--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (33031 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2438       2576   0   Internal    139    68    Marginal
aaggcgaaggttatggaatgatcacttcactactgtttcaacttctctctagatatgata
ctttaaaaaaaaacttaaaaatataaaggatatagtgtccttgctcccttatacgtggtt
tctaaactcacccacccctgtacacacaatcatataagttgatcaatctgtgccctgtag
GGTCTCACCTTTAAGTTCTCATCTGGTGCAACTTACTCTGCTGAACATTCCTTCATGTCA
TTAGATGGCATGGTTAGCTGCACTGGCTTTGGAGTCAGCCAGACTTGGATCTGGGTTCTA
GCAATGCCACTAAACTGCT
gtgaggcctgggttaagttatttaactgagctttgggttttctctattgtgagaaaacaa
aaacatattaggatacaatataccctttataggcaaagaaacttgggctcagtgatataa
tatgggatattcagggattatactagtactttagagttagggagtaattaaatgagatta

Exon  2 +       8776       8844   0   Terminal     69    88        Good
gcacaaaaaaatgctaaactaagtatccgtatgcatgatgtgatttctctaagatagtta
gacatgtaaatatgagttcaaggggatgaatgttctgccccttttctacacagtttcatt
gtaactacatggagttggggagttggggagaaaataatggcccttatcctacaactctag
GCTGAACTAGATGCAAATCCTGAAAAGTACCCTTCCCTGGATGTTGATGCGGAACATGAT
AAAGGCTAG
ctaatgcctcttatatgagtatttttgtcaccatggcaacatccaacagagctccccatc
tctttattactggtatcttattttaccgctcccaatgatataatggctctatcttggcgg
ctcccttccgtcagcagctattctagttctcagtcctgattctgaatatatatacatacg

Exon  3 +       9557       9668   0   Internal    112    95   Excellent
ggctcacattcttgtatgaacaacacctgccagcctggagcacagggcatactgcaaatc
gatattgaggggaaagaaccagcctgtggagcctgtaagaagtttaagctgcagcctgac
agaaagatgggaaactaaaattgcctggtgtttccctgccctgtgtctcgccccctgcag
GTCACTGGGACCCTGGTTTTCACTGTCATCACTGCTGTGCTGGGTTCCTTCCAGTTTGGA
TATGACATTGGTGTGATCAATGCACCTCAACAGGCAAGTGAAATATGTAGAA
gttctctttttggcaagttctgtcagtgatagatatcatatgttcctcatacacagagat
aaagggtgtccacgtgggagacacaaggccatcctggcctgtcaggtacgatgtgcactg
ttccaaagctgataacttggccttgactccctaattaacaatcacgggggaaaaaaaagg

Exon  4 +      10388      10561   0     Single    174    47    Marginal
cataggtgacccaaagtaaaataatgtaaaactttagaataatattcaagaagctcaaca
aagtttggattttctccacgatgactccttgggtgaatttttaatcaagttatttcaacc
atttttctcatatatttcgtgcatccctattctggtattcagtgaatacatgggagaggt
ATGTTATTCTCAGCTCCCACAGCCCATAAGTCGGGGAACCAGGACTTCATTCCCCTCTGC
TCTAACTCAGACTGTGAGGTCATTGAGGGCAAGACTGATGAATTGTTCCTCTTCCTATCA
CTGGTGCCAAGCACAGTAGTTGGCATAAAGAAGGTACTCAATAAAGAGGGGTGA
attaatgaaagacagagaagaggaacctggggaagaggtggcataaagtgaaggtacaaa
cattttttcggtgccttctgtaagtccattatatttcctctgcttcttttagaacattga
gccccaaggaaaatgaaagatactgcagggtgtggatatgtgaaatatgcgctgaccata

Exon  5 +      10674      10810   2   Internal    137    85        Good
tcctcttcctatcactggtgccaagcacagtagttggcataaagaaggtactcaataaag
aggggtgaattaatgaaagacagagaagaggaacctggggaagaggtggcataaagtgaa
ggtacaaacattttttcggtgccttctgtaagtccattatatttcctctgcttcttttag
AACATTGAGCCCCAAGGAAAATGAAAGATACTGCAGGGTGTGGATATGTGAAATATGCGC
TGACCATAATCCATCACCTGAAAAGGGCTGCTTCCTGCTGAAAGACGTGCTCCGATTAGG
TGCTACAATCATCAGGA
gtgtggcaggctgagagatccagggcatagtgctgggggtcaagagacaagggtcatatc
ttttttgtgtgggtgatgacaacacatgccaatttagcaggtttcctggaatttaacatc
atttaacaatttaacattcaacatcaccatgacttgattaatagagccccttctcttttt

Exon  6 +      13449      13683   0   Internal    235    99   Excellent
aatttataacctttcttttataggatatggccaactgtaaacaaatctatccatgtttat
atgtatataaaacacataattgagatggtactatttaaacacgtaacaaacactttaaag
acaaaaacaaaaatacatagaatgtttgaaatagtaaagctatttttctttatctcctag
GTAATAATATCTCACTATAGACATGTTTTGGGTGTTCCACTGGATGACCGAAAAGCTATC
AACAACTATGTTATCAACAGTACAGATGAACTGCCCACAATCTCATACTCAATGAACCCA
AAACCAACCCCTTGGGCTGAGGAAGAGACTGTGGCAGCTGCTCAACTAATCACCATGCTC
TGGTCCCTGTCTGTATCCAGCTTTGCAGTTGGTGGAATGACTGCATCATTCTTTG
gtgggtggcttggggacacacttggaaggtaggcaaatttcataaataagcataaacaga
aactttcatattttcattttcctaacacttgtttagaaaaatattatctttcttcttgtg
gaatagctttagagttgttttttcaactcatgaccctatgaggcatatcagtgttagatc

Exon  7 +      15230      15340   0    Initial    111    51    Marginal
attaaattacgttctaaaatatgcacaaatcatttagcaactactgatattttatactac
ttctcattcctgaagaaaaaatgtaaaccctggttgcctctcatttagaggtaagattct
gatgagttcagtgacttaacctaaaacatttaattagtgttaacatttaattaacattta
ATGGAGCCAATATACAAACCCTCTGAAGTCTTAGGATTTGGCATCAACAATGGTTATACC
CCAAAACAATGTCAAATGACCACGTATCAAATGACCTATGGTAAACAAAAA
gtgaggtttctcctagcttttagtaataaaatgatcccccttgaaaagcagcccaaaagt
ccataacttcaacatcaaaattaagacaaagttatcagtatccccataaaattatctttc
tagagagattcattgagaagtgacatgattttcattattaccagtgtcatttatctacca

Exon  8 +      16857      17009   0   Terminal    153    51    Marginal
taaggctggttccttctggaggctttgagggaagaatgcattccttgcccttttccagct
tgcagtgaccaactatagttctctggcttgtggccccttcttccatctttgaagcacaac
attctaatctctacttctgtcatcatatcacctgctcctcttctaccttactcttatcag
GACATTTGTGATTACATCATTGGATTCACTCAGATAATTGAAGATAATCTCCCCATCTCA
AGATTCTCAATCACATCTGCAAAACCTCATTTGCTATGTGACGTAACATTTACAGAGTCT
GGGGATTATGCTGTAGGCTGCCAGGGGACATGA
tttagcctatcacgtggatgttggacaatcactgcagtatgtgactttatagttttatgc
tccagaaaaaaaaaattctgtttggttggtgttaaagatacttgcatggaaaaggcccac
ctatcaaagtttgaagcagtgaaatagaatataacaaggacgtttacatttcttttggca

Exon  9 +      19842      19908   2   Internal     67    53    Marginal
ctattctgagcattaaagttcctaaaaattataggaaatataatttgacttcaagttcat
gtgacttcagacctgtgagcttatctacattattctgtttttcaggtatagtattagcta
ttacagaaagatagtacaacttagaattgagccaaataaatgatttttttcttacttaag
ATCAACAGGCTACACATTAAAAGTCACCTGTAAAATTCAGCTGAAATACAGATACCTTAT
CACACAT
gtaaatgttcatttgagacattaagaacaatttgaagcattaaaaaatatattttgaaaa
caattgtcaaagcatcttttacacaaagatcatccatttcaatttgataggcaggtagtt
tctaagaagaagcctctgcaaatcctatttttaaatagttaagaaaatgccaaacattta

Exon 10 +      20917      21032   1   Internal    116    88        Good
tatgaggtcatatcaaatatctcctgcacaaactatgtctatacctaggaacaagggttc
atccttccagtgaattcagggaggggctttcattcaagatatatactgtacttaaaccaa
attgttattattgagatagtcctggttgcactttaacatttatgtttatgtttcatgcag
GGCTAATTTCAGGCCTGGTTCCTATGTATATCGGTGAAATTGCTCCAACCGCTCTCAGGG
GAGCACTTGGCACTTTTCATCAGCTGGCCATCGTCACGGGCATTCTTATTAGTCAG
gtaaaaactccccatccttatcccctactgcacccatctacttcatcctctacagtacca
ctactactattgcatcccctactgtacttcctccacttcatccatctcgtccctccctga
ctgtccattctcactgtagaccagcacagagagaaaagccaattctaccagtggtagtgg

Exon 11 +      22075      22237   0   Internal    163   100   Excellent
tataacaaatagttcctaatttagttaaagtgagatacaatagtaacagtttccgttttt
acttgaaccaaagttgtcagagactactattaaatagccaaagtactttttcaacaaact
agtgtaaaaggtagatccaaagtattatgtagttgatatacttcctccttgcattttcag
ATTATTGGTCTTGAATTTATCTTGGGCAATTATGATCTGTGGCACATCCTGCTTGGCCTG
TCTGGTGTGCGAGCCATCCTTCAGTCTCTGCTACTCTTTTTCTGTCCAGAAAGCCCCAGA
TACCTTTACATCAAGTTAGATGAGGAAGTCAAAGCAAAACAAA
gtaagtctgtggatggtttttctttcttcctattgttttggcattatcagctaatgtaaa
acagtgctttccacatgaagttggtgattaaatgtaagaagaatgtgcaaaatcgctttt
atatgactggtgcatgtcatttggcacccataggcattcacttaagccgaaaccagaaat

Exon 12 +      22708      22895   1   Internal    188   100   Excellent
gttctatttttcttttaaatcaaagagcaggatctaatttaacaaaaaaagaatttccaa
cacccatgctattaagtaatacaatggggcatgcagaaatgtagctctttcattaacata
aaaataaatttctttttgttttggcctgagttgtttcaacctgatcattttcttggacag
GCTTGAAAAGACTCAGAGGATATGATGATGTCACCAAAGATATTAATGAAATGAGAAAAG
AAAGAGAAGAAGCATCGAGTGAGCAGAAAGTCTCTATAATTCAGCTCTTCACCAATTCCA
GCTACCGACAGCCTATTCTAGTGGCACTGATGCTGCATGTGGCTCAGCAATTTTCCGGAA
TCAATGGC
gtaagtttaagaacacccactaactcttaagagcacagtgaattaaaatagggaaggcaa
ggggtacaagtttaaatagctaaaagatattttaaggtattggcatcatgggtcttgcta
taacaaacgtacattgagtaagcattaatttccattttgcttcaaaagttttctaaaatt

Exon 13 +      27553      27631   0    Initial     79    40        Poor
atagaaatatgcactgaatatattaatgtttcaccaaattggaagaacatcagtttgttt
ttgggaagagagactttcccaactccacactaattgtgttccacatcctatattttcttc
cacactaatgggctggtagaagagggcctgtaatcttgagagaaaaaaagcagaaagaaa
ATGGAGGGATCTAGGAAGCAGGATGACACTGAGAAAGAAGCGGTGACTACCAAATTGGAA
CTAAGAGCCCAGGATTTGC
gtgaggccctggggcaaagatgagcgttctaattgggaagacatctccagccactgacca
tgtctcactccttgtcacactcatcctgagtgtacaccaggcctcagggacagaggccaa
ctcaattttcaagatgttcagttttagagtttatagtaagggagcttattcacaaagaaa

Exon 14 +      29014      29115   0   Internal    102    95   Excellent
gccacctggggctagagtcactccccaccttgatctcactcctgtaaaatggaaggatgg
aattgcctcttatctgttatataaattaaaatgacctctttggcagtaaaaatgatttaa
gtaaacagtcaatattttgtgactcacaaaactgagataatttctttaaaattgtcctag
GTATTCCTTGTGGAGAAGGCAGGGCGACGTTCTCTCTTTCTAATTGGAATGAGTGGGATG
TTTGTTTGTGCCATCTTCATGTCAGTGGGACTTGTGCTGCTG
gtaagtttggtgcctgcactgaggtttttcattaacatatgatggtacctggcacctctg
tggtccaggttaaagtgctttgtattcaaaaatatttgagactgacttacgaaataaagc
cagagcaacagcataaaatcaaaggagatatataaagaaaagatgaactagtttcttggg

Exon 15 +      29784      29987   0   Internal    204    91   Excellent
aaagagttatgcatgattcagactagaataatttctctcagaatagaataacttatactt
gcttgaacaaaatacattagaaaaagttgtatgccgcctgtgaactcagaggctacttag
ctaaaggaaaaagcagccaaatgatctcagtcccactattgtttttgtttttttcctcag
AATAAGTTCTCTTGGATGAGTTATGTGAGCATGATAGCCATCTTCCTCTTTGTCAGCTTC
TTTGAAATTGGGCCAGGCCCGATCCCCTGGTTCATGGTGGCTGAGTTTTTCAGTCAAGGA
CCACGTCCTGCTGCTTTAGCAATAGCTGCATTCAGCAATTGGACCTGCAATTTCATTGTA
GCTCTGTGTTTCCAGTACATTGCG
gtaagcagcctaatattccacagatttactgaacagaagagagggtcaaaaaactgctaa
ctcaaagtctgtgtttgctttctatccaggacttctgtggaccttatgtgtttttcctct
ttgctggagtgctcctggcctttaccctgttcacattttttaaagttccagaaaccaaag

Exon 16 +      30077      30277   0   Terminal    201    76        Good
tcaaggaccacgtcctgctgctttagcaatagctgcattcagcaattggacctgcaattt
cattgtagctctgtgtttccagtacattgcggtaagcagcctaatattccacagatttac
tgaacagaagagagggtcaaaaaactgctaactcaaagtctgtgtttgctttctatccag
GACTTCTGTGGACCTTATGTGTTTTTCCTCTTTGCTGGAGTGCTCCTGGCCTTTACCCTG
TTCACATTTTTTAAAGTTCCAGAAACCAAAGGAAAGTCTTTTGAGGAAATTGCTGCAGAA
TTCCAAAAGAAGAGTGGCTCAGCCCACAGGCCAAAAGCTGCTGTAGAAATGAAATTCCTA
GGAGCTACAGAGACTGTGTAA
aaaaaaaaccctgctttttgacatgaacagaaacaataagggaaccgtctgtttttaaat
gatgattccttgagcattttatatccacatctttaagtattgttttatttttatgtgctc
tcatcagaaatgtcatcaaatattaccaaaaaagtatttttttaagttagagaatatatt

Exon 17 +      32029      32080   2   Terminal     52    47    Marginal
catttgggccaatttgggataaactattttcacttgggatttcaggatacagtcaaaata
agcttaaataactcaggacatctttgtgctaaactgtgaactctggacaaaaatagagag
tctctgaatagggcaggagcaggaaaatggctcctgggtggctcttgtatgcttcttcag
GATGCTGATGGCCTTTGGGAAGCCCAGTGTAAACAATGATAAAGGAGCTTAA
cacttttataggtgatacatgtgatttaatcaaatcactattcctgatctcatttactaa
cagaataaagtggtaaatatttaaattaaaaattccaaagaccacttttaagtgcttctt
cactattttgactggcccacaaacaccagaaattcagaccctgaagttttctgcctcaga

--------------------------------------------------------------------------------