--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (54043 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (37 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1380       2774   0     Single   1395    91   Excellent
cccgggctgcgcggcgaggctgacccgggcccgggcgccggggtcgggggcggctggcgc
gggcaggaagcgcatcgcggcccgggcccgccccccgcctcccgccgcctccgggctccc
ggctcccggccgcgcctcgccccatgcactcgccgcgccgcgcagcccgcgcacgcccgg
ATGGCTCCTCGCGCCGCGGGCGGCGCACCCCTTAGCGCCCGGGCCGCCGCCGCCAGCCCC
CCGCCGTTCCAGACGCCGCCGCGGTGCCCGGTGCCGCTGCTGTTGCTGCTGCTCCTGGGG
GCGGCGCGGGCCGGCGCCCTGGAGATCCAGCGTCGGTTCCCCTCGCCCACGCCCACCAAC
AACTTCGCCCTGGACGGCGCGGCGGGGACCGTGTACCTGGCGGCCGTCAACCGCCTCTAT
CAGCTGTCGGGCGCCAACCTGAGCCTGGAGGCCGAGGCGGCCGTGGGCCCGGTGCCCGAC
AGCCCGCTGTGTCACGCTCCGCAGCTGCCGCAGGCCTCGTGCGAGCACCCGCGGCGCCTC
ACGGACAACTACAACAAGATCCTGCAGCTGGACCCCGGCCAGGGCCTGGTAGTCGTGTGC
GGGTCCATCTACCAGGGCTTCTGCCAGCTGCGGCGCCGGGGCAACATCTCGGCCGTGGCC
GTGCGCTTCCCGCCCGCCGCGCCGCCCGCCGAGCCCGTCACGGTGTTCCCCAGCATGCTG
AACGTGGCGGCCAACCACCCGAACGCGTCCACCGTGGGGCTAGTTCTGCCTCCCGCCGCG
GGCGCGGGGGGCAGCCGCCTGCTCGTGGGCGCCACGTACACCGGTTACGGCAGCTCCTTC
TTCCCGCGCAACCGCAGCCTGGAGGACCACCGCTTCGAGAACACGCCCGAGATCGCCATC
CGCTCCCTGGACACGCGCGGCGACCTGGCCAAGCTCTTCACCTTCGACCTCAACCCCTCC
GACGACAACATCCTCAAGATCAAGCAGGGCGCCAAGGAGCAGCACAAGCTGGGCTTCGTG
AGCGCCTTCCTGCACCCGTCCGACCCGCCGCCGGGTGCACAGTCCTACGCGTACCTGGCG
CTCAACAGCGAGGCGCGCGCGGGCGACAAGGAGAGCCAGGCGCGGAGCCTGCTGGCGCGC
ATCTGCCTGCCCCACGGCGCCGGCGGCGACGCCAAGAAGCTCACCGAGTCCTACATCCAG
TTGGGCTTGCAGTGCGCGGGCGGCGCGGGCCGCGGCGACCTCTACAGCCGCCTGGTGTCG
GTCTTCCCAGCCCGGGAGCGGCTCTTTGCTGTCTTCGAGCGGCCCCAGGGGTCCCCCGCG
GCCCGCGCTGCTCCGGCCGCACTCTGCGCCTTCCGCTTCGCCGACGTGCGAGCCGCCATC
CGAGCTGCGCGCACCGCCTGCTTCGTGGAACCGGCGCCCGACGTGGTGGCGGTGCTCGAC
AGCGTGGTGCAGGGCACGGGACCGGCCTGTGAGCGCAAGCTCAACATCCAGGTACACCCG
GGCGGTGGCGGCGGCGGCGGCGGCGGCGGCGGCGGGGGCGGGGGCGGGGGCGGGCGGGAA
CCGAGCGGGTCGTGA
gctgagtgggtcacaggtgggagcgcgcagagatccagatgtacgtggaacccaggtgtg
cacgcgagaatacaggtgtcccccgaggggtactactggcgcctgtatggcccaggtggg
catgtgcagggactcaagtgagtgccggctcatgggcgcgcatacctaggcgtactggga

Exon  2 +       6128       6201   0    Initial     74    69    Marginal
ttctacctattattttagaaagcccctaggtagctggtgagaaggagcaatggaggaggg
agagtggctgagaggctgaggccgcctcccgggaatagattccttcactcagtcgcaaat
atatcttgagcacttactgtgtgccaggctctgtggtgggtgccagatggcagtggggag
ATGGGGCCGGCCTTGTTCTCTGGAGACATGGCTGGCCTGGTCTGCAGCAGTGCTGAGGGC
TTGGAGGGTGGCAG
gtgggctctggacagatttgggggctgggatgcagccccagtggtggggagtgatgggat
ggaggagcagaaagctgcccagagtcaggctcagcaacaggatagatgttggtacccatg
gggtggggcatgtgatggggtacctctggggaagaggatgagtttggtctggggagaacc

Exon  3 +      18409      18668   1   Internal    260    92   Excellent
cttgttccctcgcctgctggttcccgtgtaccttgaacatcatctccttggaacagctct
gtaaccaacactgaggtcagggcaggcctgggcttggggatggggtcccgtttgtgtttg
ggcctcagctgagcactgaggatataaagtaggaacaagacttgaaagctctgatgccag
GGCCTGAGATCCCAGCCAGCTGTGCGGGCGGGGAGCCGGAGAAGGTTCTGGAGCTGGGAT
CTGACGTGCCGTTCCTCTTCCAGCTCCAGCCAGAGCAGCTGGACTGTGGAGCTGCTCACC
TGCAGCACCCGCTGTCCATCCTGCAGCCCCTGAAGGCCACGCCCGTGTTCCGCGCCCCGG
GCCTCACCTCCGTGGCCGTGGCCAGCGTCAACAACTACACAGCGGTCTTCCTGGGCACGG
TCAACGGGAGGCTTCTCAAG
gtaggtatggttggggatgtggggagggggtgggggtgggaggctcccctgggagttggc
tgagggggtcagtctgtacacagggctgctacaggtccagcctgaccctttgttttctcc
cattcgcctagcactttacagtttacaaagtattttgcaagtctgtttttgccactattg

Exon  4 +      21300      21431   0   Internal    132   100   Excellent
ggcagaagcatcaaggcccggccctgtgccctcccctgcacgcccgtgacttcccacccc
tcctgaagggtccaagacaggatggggaggcagagcccccagacccgggctcaggttgtc
ccctgggtttggcctcccctgctatgggctccagcaccctgatgcccactacccccacag
ATCAACCTGAACGAGAGCATGCAGGTGGTGAGCAGGCGGGTGGTGACTGTGGCCTATGGG
GAGCCCGTGCACCATGTCATGCAGTTTGACCCAGCAGACTCCGGTTACCTTTACCTGATG
ACGTCCCACCAG
gtgaggccagagccccagcccaacgccatcccagcaccagccgagccctcttgcttgcct
ggcctttacacacgctgttcctctgctgggagcaccctcctcctccatctcccttatctg
ctaactccaccttgtcctgcgcctcccaacaccgaccttgcctctgcagggaagccttgt

Exon  5 +      21747      21847   0   Internal    101    96   Excellent
cctgcgcctcccaacaccgaccttgcctctgcagggaagccttgtctcccatgttccccc
attagagtgttgaccctcagtttccccagcctctcatggcccgcaccatgctgaccgtac
cacctccccaagggagaggctggcagtcccattgagctgggcccccacctctgcccccag
ATGGCCAGGGTGAAGGTCGCCGCCTGCAACGTGCACTCCACCTGTGGGGACTGCGTGGGT
GCGGCGGACGCCTACTGCGGCTGGTGTGCCCTGGAGACGCG
gtgaggctggacaccagcaacagctggaccaggagggctgtgggggtgggaggagctgac
ctgggtcctgaccctgcggtgccaccccaggtgcaccttgcagcaggactgcaccaattc
cagccagcagcatttctggaccagtgccagcgagggccccagccgctgtcctgccatgac

Exon  6 +      21938      22067   2   Internal    130   100   Excellent
gaaggtcgccgcctgcaacgtgcactccacctgtggggactgcgtgggtgcggcggacgc
ctactgcggctggtgtgccctggagacgcggtgaggctggacaccagcaacagctggacc
aggagggctgtgggggtgggaggagctgacctgggtcctgaccctgcggtgccaccccag
GTGCACCTTGCAGCAGGACTGCACCAATTCCAGCCAGCAGCATTTCTGGACCAGTGCCAG
CGAGGGCCCCAGCCGCTGTCCTGCCATGACCGTCCTGCCTTCCGAGATCGATGTGCGCCA
GGAGTACCCA
gtgagtcctgggggaggcaagacccagctcgggacacaggggagcctcccttcacccagc
acccaggccccgagaggtggagactcccacccatggtgccccaaggacctgaagacaaat
aatgagaacagtgacaatgactgggctttcctgaccaactagtaagtgccaggcacgtgc

Exon  7 +      23457      23634   0   Internal    178   100   Excellent
aactgaggctcagagggtcacatgtagggcatagccctctggccctgagtcctggccacc
actaccccttcccccaggggacattcaggcagtgccagaccttgggttggtgcacagccc
tggggcaggctgtgaggagcatagcctggacccccagagctgagggctccttgcccccag
GGCATGATCCTGCAGATCTCGGGCAGCCTGCCCAGCCTCAGTGGCATGGAGATGGCCTGT
GACTATGGGAACAACATCCGCACTGTGGCTCGGGTCCCAGGCCCTGCCTTTGGTCACCAG
ATTGCCTACTGCAACCTCCTGCCGAGGGACCAGTTTCCGCCCTTCCCCCCCAACCAGG
gtaagcacgctgtgctgttggcacagccccagaggggcagaacggtggactgtcaggcat
ggggatggcagggggccagaggtcacagcttctgatgttggtggcaatcccctgccccca
tgtcctcccctggctcccccatccattccagaccacgtgactgttgagatgtctgtgagg

Exon  8 +      23786      23894   1   Internal    109    99   Excellent
ccagtttccgcccttcccccccaaccagggtaagcacgctgtgctgttggcacagcccca
gaggggcagaacggtggactgtcaggcatggggatggcagggggccagaggtcacagctt
ctgatgttggtggcaatcccctgcccccatgtcctcccctggctcccccatccattccag
ACCACGTGACTGTTGAGATGTCTGTGAGGGTCAATGGGCGGAACATCGTCAAGGCCAATT
TCACCATCTACGACTGCAGCCGCACTGCACAAGTGTACCCCCACACAGC
gtgagtggcttgggtggcttgcctccagttggtggagggaggaacgcatccccgggaagg
gtctttgctttcagggggccctgagaagaaaaatcatagcatcgtagaggtagacaggcc
cttcagttgttcattcaccagcacatttattcattctacaataaatgcatactgcctgat

Exon  9 +      24350      24452   0   Internal    103   100   Excellent
ttgtatacctcttgttagcaggcagctcactaccttaaagacccaatctttcccaggcag
ccccgatgatgagaaagacctttccctgtgctgggatctgccttttgggttctagttcct
gggacagggatgagttgaggggtggggaaccaggagttgaggggcctccttgtcttccag
CTGTACCAGCTGCCTGTCGGCACAGTGGCCCTGTTTCTGGTGCAGCCAGCAGCACTCCTG
TGTTTCCAACCAGTCTCGGTGCGAGGCCTCACCAAACCCCACG
gtaagccaggctagggggcccctccgcctctgctgtttcattaccttttttaaaaaattc
acatgttgagaatgtttcaatgcctttgcatattccgccttagctttggctttgacagct
atatggggctcatcacataccacggtgcgtttaacccatgccctatagttggacatacta

Exon 10 +      24556      24596   2   Internal     41    95   Excellent
ggccctgtttctggtgcagccagcagcactcctgtgtttccaaccagtctcggtgcgagg
cctcaccaaaccccacggtaagccaggctagggggcccctccgcctctgctgtttcatta
ccttttttaaaaaattcacatgttgagaatgtttcaatgcctttgcatattccgccttag
CTTTGGCTTTGACAGCTATATGGGGCTCATCACATACCACG
gtgcgtttaacccatgccctatagttggacatactaattatttcctcttttttgcatttt
gatatagccagggcactatgcatatccttgatgattccctgaagaccgcttcttagaaat
gacctgttgggctggtagtgtggccatagttctacaccttgagctcagctgccttccaga

Exon 11 +      29586      29690   0   Internal    105    99   Excellent
ggatggagggtggtggcgagtgggaggcacggggtggggctggtggccgttaggactgaa
tgactagtgttttctcctcaggaaggcaggactgaaccaggcaggctggggtgcagtgag
tcctcctgcctcttctctgaaatgcccctgtgtcaccctctccttctgtttcctctgcag
AGCCCTCAGGACTGCCCCCGGACCCTGCTCTCACCCCTGGCACCCGTGCCTACGGGTGGC
TCCCAGAACATCCTGGTGCCTCTGGCCAACACTGCCTTTTTCCAG
gtaagtagaagccaggccagcgccgggtggggccaggaggaggccggggagcacgcaggc
cactaactgcccccatgtcctggtgtgacccctgctctgggcccactgcagtgctttcgc
acctgtgtgggctttgcttttctttctctgagtttccaccttctgcatgaggaagcccca

Exon 12 +      32164      32253   0   Internal     90   100   Excellent
cattggacgtgatggccaggaaggggattttgggggacgggacagcccatgcaaaggcct
gacagttcgaccaagcccacctttcccagcaggagcccgtggtgtcctgctggagttaga
gggcaatgcatgctggcttggttctcctcaaacccgcctcccactccctgtttcccacag
GGTGCAGCCCTGGAGTGTAGTTTTGGGCTGGAGGAGATCTTCGAGGCTGTGTGGGTGAAT
GAGTCTGTTGTACGCTGTGACCAGGTGGTG
gtgagtggggtgactccagcatgggcggagggcgggcctgcgttaagtccagatgctgta
cccctcaccccaccctgcctctctctaccttctggttcccccatccccagcagccccaac
ttcatctgcctccatgacacccatccccagcagagccccaggcattgcccatgcccccta

Exon 13 +      32457      32550   0   Internal     94   100   Excellent
ggcggagggcgggcctgcgttaagtccagatgctgtacccctcaccccaccctgcctctc
tctaccttctggttcccccatccccagcagccccaacttcatctgcctccatgacaccca
tccccagcagagccccaggcattgcccatgccccctatgctcttttctgcccttttgcag
CTGCACACGACCCGGAAGAGCCAGGTGTTCCCGCTCAGCCTCCAACTAAAGGGGCGGCCA
GCCCGATTCCTGGACAGCCCTGAGCCCATGACAG
gtgggcacccccacccgccccacatggcctcggggcctcagtgcagtgggtggggctcag
ccttgtgcgactcattccagtggttgccccaaagccgcagatgtcccaccccattgttct
ccagcacacacacagcctcatatcccagccctgccatgccatgccaggctccaggccttg

Exon 14 +      33531      33683   0    Initial    153    51    Marginal
tggggaaggggctaagaacctcaggggatcctgacccccagaatcaggacttcctctggg
tggggcaccacaatgatggggcgcagacctcttgacagttgttgtgtgtggagggcacag
cggtgttggggcatgcaccgcagagcggggctgaccgagctgccccgtgtctccccagtc
ATGGTCTATAACTGTGCCATGGGCAGCCCCGACTGTTCCCAGTGCCTGGGCCGCGAAGAC
CTGGGTCACCTGTGCATGTGGAGTGATGGCTGCCGCCTGCGGGGGCCTCTGCAGCCCATG
GCTGGCACCTGCCCCGCCCCCGAGATCCACGCG
gtaagcatgcccagtggaggcacgtggcacccgcactccggcacggcgcatgcgcagtgc
cctcgagggtcccacttcttggggacccaaacggcacatacaccgacacatgggtgcagt
atcacctgtgaacaaaaggaagtgctctgcctcacagagctgatgtttcagtgggggagg

Exon 15 +      34274      34425   0   Internal    152    79        Good
ccttgccagcacagtgacctgccaagtggccacagtcccagccccacctgagcctccaga
ccttcctctaagcagtgggtctgcacggctgtgccctgctgggtgcctgtgactgtgggc
agaagcctgctggcctgcagcctcagatcccattcgcccctctctcgggtcacctggcag
ATTGAGCCCCTGAGTGGCCCGTTGGACGGTGGGACCCTGCTGACCATCCGAGGAAGGAAC
CTGGGCCGGCGGCTCAGTGACGTGGCCCACGGCGTGTGGATTGGTGGTGTGGCCTGTGAG
CCACTGCCTGACAGATACACGGTGTCGGAGGA
gtgagtagccacggtgcccccacctaccttctccagcagtgccagcctctgctctgtcct
cctcactcctccctccccatcctctgtcctcactctgctgctttctggaagactgttgct
tcgtggcctccaggcctgtgccgaagccattcccaccacacatcctgccgtttctgcttg

Exon 16 +      35027      35410   2   Internal    384    94   Excellent
cgtgtggaagagccgtcatctaccagcccagcagacgttctcatgatcagagaccctttt
gtcccacccccgtgtcttatagttgcagaactgtgggaaactgatggggtaaattataca
tagaaggcattggaagtgtggcatggcgtggaatggggcgatccctgagcctggctctag
GGTGGCCGTGGGGGCCAAGGACCGCTGGCTGACCACAGCACCTCCCCTCAGGATCGTGTG
TGTCACAGGGCCAGCCCCAGGACCACTCTCAGGTGTGGTGACCGTGAACGCCTCTAAGGA
GGGCAAGTCCCGGGACCGCTTCTCCTACGTGGTAAGGGGGGGCTGCAGCCCACTGTCCGG
CCCGCCCAGCACGCACACTCCCGGGGGCTGGCCCGAGGCCCAAACGCCTGCCTTCCTCCC
ACAGCTGCCCCTGGTCCACTCCCTGGAGCCTACCATGGGCCCCAAGGCCGGGGGCACCAG
GATCACCATCCATGGGAATGACCTCCATGTAGGCTCCGAGCTCCAGGTCCTGGTGAACGA
CACAGACCCCTGCACGGAGCTGAT
gtaagcctctgggcctggcccatcccttccagcccagagaaatcaatgggcttgggggct
ggcgggctggaggtgacatccttgagccaagcctctcttgggtcttcattggctgtgtcc
cctaagccaagccccttctcctctctgagcctcagtttcctcagctggtaagaatagtac

Exon 17 +      35216      35410   2   Internal    195    99   Excellent
gggggccaaggaccgctggctgaccacagcacctcccctcaggatcgtgtgtgtcacagg
gccagccccaggaccactctcaggtgtggtgaccgtgaacgcctctaaggagggcaagtc
ccgggaccgcttctcctacgtggtaagggggggctgcagcccactgtccggcccgcccag
CACGCACACTCCCGGGGGCTGGCCCGAGGCCCAAACGCCTGCCTTCCTCCCACAGCTGCC
CCTGGTCCACTCCCTGGAGCCTACCATGGGCCCCAAGGCCGGGGGCACCAGGATCACCAT
CCATGGGAATGACCTCCATGTAGGCTCCGAGCTCCAGGTCCTGGTGAACGACACAGACCC
CTGCACGGAGCTGAT
gtaagcctctgggcctggcccatcccttccagcccagagaaatcaatgggcttgggggct
ggcgggctggaggtgacatccttgagccaagcctctcttgggtcttcattggctgtgtcc
cctaagccaagccccttctcctctctgagcctcagtttcctcagctggtaagaatagtac

Exon 18 +      36175      36342   2   Internal    168   100   Excellent
ggaatttggaagtgtaaggaaacagctgggcactaactgggcagaagatgagttgggacc
agtcaaggaggccttgaaccccaggccaagtgcgtggacttgtgccccaggtctcagggg
cattggcggtgggtgagcagcagaaggcaggccctgctgataacctgctgctccccccag
GCGCACAGATACCAGCATCGCCTGCACCATGCCTGAGGGGGCCCTGCCGGCTCCGGTGCC
TGTGTGTGTGCGCTTCGAGCGTCGGGGCTGCGTGCACGGCAACCTCACCTTCTGGTACAT
GCAGAACCCGGTCATCACGGCCATCAGTCCCCGCCGCAGCCCTGTCAG
gtgagactggcaccccgcccttcccccaggctctctggggctgcaggtgcactgataggt
tttgctgtcccccgcagtggcggcaggaccatcacagtggctggtgagcgtttccacatg
gtgcagaatgtgtccatggccgtccaccacattggccgggagcccacggtgaggcattcg

Exon 19 +      36420      36510   2   Internal     91   100   Excellent
gtgtgcgcttcgagcgtcggggctgcgtgcacggcaacctcaccttctggtacatgcaga
acccggtcatcacggccatcagtccccgccgcagccctgtcaggtgagactggcaccccg
cccttcccccaggctctctggggctgcaggtgcactgataggttttgctgtcccccgcag
TGGCGGCAGGACCATCACAGTGGCTGGTGAGCGTTTCCACATGGTGCAGAATGTGTCCAT
GGCCGTCCACCACATTGGCCGGGAGCCCACG
gtgaggcattcgggggcctgatgggtgggagggggtggcccaggcacagccagggcccta
actgaccaggcctcctcccactgcatctctgtcccctcttcctccctctgcctctgtgtc
tcctcaaaccccactccccaccgtttctccatgcccatctgtccatcctgcatcccggcc

Exon 20 +      36716      37000   0   Internal    285    85        Good
tgggagggggtggcccaggcacagccagggccctaactgaccaggcctcctcccactgca
tctctgtcccctcttcctccctctgcctctgtgtctcctcaaaccccactccccaccgtt
tctccatgcccatctgtccatcctgcatcccggcctgggcccctggctctcctgcaccag
CTCTGCAAGGTTCTCAACTCCACCCTCATCACCTGCCCGTCCCCCGGGGCCCTGAGCAAC
GCATCAGCGCCAGTGGACTTCTTCATCAATGGGCGGGCCTACGCAGACGAGGTGGCTGTG
GCTGAGGAGCTACTGGACCCCGAGGAGGCACAGCGGGGCAGCAGGTTCCGCCTGGACTAC
CTCCCCAACCCACAGTTCTCTACGGCCAAGAGGGAGAAGTGGATCAAGCACCACCCCGGG
GAGCCTCTCACCCTCGTTATCCACGTGAGCACCAAAGGGGCCGGG
gtaggcgggggcaagcgagccagcctcagctgtgggcctcgggagcacttccccatgagc
atcctccccctttgcacccacagaaggagcaggacagcctggggctccagagtcacgagt
accgggtcaagataggccaagtaagctgcgacatccagattgtctctgacagaatcatcc

Exon 21 +      37084      37233   0   Internal    150   100   Excellent
cccacagttctctacggccaagagggagaagtggatcaagcaccaccccggggagcctct
caccctcgttatccacgtgagcaccaaaggggccggggtaggcgggggcaagcgagccag
cctcagctgtgggcctcgggagcacttccccatgagcatcctccccctttgcacccacag
AAGGAGCAGGACAGCCTGGGGCTCCAGAGTCACGAGTACCGGGTCAAGATAGGCCAAGTA
AGCTGCGACATCCAGATTGTCTCTGACAGAATCATCCACTGCTCGGTCAACGAGTCCCTG
GGCGCGGCCGTGGGGCAGCTGCCCATCACA
gtgagtggatggggcgccggagcagggcagacctggccccacccctggcccatctgccaa
gcatctgcccctcacccagcacctgaattcactgagcgttttcacgctcaacagctcagt
ccagcaaagcagagctttacatccccacttgacatatgaggaaactgaggcccaagaact

Exon 22 +      38062      38176   0   Internal    115   100   Excellent
gccctcatttagccttcccagtgtccccaggaggtggacattgttatctctatgttatca
gtgtggcacctgaggctcagagaggttaggtaatttacccagggccacacagcaagtgag
gagcagaactagagtataagtccaggaaagctacaacccccttccccaacctctgcacag
ATCCAGGTAGGGAACTTCAACCAGACCATCGCCACACTGCAGCTGGGGGGCAGCGAGACG
GCCATCATCGTGTCCATCGTCATCTGCAGCGTCCTGCTGCTGCTCTCCGTGGTGG
gtaaggagccccaccctcaggacaccttggagggcaggcttgccaccttgccccagcccc
tctgaagattggcagatgggagaaggcaggatgggatggggcacagcttgaacaaaggct
tggccatgggaacaggttaggcacccagaggttgggggaggtgtgccctggctccagcac

Exon 23 +      40370      40527   1   Internal    158   100   Excellent
gacctgcctctccactgcccgcagccctgttcgtcttctgtaccaagagccgacgtgctg
agcgttactggcagaagacgctgctgcagatggaggagatggaatctcagatccgagagg
aaatccgcaaaggtagtgggcggggaccctgcagggctgggcctcaactttccctcctag
GGGATGGGTTCTCGGGCCGCTCACGGCTGTCCGTGTGTCCGCCAGGCTTCGCTGAGCTGC
AGACAGACATGACAGATCTCACCAAGGAGCTGAACCGCAGCCAGGGCATCCCCTTCCTGG
AGTATAAGCACTTCGTGACCCGCACCTTCTTCCCCAAG
gtcagcccgagcctgagcctgccctgaacctgtgccagccacctcaaggcaactcgacct
ctctgagccctgccagcctatagggtcccttgagcagtgccaaacctgcacagctgtccg
cagccgtcctggccacttgccctggcctgccacggggagaagggttggaggcagattctc

Exon 24 +      41990      42132   0   Internal    143   100   Excellent
cttctctgagccccacttttcaattcaaccaagctattgttccctgtcacaaaggttagg
aggcatccaccgtggaaggtaatgagctccccatcccaggaggcatacaagcagccgtcg
taagcactggctgttaggctaggcagggacactgggcccctctggacaccccatcaccag
TTGCTTCCACAGATTCCTGAGAGCTGCCGGCCCAACATGGAAGAGGGAATTAGCTTGTTC
TCCTCACTACTCAACAACAAGCACTTCCTCATCGTCTTTGTCCACGCGCTGGAGCAGCAG
AAGGACTTTGCGGTGCGCGACAG
gtcaggctgtgacagactggggtggggtagggaagaggagcctgtccaaggccacacagc
atcaggtcctgggtcctggggctctggggctcttgacacccccatattccagcccttcct
gggccgggatgcccaagaccttggctcacggggcacgatggttgctgtggacgtagaaga

Exon 25 +      42290      42314   0    Initial     25    47    Marginal
aaggactttgcggtgcgcgacaggtcaggctgtgacagactggggtggggtagggaagag
gagcctgtccaaggccacacagcatcaggtcctgggtcctggggctctggggctcttgac
acccccatattccagcccttcctgggccgggatgcccaagaccttggctcacggggcacg
ATGGTTGCTGTGGACGTAGAAGAAG
gtggctgtttctccaggaggattctagccccactcacccctcgcaggacccacccacaca
ggcactcctgggatcgatgggcccggggatgaggcggcactgagaccctgggacccacag
ctcctagggcctcaaggtgcagttgacacctgcctcccgctcacaggtgcagcctggcct

Exon 26 +      42481      42679   2   Internal    199   100   Excellent
ggacgtagaagaaggtggctgtttctccaggaggattctagccccactcacccctcgcag
gacccacccacacaggcactcctgggatcgatgggcccggggatgaggcggcactgagac
cctgggacccacagctcctagggcctcaaggtgcagttgacacctgcctcccgctcacag
GTGCAGCCTGGCCTCGCTGCTGACCATCGCGCTGCACGGCAAGCTGGAGTACTACACCAG
CATCATGAAGGAGCTGCTGGTGGACCTCATTGACGCCTCGGCCGCCAAGAACCCCAAGCT
CATGCTGCGGCGCACAGAGTCTGTGGTGGAGAAGATGCTCACCAACTGGATGTCCATCTG
CATGTACAGCTGTCTGCGG
gtgaggctgcctggggacagacagagcccaggcgggggacgtggcagggactcagcggca
gtgaccccacggcctcccaggccttccctggcaccctcaggccagctctgccaggaggga
gtgttgcatgagacaggccaggcccgtaggacctgttatgcagagaggggagccatggcc

Exon 27 +      44779      44925   0   Internal    147   100   Excellent
tgtttaatgaacacgagcttagggtccgtggagacaccctggagaggagagtgttgacac
caggatccaaaaggagactgttggaggggttgggggacgggggcgtgaaggtgtttggcc
caaagcatgggggctggaatacagagggggccttggccctgatacccccgtgcccctcag
GAGACGGTGGGGGAGCCATTCTTCCTGCTGCTGTGTGCCATCAAGCAGCAAATCAACAAG
GGCTCCATCGACGCCATCACAGGCAAGGCCCGCTACACACTCAGTGAGGAGTGGCTGCTG
CGGGAGAACATCGAGGCCAAGCCCCGG
gtaagtcggcagggcggggagggtcccagggctgctgtgtcgccgccaacggcattgacc
cagccttcctctgcagggccttgctgcctgggcactgacatagtgatggcagcaactcac
tgacctttctctcccactctccccctgcagaacctgaacgtgtccttccagggctgtggc

Exon 28 +      45076      45232   0   Internal    157   100   Excellent
ctgcgggagaacatcgaggccaagccccgggtaagtcggcagggcggggagggtcccagg
gctgctgtgtcgccgccaacggcattgacccagccttcctctgcagggccttgctgcctg
ggcactgacatagtgatggcagcaactcactgacctttctctcccactctccccctgcag
AACCTGAACGTGTCCTTCCAGGGCTGTGGCATGGACTCGCTGAGCGTGCGGGCCATGGAC
ACCGACACGCTGACACAGGTCAAGGAGAAGATCCTGGAGGCCTTCTGCAAGAATGTGCCC
TACTCCCAGTGGCCGCGTGCAGAGGACGTCGACCTTG
gtgggtgggaatgggggcagagaccccgtgtcaggcgcttcagccggggctggcccctgc
cttgacgggaaacactcctttcacctggcatgggtgcatgaatgtggggacactgagagg
atccaatgaggccccctcagcaagaagctcttactctgtaggagacaagtcctgcagtgt

Exon 29 +      46116      46219   1   Internal    104    99   Excellent
ccagctctttcctgccctccccattttacagatgggaaaatggaggctcagagagaggta
tggcttgcctcagtttacatggagagagcgagaggcctctccctatgtggctgggccggt
acctacccctcaggcccagctccctgcccggaccctgatggcctgtcccttgtcccccag
AGTGGTTCGCCTCCAGCACACAGAGCTACATCCTTCGGGACCTGGACGACACCTCAGTGG
TGGAAGACGGCCGCAAGAAGCTTAACACGCTGGCCCATTACAAG
gtgcagccctgccccccgcccccatttccccaccctcatgcccccaccccaacctccggc
ctctgacctcggcctctcccctcccatcagatccctgaaggtgcctccctggccatgagt
ctcatagacaagaaggacaacacactgggccgaggtagtgcgggtgcacgtgggaaggga

Exon 30 +      46310      46388   0   Internal     79    57    Marginal
agcacacagagctacatccttcgggacctggacgacacctcagtggtggaagacggccgc
aagaagcttaacacgctggcccattacaaggtgcagccctgccccccgcccccatttccc
caccctcatgcccccaccccaacctccggcctctgacctcggcctctcccctcccatcag
ATCCCTGAAGGTGCCTCCCTGGCCATGAGTCTCATAGACAAGAAGGACAACACACTGGGC
CGAGGTAGTGCGGGTGCAC
gtgggaagggagcccaggctgcgtgtggacaggggcttccatcccatgccccagtgggga
agctgaggctccgagaggcagggctggcctgggctgaggcctccttggtgggggctgggc
ggggccagcctcctctgacccagtactgctggggcagggcccacaccaggcctcctcaag

Exon 31 +      47296      47330   1   Internal     35    83        Good
tgactgtctctttggatctctgtctccgtttctgtttctctctccatctttctgtctctg
cttctgtttctctccccatctttctgtcttgtttctgtttctcactccatctttctgtct
tcatttctgtttctctcctctcctctcccgtgtttatttattgtgtttttcctctcacag
TGAAAGACTTGGACACAGAGAAGTATTTCCATTTG
gtgagtgcccaacctcggccccgggggatccagcccctcagtgggtgtggccttggcttt
ctgtggccctgggcctcttgggaaaagtgctcccagccctgcgaaaggctggggggtggg
ggagtagggatggggcccagaatcaggagggaaccacagcccttgtgtgctaagaagcat

Exon 32 +      47585      47689   0   Internal    105   100   Excellent
ctcttgggaaaagtgctcccagccctgcgaaaggctggggggtgggggagtagggatggg
gcccagaatcaggagggaaccacagcccttgtgtgctaagaagcatggcagagccagacc
tcccacaggcggccgaggatggggcctggtgcggacactgaccactgcccggcctcccag
GTGCTGCCTACGGACGAGCTGGCGGAGCCCAAGAAGTCTCACCGGCAGAGCCATCGCAAG
AAGGTGCTCCCGGAAATCTACCTGACCCGCCTGCTCTCCACCAAG
gtgagtccggcctcagtctcccctctgtgcagtgggtacaaggctccagccccagctcca
gagggtcattgctcagggccagctgtgcacccgcggctgggagaggggtgtgagttcttc
ctgtttcccctgtggggctggaggggcaagaggctgaaggcttagggtcccacttgagga

Exon 33 +      48236      48399   0   Internal    164   100   Excellent
ttagtcctttcaacgcctctgggaggcaagtgagccagagaggctcggtgaccagcctga
tgccatgtggcttcctcattcagcagcctggcatttcaagctccgcagagccaccaaggg
tgcccactagccctctgcacgtggcccggggctgacggcggccaccccactcccccgcag
GGCACGTTGCAGAAGTTTCTGGATGACCTGTTCAAGGCCATTCTGAGTATCCGTGAAGAC
AAGCCCCCACTGGCTGTCAAGTACTTTTTCGACTTCCTGGAGGAGCAGGCTGAGAAGAGG
GGAATCTCCGACCCCGACACCCTACACATCTGGAAGACCAACAG
gtggcgggtgggggggccgtgtggacttcactgtgccactggggcccctgtggcaggggg
ttcagagtctagtcttctggcctcgcctgcttggggtcaagccctcctctgccatttccc
agctgtgtgttctcggatgagtgacttagcctctctgtgcttcagtttcccctccactgt

Exon 34 +      49444      49591   2   Internal    148    91   Excellent
gccccactgcaccccagctggccagggataggcaaactaaggttcccaaaggtcacatct
tgtgacaaggctccaacctcaggcccttgagggacaaagccagctctctcctccacaact
gtccctcgactgcttcctaccccaccctaccctcactgtctttgtcaccctaccccacag
CCTTCCTCTCCGGTTCTGGGTGAACATCCTGAAGAACCCCCAGTTTGTCTTTGACATCGA
CAAGACAGACCACATCGACGCCTGCCTTTCAGTCATCGCGCAGGCCTTCATCGACGCCTG
CTCCATCTCTGACCTGCAGCTGGGCAAG
gtcagctgttcccaggaccaggccaggcccatgcacagggccagagtggggtgccgacca
tgggtagcctcctcgactctctgaggctgagctcagagatcttcctgggaggggaaccaa
aagatctcaggtctaggggatgtgggatgagtgactcattcagacagggagacacctaga

Exon 35 +      50796      50936   0   Internal    141   100   Excellent
gagcccctggtctggggccggctgagtgcggggacgttcagtgaccgggtgagactcttt
gggcctcgggggcctgctaaggtcacttatgtggcaggagggatgagggctcatccagaa
aacgaccagatccgtcctttctccagcagccatctaacaccctcgctcttctctgcccag
GATTCGCCAACCAACAAGCTCCTCTACGCCAAGGAGATTCCTGAGTACCGGAAGATCGTG
CAGCGCTACTACAAGCAGATCCAGGACATGACGCCGCTCAGCGAGCAAGAGATGAATGCC
CATCTGGCCGAGGAGTCGAGG
gtgcggtggctcggcggcgggggatgggggcctgaagagctgagggatcgggggtcgggg
gctgggcctcaatgcctccactggagtaagggcagggagcgcagagggcatttcagaagt
ggctgtggcctcttgctggcctgcaaattcgtcatgcattttcccagagtttgaggagcg

Exon 36 +      51328      51402   0   Internal     75   100   Excellent
agattggacttcagggtccgggaagccgtcttcgtccatgggacttgaggggcctcatcg
ctgaactgttctgtgggggccgtggggagttggggattgtgtgcaagcagctggctttgc
tgggactaggctcagctttgaccgctgggctaacctcctccccatcctgcctccttatag
AAATACCAGAATGAGTTCAACACCAATGTGGCCATGGCAGAGATTTATAAGTACGCCAAG
AGGTATCGGCCGCAG
gtgagtgccccagggtgaggcacctgccctcggggtaggtgagcttcctactcaaggaca
cacatctcagggtgcttgcccctaatggacggatgtcactcgtggtagacgttcaggggt
gtgttctctcccacgaactgaggcagggctaccggccatggcccggctgactccgctgct

Exon 37 +      51591      51707   0   Terminal    117   100   Excellent
cccagggtgaggcacctgccctcggggtaggtgagcttcctactcaaggacacacatctc
agggtgcttgcccctaatggacggatgtcactcgtggtagacgttcaggggtgtgttctc
tcccacgaactgaggcagggctaccggccatggcccggctgactccgctgctcccctcag
ATCATGGCCGCGCTGGAGGCCAACCCCACGGCCCGGAGGACACAACTGCAGCACAAGTTT
GAGCAGGTGGTGGCTTTGATGGAGGACAACATCTACGAGTGCTACAGTGAGGCCTGA
gacacatggagagttggtcaggctgctgctgggagaaatggacgcccactgggcctcaac
ttgatcttctaccccgtgcctgtgactcagactgggaaatactgagcagagacggctggg
gcgggggcaggaggaggggctgctctctgagacaggggcgcccccgccttgacccctggg

--------------------------------------------------------------------------------