--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (24508 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2624       2686   1   Internal     63    50    Marginal
tttttaaaaattccttttttgtcctcacgatcaatggtatttgcgtttagggtctgccaa
caaggtcgttcatgaaagtgtttttctctttaaggtaattaaaaaacagtggaatggaaa
aacagtgctgtagtcatcctgtaatatgctccttgtcaacaatgtatacattcctgctag
GTGCCATATTCATTGCTTTAAGCTCAAGTCGCATCTTACTAGTGAAGTATTCTGCCAATG
AAG
gtaagttaagacttggtatatgcatggagcacttccatctaatcacacatctctctcttg
cctttggttctgttatatataacatggaaataataatgccttttgcttcatgtgagtgat
aaagcatatttaaatttgattatttaaccttgcattcctcaacaagaaaaaatgtttgat

Exon  2 +       8324       8422   1   Internal     99   100   Excellent
ggatagctaatacattaggtgaattgattaaaaaatccaaaggagcaaaggcaactggaa
gaaacttaatataaccagtagtaaatccagcttttaaattttaaaacaattatgttatac
tgtatataaacatacatggaataaaatatatagttaaaaaacatttctgttacatttcag
AAAACAAGTATGATTATCTTCCAACTACTGTGAATGTGTGCTCAGAACTGGTGAAGCTAG
TTTTCTGTGTGCTTGTGTCATTCTGTGTTATAAAGAAAG
gtaagtcttgaaatggtactatatacttgttaatcataggaccaaaaaatgttagaactg
gaaggaacattttgtatcatttagcttagtccattaaattttatatgaggaagctaagat
acaaacataagtatgttttagaggtggagaaacaagctcaaagagaaagtgttaatgcag

Exon  3 +      17622      17748   0    Initial    127    68    Marginal
ttgtcttttactcatagtttatcatttatgtaatctttatgtagtgacaacagtgaggtc
acctggcaaaaacatgtttaggaacagagattctgtgggcaaacaattcacttgggagga
gaggccctcaggaagagtagccttctagccacaggcattcggctctgagcatccattact
ATGTTTTACCGAGGCAGTGGAGAGATGAGTGAAGTGAGCTTCCACTGTTTTGTATCAGTT
AAACTGAAGAACAAATTGGGCCTAGCAGACTCAGTTGTCATTTCAGATTGTCAGCTGACT
TTACAGG
gtaatttattaagctttattttctttcctaaaaatctaccatttttaatttttagcttaa
tccttaataaattttacgttccttagagcattaccttgaatgagtaattgtttacagaag
gtgttgtttagcttaaggatttctttcttttttcttaatattagtgaaaaatgtatagct

Exon  4 +      20219      20479   0   Internal    261    95   Excellent
gggaaccagctcactgaaagcatcttcatacagaacagcaaactctatttctttggcatt
ctgtttaatgggctgactctgggccttcagaggagtaaccgtgatcagattaagaactgt
ggatttttttatggccacagtgcattttcagtagcccttatttttgtaactgcattccag
GGCCTTTCAGTGGCTTTCATTCTGAAGTTCCTGGATAACATGTTCCATGTCTTGATGGCC
CAGGTTACCACTGTCATTATCACAACAGTGTCTGTCCTGGTCTTTGACTTCAGGCCCTCC
CTGGAATTTTTCTTGGAAGCCCCATCAGTCCTTCTCTCTATATTTATTTATAATGCCAGC
AAGCCTCAAGTTCCGGAATACGCACCTAGGCAAGAAAGGATCCGAGATCTAAGTGGCAAT
CTTTGGGAGCGTTCCAGTGGG
gtaagtttgtgagggtgttcctttttgcttgttcttcccaaatttaaagcatagttaatt
caaggaaaaaaataaaatcagtactgatttgtcaaagaatgtattggatctctgactttt
aaaaccgaatcaacaaacattccttttactcctgatgtttgcaagggctcataatcaatg

Exon  5 +      21824      21889   0   Terminal     66    94   Excellent
ttttttatcctctcatacttctatagttaactttccaagaacataagtatttatttaatt
tgaccagattatatctatagcttaatgaggtaagaccagtgatttgttagtaaggttttc
cctttaaaaatgctacatttccagttttgttctaattactgctttcatgtttccttttag
GATGGAGAAGAACTAGAAAGACTTACCAAACCCAAGAGTGATGAGTCAGATGAAGATACT
TTCTAA
ctggtacccacatagtttgcagctctcttgaaccttattttcacattttcagtgtttgta
atatttatcttttcactttgataaaccagaaatgtttctaaatcctaatattctttgcat
atatctagctactccctaaatggttccatccaaggcttagagtacccaaaggctaagaaa

Exon  6 +      23421      23504   0   Terminal     84    75        Good
gtgatatccacaataatatgactggcaagaattggtggaaatttgtaattaaaataatta
ttaaacctatgtcttgtgttgccactctgtcatttagggtgggatgtagagtacttttaa
tcttaaaaaatagagtgagacaaaaacctacacaacttttaaaactttctctttaagtag
ATCTTTACTTCTAACAATAACAAAGGCATTTTCATCAGTTATGTGAAATACGAAGATTAT
ATCTATTATGGCGATTTATTTTAA
aggtaagggaaatgaggtacagcaggacctttctaggaaatgtggcatacaaaacatttt
tatctcataaaacataaaaattacaaaaatattcttacaaaggtatcacatacagaatac
attaaatagcagatttcagtagtgcatggagattgattttcttatttacgattacttttt

Exon  7 +      23992      24135   0     Single    144    50    Marginal
tctattcaacccagcaatccctctactgggtacctacccaaaggaaaataaatcgtttta
tcaaaaagacacttgcagtggtatgtttatcacagcagtattcacagtaacaaaatcatg
gactcaacctaagtgtccatcagtggtgcctggaataagaaaatgtggtacatatacacc
ATGGAATACTTTGCAGCCATAAAAAATAATGAAACCATGTGCTTTAAAGCCACATGGATG
CAGCTGGAAGCCATTATCCTAACTGAAATAATTCAGAAACAGAAAATCAAATACCACATG
TTCTCACTTATAAGTGGGAGCTAA
acagtgggtacatgtggacacaggattccaaagtgagaagggtggtgtattagtccattc
tcatgctgctacaaagaaatacccgagactgggtaatctataaagaaaaggggtttaaat
gactcgcagttctgcatggctggggaggaggcctcaggaaactcacaagcatggctgaag

--------------------------------------------------------------------------------