--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (33737 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      18425      18539   0    Initial    115   100   Excellent
ctcagtttttaacactggcaactgagactagtgtgtgtgtgcatcatgtgggccaaaccc
aatcatagcagagccctgggggagcgggtccctgagtgctgcccgtgactgttcccgctg
gtcccgcccggccgcctggcctcacccctctgtgtgcacagccccactgcaggccccacc
ATGGCGCCGTTCCTGCGCATCGCCTTCAACTCCTATGAGCTGGGCTCCCTGCAGGCCGAG
GACGAGGCGAACCAGCCCTTCTGTGCCGTGAAGATGAAGGAGGCGCTCAGCACAG
gtaggcctggaggctggaccctggagaggggctgggaatctgggcccagctggaaggact
ggagggggcctggccttgttccctgcaacctctgaaggattctgctcttcctcatccttg
actccctgccccactcagctatgaaggcagaggccactgagtcgctatagggctgcaaac

Exon  2 +      19579      19778   1   Internal    200   100   Excellent
tggagggaggacctagcagggtgcccaaggtagttctgtgctctagaggacactggggaa
ccacagcaggccctcaaggcaggagagtcgggcagattctgccaggggaaggccgtggag
gtctacgagggagggacagaggggccatggcccaaccttctctgcctggccttgttgcag
AGCGTGGGAAAACACTGGTGCAGAAGAAGCCGACCATGTATCCTGAGTGGAAGTCGACGT
TCGATGCCCACATCTATGAGGGGCGCGTCATCCAGATTGTGCTAATGCGGGCAGCAGAGG
AGCCAGTGTCTGAGGTGACCGTGGGTGTGTCGGTGCTGGCCGAGCGCTGCAAGAAGAACA
ATGGCAAGGCTGAGTTCTGG
gtaaggggcgcacgagccgtgccgtgtgtgtgtgtgtgtgtgtctgtgtgtgtgtgcatg
cgtgcatgtgtgtgcgtgcacacacgcgggcttggtcagtgagcacagctgaagagcacc
gggccctgtgctggccaccagtccagccctgtggccaacatgtcctgggtgtgaatcctg

Exon  3 +      21209      21269   0   Internal     61    82        Good
tggggctcaggagtggggctcaggcggggccctgcccacactgggcagacaagtgtctgg
ctaggccttggggggctgccttggccttgggggaccagccatgggggtgggttctgagtt
tggcctggcccaggctgccctcactgaccttgttctcccctggcctctggcccccaacag
CTGGACCTGCAGCCTCAGGCCAAGGTGTTGATGTCTGTTCAGTATTTCCTGGAGGACGTG
G
gtaagaactccctgggggtggagggctcccttgccgggttcagaggcagagccagcactg
aggtgtagggaagctgctcccttcggcagagctgtccaggaccaccctgggagggactgt
aggggtgccaccccttccagataccagggctgacttccctactccatggtcaccagattg

Exon  4 +      21446      21603   1   Internal    158   100   Excellent
gtgggtaagaactccctgggggtggagggctcccttgccgggttcagaggcagagccagc
actgaggtgtagggaagctgctcccttcggcagagctgtccaggaccaccctgggaggga
ctgtaggggtgccaccccttccagataccagggctgacttccctactccatggtcaccag
ATTGCAAACAGTCTATGCGCAGTGAGGACGAGGCCAAGTTCCCAACGATGAACCGCCGCG
GAGCCATCAAACAGGCCAAAATCCACTACATCAAGAACCATGAGTTTATCGCCACCTTCT
TTGGGCAACCCACCTTCTGTTCTGTGTGCAAAGACTTT
gtctggtgagaaccggccatgcccactggtggtggtgcagggtagtgggggccgatcccg
gtccccgctcactcactttgcctgggttttgcctttcaggggcctcaacaagcaaggcta
caaatgcaggcgtaagtgtctccacaggccagtttgtacgtatgtacccatgtgtgctca

Exon  5 +      22939      22992   1   Internal     54    53    Marginal
catgtgtaagagagggcatttaggagccgtttgctatcccagggcttggaagaactgccc
ccgcttctcatattgcgatgccctgtgcccgctaacttctgcccacctccctgcccacta
ggactccttctttctaagcccctgcagattggcctgtcctctccgccccgtcctctccag
GCTCCTCCTTCGAGGGCTGGCAGGAGGAAGACTCAAGCGCTGGGCCTCTGCGGG
gtgagggtgtgggcggtcaggagaacggtggctttgtgtagagggctagactggtcggca
ggcaccagctcatagactctgcccctcccggtgctttcccttccccctcctgggcctgtg
cctcttcaagaatgtaacgctgccatccacaagaaatgcatcgacaagatcatcggcaga

Exon  6 +      23454      23583   0   Internal    130   100   Excellent
cctctccccaccctccctggggagcttaccctccctccccatttttcttagtctttcctt
gcctctcccagtggagctctcttgggatgttgttgtgcccagggttgggggagagctagg
ggttgaagaagaggctggagctggcacgtgaccctcagcctgtgatacccccacctccag
TTCCAGAAAGAACGCTTCAACATCGACATGCCGCACCGCTTCAAGGTTCACAACTACATG
AGCCCCACCTTCTGTGACCACTGCGGCAGCCTGCTCTGGGGACTGGTGAAGCAGGGATTA
AAGTGTGAAG
gtgcgtgccaccccgcccctgggctgcaggaggggcactcccagctggtgctgctgtgaa
ttccagccacctcacgccaccctcgcctcctcacctggagacgggcacctcattcaggga
cctgatgagggtgaggccttggtggaccctccccactggcctgactggctctgccactta

Exon  7 +      24876      24976   1   Internal    101   100   Excellent
gagagagagagagagatcgaagtatttatgatggcttcagatcaatgttttcctagaaac
tggaacccagcagaccccactgaagccctcctttctcttgctctcctgcgcctctcctac
actgccccctgcccttggctgagctctgagactgacagccccgcttctccctcaccccag
ACTGCGGCATGAATGTGCACCATAAATGCCGGGAGAAGGTGGCCAACCTCTGCGGCATCA
ACCAGAAGCTTTTGGCTGAGGCCTTGAACCAAGTCACCCAG
gtgggcaggtgccatggggaccctggacacagggcagtggggtcagggacagtcaaggct
tacagccactgctggggagccacagacagccaggatatatttagacccaggactctactt
cgggaagatgcaactcaagaatttaggcagcagagggaggggggctttttttcataagaa

Exon  8 +      25606      25702   0   Internal     97    80        Good
tctctgggctcctggaagagtgcgtgtgtgtacacgcagcccgagtagggggcctgggct
gtgcccctgttgtctcctcttggtgttaagggtggagttatacctgggagtcttccttct
gggctgggagttctgataatggtctgaccatctggccccccacctctgctccctccccag
AGAGCCTCCCGGAGATCAGACTCAGCCTCCTCAGAGCCTGTTGGGATATATCAGGGTTTC
GAGAAGAAGACCGGAGTTGCTGGGGAGGACATGCAAG
gtgaagctgggtccattgccccattacggtttttattccccctgaggccaaagaaagggg
actgtcctcccttccattgtcaagtgagacatggaaggaaccaccggtcctggggagcga
gccccttcctctctgaggccccttcccccagcctaccccaggccccgggggaggggagtt

Exon  9 +      25929      26029   1   Internal    101   100   Excellent
gccaaagaaaggggactgtcctcccttccattgtcaagtgagacatggaaggaaccaccg
gtcctggggagcgagccccttcctctctgaggccccttcccccagcctaccccaggcccc
gggggaggggagttgtgtagactgagaccccgatctgaggaggtgccatctctcgggcag
ACAACAGTGGGACCTACGGCAAGATCTGGGAGGGCAGCAGCAAGTGCAACATCAACAACT
TCATCTTCCACAAGGTCCTGGGCAAAGGCAGCTTCGGGAAG
gtgagggctgtgagccgggcacctgcttcccaccccaccctggcttcttcccgcttaggt
ggctgaggtgggagtctgtgaatcgggctgtggcccctgccccgtcctcacctgctcagc
acccgtgtctccccatcaggtgctgcttggagagctgaagggcagaggagagtactttgc

Exon 10 +      26169      26384   0   Internal    216    95   Excellent
tcatcttccacaaggtcctgggcaaaggcagcttcgggaaggtgagggctgtgagccggg
cacctgcttcccaccccaccctggcttcttcccgcttaggtggctgaggtgggagtctgt
gaatcgggctgtggcccctgccccgtcctcacctgctcagcacccgtgtctccccatcag
GTGCTGCTTGGAGAGCTGAAGGGCAGAGGAGAGTACTTTGCCATCAAGGCCCTCAAGAAG
GATGTGGTCCTGATCGACGACGACGTGGAGTGCACCATGGTTGAGAAGCGGGTGCTGACA
CTTGCCGCAGAGAATCCCTTTCTCACCCACCTCATCTGCACCTTCCAGACCAAGGTGCCC
GGGCCTCCTGCCGTCACCACCCCATGCCACAGCCAT
gtcccacagctcctcagcccccctcagtcagggctgtgtctccccttcaggccacttaag
gcagggccatgctttcccccctcatgcctcccagggcagagtcgtccacctcagccaggg
cctgtccctgctgtttcctgttggggcttggccccagtggccctcagtgagggagcctcc

Exon 11 +      26606      26697   0   Internal     92    98   Excellent
ccccttcaggccacttaaggcagggccatgctttcccccctcatgcctcccagggcagag
tcgtccacctcagccagggcctgtccctgctgtttcctgttggggcttggccccagtggc
cctcagtgagggagcctcctgcctattcctcacccctgctcaccacccttcccaccccag
GACCACCTGTTCTTTGTGATGGAGTTCCTCAACGGGGGGGACCTGATGTACCACATCCAG
GACAAAGGCCGCTTTGAACTCTACCGTGCCAC
gtacgtaagggccatggtggggaagggcccagtgtggaggaagggctactggctcagagc
ccacttccagtctgccctccatgccttcttccctctccctagaaaagccagcctgggcta
gagcggcaactggggagatgtgggggtagcctgggtcggcaccacacaggaagccatggg

Exon 12 +      27342      27404   2   Internal     63    69    Marginal
ctttctgcctgggctgccagcccccacttgcctgatacaagatgtacttgatcatgctca
ggtggtccatggagttatttgcagcatttcttgctcctggaagtggggttgagggcccga
ggagaagcagaggctgctcggcagagatcccggaacactttatccctctctcttgcccag
GTTTTATGCCGCTGAGATAATGTGTGGACTGCAGTTTCTACACAGCAAGGGCATCATTTA
CAG
gtgcgggggtgagggcagcgggggctcttgggaggggaggctccagccccatcatatctt
ctgaaatgctccaagcaggatccccccaactccagttccttctctgctggaaatcaatct
ttagctgggtatttgcctatgcctcccaccctggtgttagcattcctgtggccaccattt

Exon 13 +      28722      28860   2   Internal    139   100   Excellent
cttgcaagaagcacctgtttttaggatctctttctccttctgcttccttttctgtttctc
attcccttgtacccttggggacagtcctggactaatacggctgaaaattaggacatgggg
ggcagggttggaaggagaagaaatgtcccctgctgactcttacctgtcccctgtccttag
GGACCTCAAACTGGACAATGTGCTGCTGGACCGGGATGGCCACATCAAGATTGCCGACTT
TGGGATGTGCAAAGAGAACATATTCGGGGAGAGCCGGGCCAGCACCTTCTGCGGCACCCC
TGACTATATCGCCCCTGAG
gtgagccgatacccttccagccccccgctcagtcaggcaccttgcctccccacggtgggc
cagggaaggattcccaagggcagtgatgtccaagccaaagcccataggctgaggcggcct
ggctaggcttcgtgcccaggggcccctctcagcctcagcacctcagctcctgctgacctg

Exon 14 +      29060      29248   0   Internal    189    95   Excellent
gccccccgctcagtcaggcaccttgcctccccacggtgggccagggaaggattcccaagg
gcagtgatgtccaagccaaagcccataggctgaggcggcctggctaggcttcgtgcccag
gggcccctctcagcctcagcacctcagctcctgctgacctgctgctctccccaccgccag
ATCCTACAGGGCCTGAAGTACACATTCTCTGTGGACTGGTGGTCTTTCGGGGTCCTTCTG
TACGAGATGCTCATTGGCCAGTCCCCCTTCCATGGTGATGATGAGGATGAACTCTTCGAG
TCCATCCGTGTGGACACGCCACATTATCCCCGCTGGATCACCAAGGAGTCCAAGGACATC
CTGGAGAAG
gtggaggccctgggctgggctgggctggtctgggctgggctggggcaggggctggcagac
actgggctttgggtgaggagcttcctgtctctggaatggcagcctcagtggtgctgcagt
cctaacatacggggtattgctctctcaccatgttcccaggaactcctgtctgagtcctgt

Exon 15 +      32110      32268   0   Terminal    159    94   Excellent
cttggggaaatggcagcctccttcccatggggctcctttcaggctgctaggggaggctct
gtcttctgttctgggtgaggacagctctggcctggcccagccctgcagggactccagcct
ggggtgtctggagggccattccctaggtcctgttcgctcacccctgccctctgcttgtag
AAGTCACCCAGAGACTACAGTAACTTTGACCAGGAGTTCCTGAACGAGAAGGCGCGCCTC
TCCTACAGCGACAAGAACCTCATCGACTCCATGGACCAGTCTGCATTCGCTGGCTTCTCC
TTTGTGAACCCCAAATTCGAGCACCTCCTGGAAGATTGA
ggttcctggacagatcaggctagccctgccctccacccacacctgcccgctccccacgat
aagcaccagtgggactgtggtgacttctgctgctggccccgcccctgcccccagagcgtc
cttggctgccgtctggccgggctctcatggtacttcctctgtgaactgtgtgtgaatctg

--------------------------------------------------------------------------------