--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11205 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (21 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1206       1322   0    Initial    117    96   Excellent
ggccggtttgtccgccctgtgttgtttaaaggggatagacgaccttggagcgccccgccc
cctcccgccaaggaaggaccccattggctctccccggaggcttcactctcattggtcagc
gagtgaatgccgacctgcagactggggcctaagtttcttttagtttccggtgtctctgca
ATGGCGGCTCTAGACTCCCTGTCGCTCTTCACTAGCCTCGGCCTGAGCGAGCAGAAGGCC
CGCGAGACGCTCAAGAACTCGGCTCTGAGCGCGCAGCTGCGCGAGGCCGCTACTCAG
gtgcgagcccctctgcccccggcctggtttgcagaccatgctgcaacgcagcgcggggcg
gggtccagatcccgacctgccccgtttgtcccgccctttcctctcactgagcgcggggct
tctctcttgacccctctgacctcaggctcagcagaccctgggttccaccattgacaaagc

Exon  2 +       1933       2076   0   Internal    144    94   Excellent
gcctatggtgagactgacacgggaactgtcagggtctgaggggggatccactctcgacac
gtgcttctttcttccctgtgttctctagggtggtggtgccagggcttaacttttcaggag
gccagactatccttggagtttcatgagattaggaccctgtctgtccacttcttggagcag
AGATGCCACAAACTCACGGGCTCTTTCTTCTCAGCTGCCCTTGAGTATGTGCGGAGTCAC
CCCTTGGACCCCATCGACACTGTGGACTTCGAGCGGGAATGTGGCGTGGGTGTCATTGTG
ACCCCAGAGCAGATTGAGGAGGCT
gtgagtctttccccaggcatcgtctgcctccccagtcctggccatggaaaggagtggctc
agtttccctcctcaggaagacccagagtgagggtgtgggttcccagaatatctctaaagg
tggctttcctgaaccacatggtttggctttctgcaggtggaggctgctattaacaggcac

Exon  3 +       2233       2308   0   Internal     76    94   Excellent
accccagagcagattgaggaggctgtgagtctttccccaggcatcgtctgcctccccagt
cctggccatggaaaggagtggctcagtttccctcctcaggaagacccagagtgagggtgt
gggttcccagaatatctctaaaggtggctttcctgaaccacatggtttggctttctgcag
GTGGAGGCTGCTATTAACAGGCACCGGCCCCAGCTCCTGGTGGAACGTTACCATTTCAAC
ATGGGGCTGCTGATGG
gtgagcagggcctggaacggggctatattgttctctctggtcatgccttttcttctgggc
acgagtgagaaggaggtgggggaaggaacaggagtgacttaaagtggtctggctgggctc
aggctctggttctggtggtcagccaggacctttccttgggaaagaggtggggggagtact

Exon  4 +       2530       2594   1   Internal     65    98   Excellent
catgccttttcttctgggcacgagtgagaaggaggtgggggaaggaacaggagtgactta
aagtggtctggctgggctcaggctctggttctggtggtcagccaggacctttccttggga
aagaggtggggggagtactcttttttgcctttctgcagctccttgtgcctatgcttctag
GAGAGGCTCGGGCTGTGCTGAAGTGGGCAGATGGCAAAATGATCAAGAATGAAGTGGACA
TGCAG
gtgagcgtgcttcactaagctgaagctggcaaagactctggcatgaacagagcctggaat
ccactaagggataaaaggcaggaagagggctgggcatggtggctcacgcttctgatccca
gcactttgggaggctgaggcaggaggattacttgagcccaggagttcaagaccagcctga

Exon  5 +       3467       3520   0   Internal     54    99   Excellent
caagagcaagagcattttaagctagcagacccacatgagaagagatgggatgggctaggt
aggttttttcagtcagtgctggtagataggccaggaagccttgggttggtgggtaggatc
agtcaggggctccttgaaagaggatactcctgcctctgcctgattctggtctctgctcag
GTCCTCCACCTTCTGGGCCCCAAGTTGGAGGCTGATCTGGAGAAGAAGTTCAAG
gtagggatgggcatggccctgagtccctgagggtgaggtgaggtatggtgagacttcagg
ctggggaaggaagtgtctgaccacagggatcccaagaccctatccaagagaaaatttgat
gccattttctgaagcacctggggcttctttcaggtggcaaaagctcggctagaagaaaca

Exon  6 +       3674       3734   0   Internal     61    77        Good
gaggctgatctggagaagaagttcaaggtagggatgggcatggccctgagtccctgaggg
tgaggtgaggtatggtgagacttcaggctggggaaggaagtgtctgaccacagggatccc
aagaccctatccaagagaaaatttgatgccattttctgaagcacctggggcttctttcag
GTGGCAAAAGCTCGGCTAGAAGAAACAGACCGGAGGACGGCAAAGGATGTGGTGGAGAAT
G
gtgagaagcttgagactcctgtcacagcattcagctccctgacttctgaacctcctcaga
agagtccttacaggctcctcaggcccttggcttactcagtaccctgacttctgtctcaag
actgggattcctggtgtttcttttgttccctttgcccagagactggcatgagaggcctca

Exon  7 +       4040       4111   1   Internal     72    89        Good
gattcctggtgtttcttttgttccctttgcccagagactggcatgagaggcctcagatgt
ctggctctagatatcttgtctctggaattgagggaataggggtctactcagttctgttct
ggctgtaggatatggtaaatgtatctagaggacaagttttccttgttttgttccccacag
GCGAGACTGCTGACCAGACCCTGTCTCTGATGGAGCAGCTCCGGGGGGAGGCCCTTAAGT
TCCACAAGCCTG
gttagtgggcatgtcaaaaccctggggagggctggatcttggcagcagctcctatagtca
ggcccctggggtcagaggctttggctgcagcctggtccttaggcttattctggtcctggc
aggtgagaactacaagaccccaggctatgtggtcactccacacaccatgaatctactaaa

Exon  8 +       4234       4319   1   Internal     86    78        Good
cagaccctgtctctgatggagcagctccggggggaggcccttaagttccacaagcctggt
tagtgggcatgtcaaaaccctggggagggctggatcttggcagcagctcctatagtcagg
cccctggggtcagaggctttggctgcagcctggtccttaggcttattctggtcctggcag
GTGAGAACTACAAGACCCCAGGCTATGTGGTCACTCCACACACCATGAATCTACTAAAGC
AGCACCTGGAGATTACTGGTGGGCAG
gtgtgtggggatgtggccatgtgagcttgtgccatcaaacacctgcctgagtgcctgggc
tgcgtccatactgccccatctcacccatcaccatggccttcctgggagggaacatctgtt
tctttaaggtcatctgagctcagactttatttctcttttcccatcccccttattttaggt

Exon  9 +       4498       4584   0   Internal     87   100   Excellent
aggtgtgtggggatgtggccatgtgagcttgtgccatcaaacacctgcctgagtgcctgg
gctgcgtccatactgccccatctcacccatcaccatggccttcctgggagggaacatctg
tttctttaaggtcatctgagctcagactttatttctcttttcccatcccccttattttag
GTACGTACCCGGTTCCCGCCAGAACCCAATGGAATCCTGCATATTGGACATGCCAAAGCC
ATCAATTTCAACTTTGGCTATGCCAAG
gtaagcatgtgtctagggacctggcaagcaagatgaccacttgctgttcccatgagtgga
taccatatccctgccttgctgtctgctcccaataatgtacccaggtgggcagaggccatg
gaaaggaaccacatgtgtgacagatacctaggaatctattgagcttattggaataaatag

Exon 10 +       5481       5559   1   Internal     79   100   Excellent
accaaccctgagaaggaggaagcaaagttcttcacggccatctgtgacatggtagcctgg
ctaggtatggactaggcaaagcctagaagggctggtggttagtgggcctctccttgggcc
atggcctgcccactgggtgtttgtggctggctgctcatactttgtttcattttgccccag
GCTACACACCTTACAAAGTCACATATGCGTCTGACTATTTTGACCAGCTATATGCGTGGG
CTGTGGAGCTCATCCGCAG
gtaaggccagggccatgacgtagagccaggcagactgactaggtcacagccatgctgggc
actcacaccgcttccccacaggggtctggcttatgtgtgccaccagcgaggagaggagct
caaaggccataatactctgccttcaccctggagagaccgtcccatggaggagtcactgct

Exon 11 +       5641       5749   2   Internal    109    56    Marginal
tttgtttcattttgccccaggctacacaccttacaaagtcacatatgcgtctgactattt
tgaccagctatatgcgtgggctgtggagctcatccgcaggtaaggccagggccatgacgt
agagccaggcagactgactaggtcacagccatgctgggcactcacaccgcttccccacag
GGGTCTGGCTTATGTGTGCCACCAGCGAGGAGAGGAGCTCAAAGGCCATAATACTCTGCC
TTCACCCTGGAGAGACCGTCCCATGGAGGAGTCACTGCTGCTCTTTGAG
gtggggtcctagaggagcatctgggtttgggtgggccaaggtgctgagaatgagatgctc
ctgtgcttagagacagcctgagtccttgttcccctcaggcaatgcgcaagggcaagtttt
cagagggcgaggccacactacggatgaagctggtgatggaggatggcaagatggaccctg

Exon 12 +       5848       5978   0   Internal    131   100   Excellent
aggagaggagctcaaaggccataatactctgccttcaccctggagagaccgtcccatgga
ggagtcactgctgctctttgaggtggggtcctagaggagcatctgggtttgggtgggcca
aggtgctgagaatgagatgctcctgtgcttagagacagcctgagtccttgttcccctcag
GCAATGCGCAAGGGCAAGTTTTCAGAGGGCGAGGCCACACTACGGATGAAGCTGGTGATG
GAGGATGGCAAGATGGACCCTGTAGCCTATCGAGTCAAGTATACACCACACCACCGCACA
GGGGACAAATG
gtgggtgtagaatggggtggggtggtggggctgccgagcagggcgatgggccatggggta
gggcagagtagggctggatggtagggcccactgcctatgccccacaggtgcatctatccc
acctacgactacacacactgcctctgtgactccatcgagcacatcactcactcactctgc

Exon 13 +       6086       6178   2   Internal     93   100   Excellent
tggaggatggcaagatggaccctgtagcctatcgagtcaagtatacaccacaccaccgca
caggggacaaatggtgggtgtagaatggggtggggtggtggggctgccgagcagggcgat
gggccatggggtagggcagagtagggctggatggtagggcccactgcctatgccccacag
GTGCATCTATCCCACCTACGACTACACACACTGCCTCTGTGACTCCATCGAGCACATCAC
TCACTCACTCTGCACCAAGGAATTCCAGGCCCG
gtgagggagctgggtccatggggtggtagggccagtggaattccagcagcccttcctgtg
gtctctgcctggttccagagctggccagtgctaaccctactctcccaccccagacgctct
tcctacttctggctttgcaatgcactggacgtctattgccctgtgcagtgggagtatggc

Exon 14 +       6292       6429   2   Internal    138    90   Excellent
cacactgcctctgtgactccatcgagcacatcactcactcactctgcaccaaggaattcc
aggcccggtgagggagctgggtccatggggtggtagggccagtggaattccagcagccct
tcctgtggtctctgcctggttccagagctggccagtgctaaccctactctcccaccccag
ACGCTCTTCCTACTTCTGGCTTTGCAATGCACTGGACGTCTATTGCCCTGTGCAGTGGGA
GTATGGCCGCCTCAACCTGCACTATGCTGTTGTCTCTAAGAGGAAGATCCTCCAGCTTGT
AGCAACTGGTGCTGTGCG
gtaggtgcggctgtttggcttatgaaaggttaatggcatatgctcccaaaggccttctca
ccaccttcttatccacagggactgggatgacccacggctctttacactcacggccctgcg
acggcggggcttcccacctgaggccatcaacaacttctgtgcccgggtatagcccagcag

Exon 15 +       6508       6595   2   Internal     88    71        Good
cgtctattgccctgtgcagtgggagtatggccgcctcaacctgcactatgctgttgtctc
taagaggaagatcctccagcttgtagcaactggtgctgtgcggtaggtgcggctgtttgg
cttatgaaaggttaatggcatatgctcccaaaggccttctcaccaccttcttatccacag
GGACTGGGATGACCCACGGCTCTTTACACTCACGGCCCTGCGACGGCGGGGCTTCCCACC
TGAGGCCATCAACAACTTCTGTGCCCGG
gtatagcccagcaggttgggtagatacattgggggttgagtgtggcagtttgtgattgta
gctgtgactgatgctgaactttcctgccaggtgggagtgactgtggcacaaaccacaatg
gagccacatcttctagaagcctgtgtgcgtgatgtgctgaatgacacagccccacgagcc

Exon 16 +       6686       6829   0   Internal    144   100   Excellent
agggactgggatgacccacggctctttacactcacggccctgcgacggcggggcttccca
cctgaggccatcaacaacttctgtgcccgggtatagcccagcaggttgggtagatacatt
gggggttgagtgtggcagtttgtgattgtagctgtgactgatgctgaactttcctgccag
GTGGGAGTGACTGTGGCACAAACCACAATGGAGCCACATCTTCTAGAAGCCTGTGTGCGT
GATGTGCTGAATGACACAGCCCCACGAGCCATGGCTGTGCTGGAGTCACTACGGGTCATC
ATCACCAACTTTCCTGCTGCCAAG
gtgggcctgcctcaacatgtgtgtcacatgtgtgtgtgtagctgggggtacacttggctc
tgggcatgggggtcctaatgctgagtatgactcatacctgtctcctgtctcctgctatag
tccttggacatccaggtgcccaacttcccagctgatgagaccaaaggcttccatcaggtt

Exon 17 +       6950       7054   0   Internal    105   100   Excellent
cgagccatggctgtgctggagtcactacgggtcatcatcaccaactttcctgctgccaag
gtgggcctgcctcaacatgtgtgtcacatgtgtgtgtgtagctgggggtacacttggctc
tgggcatgggggtcctaatgctgagtatgactcatacctgtctcctgtctcctgctatag
TCCTTGGACATCCAGGTGCCCAACTTCCCAGCTGATGAGACCAAAGGCTTCCATCAGGTT
CCCTTTGCACCCATTGTCTTCATTGAGAGGACTGACTTCAAGGAG
gtaaattgtgggggtggagggtcccgtttgctgctgagtctggtactgggaacctttcat
ctcctcatctctgtcagtccatctacttcctgcttcagatgaaccaatctttgccagaca
cgggggtagggaagcttccccacttgtttgacccttgcagcctcatgtgtctaccccact

Exon 18 +       7247       7339   0   Internal     93   100   Excellent
ggtggagggtcccgtttgctgctgagtctggtactgggaacctttcatctcctcatctct
gtcagtccatctacttcctgcttcagatgaaccaatctttgccagacacgggggtaggga
agcttccccacttgtttgacccttgcagcctcatgtgtctaccccacttcctatctctag
GAGCCAGAGCCAGGATTTAAGCGCCTGGCTTGGGGCCAGCCTGTGGGCCTGAGGCATACA
GGCTACGTCATTGAGCTGCAGCATGTTGTCAAG
gtgagagccagctgcagccttcctactgcagtgcctgctggggccaagatgtgagtatag
cctgcagtcctggttgtggttcccgggtctaattgctgctcccctccccccacttccagg
gccccagtggttgtgtagagagtctggaggtgacctgcagacgggcagatgctggagaga

Exon 19 +       7822       7947   0   Internal    126    90   Excellent
gctgcccagctgggggtatgaccttcactttggctgcagattccagcacaagaaccctga
agatcctactgaggtgcctggtggatttttaagtgacctgaacctggtaggttcatgagg
tttggggtgagggaggtaggcctccctggttggatggttgcctgagttccctgcctgcag
GCATCACTACACGTGGTGGATGCAGCATTAGTGGACTGCTCTGTGGCCCTGGCAAAACCC
TTCGACAAGTTCCAGTTTGAGCGTCTTGGATATTTCTCCGTGGATCCAGACAGCCATCAG
GGAAAG
gtgcttgactttactcacctgccctcatctgcagcagtgacagtggctgccgttcattgt
gccaagtgctctgcatacattcccttagttaatcctcaccacctgagggagttggtattc
atattctactagtgaggaaactggcactgaggataactccaggcacaaaattttgtatga

Exon 20 +       9860       9910   0   Terminal     51    59    Marginal
cccattcagtcccttacccaaagtcacaaagttattgaggacccgggcctcctgaccctt
agtccctcggcttctttggcttaagaaggatgttagggggaggtgtctgtggtgaaacct
gcccaggcctccctggccttgttctgggttggtggtcatccttttccctctgccctccag
CTTGTCTTTAACCGAACTGTCACACTGAAGGAAGACCCAGGAAAGGTGTGA
gctggaagcactgaacctacctcatcctcctggagggtgtggctaccctcgccaccccaa
attccatgtcaataaagaacagctaaattctcctagagtctgtgtgttatctctgcactt
ctagcatctgaaggccctgaagacatgctggtggtggtggtatgattgggggatggagat

Exon 21 +      10035      10075   1   Terminal     41    84        Good
tccagcttgtctttaaccgaactgtcacactgaaggaagacccaggaaaggtgtgagctg
gaagcactgaacctacctcatcctcctggagggtgtggctaccctcgccaccccaaattc
catgtcaataaagaacagctaaattctcctagagtctgtgtgttatctctgcacttctag
CATCTGAAGGCCCTGAAGACATGCTGGTGGTGGTGGTATGA
ttgggggatggagatgtgccttttgcacattttgtctgtgagaatggactttcccagaac
agagtggtactgacagctttgaaagcaccggtgcactttttggtgcttaaaggcaggggc
ctgggtaggattcataccctccgcacctggtctgagagaatggagggccctggggtgttt

--------------------------------------------------------------------------------