTGCAA
GTTCTCTTTCCACAATGGCCACGACACCATTAGCCTCATCGACGCCTGCTCCGAGAGGGC
CGCCTCACTCTTCAGCGCCATCGCCAAGTTCAAAGCAG
gtcctccccttttccactccttcagcctaacttctagttcaggaacacatggggaagatg
gcgtggggtaatctgttaagtgagtgccttaacagattccacctagtggagcaatcaagg
caccaggaaacactgtgctaccctgcaagtcactatcctggtgtccgctcctggcaacca

Exon  4 +      10884      11332   1   Internal    449    89        Good
taaggaggaccaaattcatttcataaacctattccagcctgtttcagcccaactacaagt
gccttccctccctcttcattcacctccttggagcctagggtaatttgttctagtttgcta
ctgactttgacacctggggagatgaaaattttaaaagtaactaacttggcatttttgcag
TCCGATATGAAATTGATAATGACCTAATGGAATTCAACATCTTAAAAAACAGCTTTAAAG
CTGACAAGGAGGCAAAGCGAAAAGAGATCAGAAATGGCTTTCTCAAGTTGCGCAGCATTC
TTCAGGAGAAAGAGAAGATCATCATGGAGCAGATAGAGAATCTAGAAGTGTCCAGGCAGA
AGGAAATTGAAAAATATGTGTATGTTACAACCATGAAAGTGAACGAGATGGATGGTCTGA
TCGCCTACTCCAAGGAAGCCCTGAAGGAGACTGGCCAGGTGGCATTCCTGCAGTCAGCCA
AGATCCTGGTGGACCAGATCGAGGACGGCATCCAGACCACCTACAGGCCTGACCCACAGC
TCCGGCTGCACTCAATAAACTACGTGCCCTTGGACTTTGTTGAGCTTTCCAGTGCCATCC
ATGAGCTCTTCCCCACAGGGCCCAAGAAG
gtacgctcctcaggggactccctgccctccccctaccccgtgcactcagaaacaatgatt
gccaggaaggtcactttcagcacccacagcctcggcaaccagcacatataccagcgaagc
tcctccatgttgtccttcagcaacactgacaagaaggccaaggtgggtctggaggcctgt

Exon  5 +      14130      14354   0   Internal    225   100   Excellent
aggcctcatcacacagtcttccaagacttgtgcatggtctaattaaaagtcttcggtagc
tacaggggatggggtcagcttaaactcaccccacagatagtcaacatcacaaatctttaa
gggaaagaaagctgaatgatgtatactagtaccacaccagtatgttcatttcttccatag
GTTTACTGGACATGTCCAGCAGAAGACGTGGACTCTTTTGAGATGGAATTCTATGAAGTC
ATTACTTCTCCTCCTAACAACGTACAAATGGAGCTCTGTGGACAAATTCGGGACATAATG
CAGCAAAATCTGGAGCTGCACAACCTGACCCCCAACACAGAATACGTGTTTAAAGTTAGA
GCCATCAATGATAATGGTCCTGGGCAATGGAGTGATATCTGCAAG
gtattgtgtgcgttatttctcagacagatttttttttctatggtaggttctggatgaggc
cctgttaagatgatcgtgagattatagaactcactatgggactcttcctctaagcacaga
acatttgttaacttgaggccaaagagagggctgctggcctcaaccagactttgcagatgt

Exon  6 +      22271      22303   0   Terminal     33    72        Good
agtagatatccttgtcttattcctgatattaacgtttctccattgagttattttttattt
agtttttatggtatataatccttattaagttaaggaaaattacttctaggtttctgagaa
ataggtacttattaaattttttgcattatttgaggtaattacatgatttttctccttcag
GCCATTATTAATGAAGTGAATTACATTGACTGA
tttttctgatactaaattccacttccattcatggaataaatcctgtgtgttcatgatgta
ttactttttaatacagtttacttcagttagctcgtattttattttggtttattgcatcta
taattataagggaattgggctcaattttttgcttatattgtttttatctggttctggaat

Exon  7 +      23282      23330   0    Initial     49    53    Marginal
ttaaaagctttgtacatagagactttgtgccctgtataaacattcctcttcaccatacaa
accccacccccattctatctcaagtcctcattcacctcagcagagcccattgatccagtg
gactgtctttcatccctgggtctcgacctcactccataaatatttatttggggggaagga
ATGGGAATGCTGCCAGACCACAGTAGTGAAGAAACCCAGTATCTTCAAG
gtaaggcatggagggcaacatctaagctaacttggtgagatttctaggagggttcttctt
acccctcgtgcccagtacagtctttctttttcaggtagcactggccattcactgtaatta
aagatagtatgaagtgtttctgctagcatcaaaggaaaacaactggcagatttacaaatt

Exon  8 +      23829      23954   0     Single    126    44    Marginal
aaagtcaaatgcattagctgaaacttaacaactgataaaagctgtgacagaaccaagttc
taatggctgaggaaggatacagaggatcctctatggtgaagctcacctgcggtccagccc
catcactgtcatcagcacttagtcacatgagctaccctaaagggaagtaggatctggcct
ATGGAATCACAATCCCAGGACACTATAGCTGTGGGGCTTTGGGAAACCTTCCTGGTCCTT
CTGAGCCTCAGCTTCTTCATCTATAAAGTGGCACCAACAGCCACTGTGGTGGTCGTGAGG
AGTTAA
tgaaatgatgtgtgtagtgtctgacatgcagaagggcccaggctactgggagctgttgtc
tattgggtgtcatgactcttcgcttctgattgcaggtggtaacaccagatggacatggga
agaaccgagctaagtggggcctgctgaagaatatccagtctgccctccagaagcacttct

Exon  9 +      24050      24136   0   Terminal     87    86        Good
ggaaaccttcctggtccttctgagcctcagcttcttcatctataaagtggcaccaacagc
cactgtggtggtcgtgaggagttaatgaaatgatgtgtgtagtgtctgacatgcagaagg
gcccaggctactgggagctgttgtctattgggtgtcatgactcttcgcttctgattgcag
GTGGTAACACCAGATGGACATGGGAAGAACCGAGCTAAGTGGGGCCTGCTGAAGAATATC
CAGTCTGCCCTCCAGAAGCACTTCTGA
gccccttcagagcaggaaacaacctcagactcatcacaaagtagacatatacacacacat
atatgtatgtatatttttctcaccacattcttcaaggaggttgtagacaaatgtttccat
gacctctcagctttccaacaggaatcttgtaagagctaataaaaggaaatacctgacatg

--------------------------------------------------------------------------------