--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (22762 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (30 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       2307   0    Initial   1107    80        Good
ggtcctggggtcatcctggacatagtgcctatctaagaagcctggtcctcctctgctcac
cccctaggttaggaggagcatcttggcaatgccacagtcctatcccttaccagtggcccc
agggtgctctggcggccacgtgagccccactctctcgacctctcttcctgccaggtgacc
ATGCCTGCTCTGGGCCCAGCTCTTCTCCAGGCTCTCTGGGCCGGGTGGGTCCTCACCCTC
CAGCCCCTTCCACCAACTGCATTCACTCCCAATGGCACGTATCTGCAGCACCTGGCAAGG
GACCCCACCTCAGGCACCCTCTACCTGGGGGCTACCAACTTCCTGTTCCAGCTGAGCCCT
GGGCTGCAGCTGGAGGCCACAGTGTCCACCGGCCCTGTGCTAGACAGCAGGGACTGCCTG
CCACCTGTGATGCCTGATGAGTGCCCCCAGGCCCAGCCTACCAACAACCCGAATCAGCTG
CTCCTGGTGAGCCCAGGGGCCCTGGTGGTATGCGGGAGCGTGCACCAGGGGGTCTGTGAA
CAGCGGCGCCTGGGGCAGCTCGAGCAGCTGCTGCTGCGGCCAGAGCGGCCTGGGGACACA
CAATATGTGGCTGCCAATGATCCTGCGGTCAGCACGGTGGGGCTGGTAGCCCAGGGCTTG
GCAGGGGAGCCCCTCCTGTTTGTGGGGCGAGGATACACCAGCAGGGGTGTGGGGGGTGGC
ATTCCACCCATCACAACCCGGGCCCTGTGGCCGCCCGACCCCCAAGCTGCCTTCTCCTAT
GAGGAGACAGCCAAGCTGGCAGTGGGCCGCCTCTCCGAGTACAGCCACCACTTCGTGAGT
GCCTTTGCACGTGGGGCCAGCGCCTACTTCCTGTTCCTGCGGCGGGACCTGCAGGCTCAG
TCTAGAGCTTTTCGTGCCTATGTATCTCGAGTGTGTCTCCGGGACCAGCACTACTACTCC
TATGTGGAGTTGCCTCTGGCCTGCGAAGGTGGCCGCTACGGGCTGATCCAGGCTGCAGCT
GTGGCCACGTCCAGGGAGGTGGCGCATGGGGAGGTGCTCTTTGCAGCTTTCTCCTCGGCT
GCACCCCCCACTGTGGGCCGGCCCCCATCGGCGGCTGCTGGGGCATCTGGAGCCTCTGCC
CTCTGTGCCTTCCCCCTGGATGAGGTGGACCGGCTTGCTAATCGCACGCGAGATGCCTGC
TACACCCGGGAGGGTCGTGCTGAGGATGGGACCGAGGTGGCCTACATCGAGTATGATGTC
AATTCTGACTGTGCACAGCTGCCAGTG
gtgagttccagtattgccccacttttccgcctctctgaggccactggccaagcatttgca
gccaaggagctgcccagagagtccgagggcagctggtggtagcacgaggatgatcagatc
agcaaatattaagtgcttcctatgttgcctgggcagtggaagggtaccttaccacaaatc

Exon  2 +       2865       3047   0   Internal    183    91   Excellent
aaaaagggaagagagactgggggcggggatgaggttgtcccaggagggccagcagagaaa
acacagttgtacagggagagctaccagagcggctgggggagggaatgaggttgtccaggg
acgatgcggccgaggaggttatccagggagggccttcctgatgcttcttgctgcctatag
GACACCCTGGATGCTTATCCCTGTGGCTCAGACCACACGCCCAGCCCCATGGCCAGCCGG
GTCCCGCTGGAAGCCACACCAATTCTGGAGTGGCCAGGGATTCAGCTAACAGCTGTGGCA
GTCACCATGGAAGATGGACACACCATCGCTTTCCTGGGTGATAGTCAAGGGCAGCTGCAC
AGG
gtgagcccacaggaagtactggcccctgccccagagtctggagggaacagattgctaggg
acccagcctggtttaagctatccctgtgacccctgggccaggagagatgacctgagctcc
tctccccaggactgggtggtgtttacctgtgactttcctccatccccgctaggccagttg

Exon  3 +       3353       3554   0   Internal    202   100   Excellent
ccaggactgggtggtgtttacctgtgactttcctccatccccgctaggccagttggtatg
acctgtgactgcctaggaggaaattctatttgtaaattacttcgattgggtggaggaggg
gagggctttgggcctctggccatggacttgggtcccagaccctgtggtctctgatcccag
GTCTACTTGGGCCCAGGGAGCGATGGCCACCCATACTCCACACAGAGCATCCAGCAGGGG
TCTGCAGTGAGCAGAGACCTCACCTTTGATGGGACCTTTGAGCACCTGTATGTCATGACC
CAGAGCACAGTGAGTGCCAGGCACAAGCCAGGGCATGACTGCTGGGAGGGGCCTCTGGGT
GGGGCCAGGGACCCACTTGTGG
gtgagccactggtgtttggattgctggcctcaggtcctctttgctgtcacagcttctgaa
ggttcctgtggcttcctgtgctcagcacctggactgtgcatcttgccttgctcacaggga
cccatactgtgggtggtgcgtgctccttggcaggtcagatttctgaccccatcccagccc

Exon  4 +       4856       4964   1   Internal    109    98   Excellent
gaatggatgcctttctctgggtcctcccactccccaaccacctgaagcctccattctgtg
cccttggactgtattccctcatcctgggtcctcttccccattcaagggctcaggatatcg
gctctgggtctgagtgcacctccttgctgcttaaccctggccctctctccccctctgcag
ACTACGTATCCGTGAGCGTGGAGCTCAGATTTGGCGCTGTTGTGATCGCCAAAACTTCCC
TCTCTTTCTATGACTGTGTGGCGGTCACTGAACTCCGCCCATCTGCGCA
gtgagttcctcgccctgtccccaggcctgggcttccctgtggcgacccttgccccatggc
tgtgctctgtgcaggtgccaggcctgtgtgagcagccgctgggggtgtaactggtgtgtc
tggcagcacctgtgcacccacaaggcctcgtgtgatgctgggcccatggttgcaagccat

Exon  5 +       5815       6235   2   Internal    421    88        Good
ccctgctcctgacacccttcccgtggagcctggggctccctccacagccacagcttcgga
catctcacctggggctagtccttccctgctcagcccctgggggccatgggcaggttctgg
ctccatatcttcccctggctccacagggtcgcctctccatgaggagccctcccctcccag
CCCCCAAAATGGACCTGGAACCGCTGTCCCTGCCCCCACTGACTTCAGACCCTCAGCCAC
ACCTGAGGACCTCTTGGCCTCCCCGCTGTCACCGTCAGAGGTAGCAGCAGTGCCCCCTGC
AGACCCTGGCCCCGAGGCTCTTCATCCCACAGTGCCCCTGGACCTGCCCCCTGCCACTGT
TCCTGCCACCACTTTCCCAGGGGCCATGGGCTCCGTGAAGCCCGCCCTGGACTGGCTCAC
GAGAGAAGGCGGCGAGCTGCCCGAGGCGGACGAGTGGACGGGGGGTGACGCACCCGCCTT
CTCCACTTCCACCCTCCTCTCAGGTGATGGAGACTCAGCAGAGCTTGAGGGCCCTCCCGC
CCCCCTCATCCTCCCGTCCAGCCTCGACTACCAGTATGACACCCCCGGGCTCTGGGAGCT
G
gtgaggcccagcccaggaaggaggcctcaggggaggggatgtggggaagatgctacccct
agcttgccttgtgattctgcactgggaggaggtgaggggcagggtggagtctgcagcccc
acaccggccttgcctctggaatctggcaaggcagagggctgagctgggcagggtgggctc

Exon  6 +       6446       6568   0   Internal    123    99   Excellent
gggaggggatgtggggaagatgctacccctagcttgccttgtgattctgcactgggagga
ggtgaggggcagggtggagtctgcagccccacaccggccttgcctctggaatctggcaag
gcagagggctgagctgggcagggtgggctccatagactgccttgcccttggtgcctgcag
GAAGAGGCGACCTTGGGGGCAAGCTCCTGCCCCTGTGTGGAGAGCGTTCAGGGCTCCACG
TTGATGCCGGTCCATGTGGAGCGGGAAATCCGGCTGCTAGGCAGGAACCTGCACCTTTTC
CAG
gtcagtgtgtcctgcctgccgctgtccttgcagcctccttagctgttgagaaactctgca
caagccctggggagcaggaggagggcagagtccgagggctcaactccaacccagaagctg
tgctgggggatctgttgggtgacctgcaggactccctgggcccagctcctgaagctgccc

Exon  7 +       6773       6916   0   Internal    144    76        Good
tccttgcagcctccttagctgttgagaaactctgcacaagccctggggagcaggaggagg
gcagagtccgagggctcaactccaacccagaagctgtgctgggggatctgttgggtgacc
tgcaggactccctgggcccagctcctgaagctgcccaacagctgtgttctctgccctcag
GATGGCCCAGGAGACAATGAGTGTGTGATGGAGCTGGAGGGCCTCGAGGTGGTGGTTGAG
GCCCGGGTCGAGTGTGAGCCACCTCCAGATACCCAGTGCCATGTCACCTGCCAGCAGCAC
CAGGTGCACACCATGAGCGCCTGG
gtgggcacgggtgcactgcactggccacaggctggctgccaactgtagctggctgcacca
cactttccagagccacgctctgaccgtgtcgccctgagggagtctccacacccatttctg
acctctgaccatgtgccccgtggagtccttgcatcccagctctgaactctaacttgagac

Exon  8 +       7270       7363   0   Internal     94    94   Excellent
ttgagaccccatggggtccccatactccatttctggctctgccctccaacttgtggcccc
atggggtccctctgaccctatgctcctaactggtcgttttagtcctttctctgactaacc
cctccccaggcctgacacttcccccagtgcttgactctgaacccactcccatttctccag
CTCAGCTATGAGGCTCTGCAGCCGGAGCTCCGTGTGGGGCTGTTTCTGCGTCGGGCCGGC
CGTCTGCGTGTGGACAGTGCTGAGGGGCTGCATG
gtgagccacctgcgggctgctgggctggcggtggtagcagggctctcccaggcctgcctc
tcacgtgtgtctctgccacccccagtggtactgtatgactgttccgtgggacatggagac
tgcagccgctgccaaactgccatgccccagtatggctgtgtgtggtgtgagggggagcgt

Exon  9 +       7775       7901   1   Internal    127    98   Excellent
cagtgcccagcgcccctcatccactcggtttgttgaaaggctggccatcccttcctcagt
gctgcccttagagggagggtgtgggggcccaaaggtgggaggttggggctgcctttccag
ttgagtagaggtgagcagtccttgtcctggaacaggtggagccactgactgggcctgtag
ACGGAGGCACCCGTGTCACCATCAGGGGCTCCAACCTGGGCCAGCATGTGCAGGATGTGC
TGGGCATGGTCACGGTGGCTGGAGTGCCCTGTGCTGTGGATGCCCAGGAGTACGAGGTCT
CCAGCAG
gtaagctggctgcacccagcaggagcacggcgcagcctggggcctccgcggttggcgttg
ctgcttggggcctcccacccaccgctcatctgcccccctctctccctgttccttgatcct
ggccacaatgcccgagtgccagcgttgccactgaagaccctgagcacccaccacacctgt

Exon 10 +       9361       9466   2   Internal    106    83        Good
ccaaggccttctgatgtgtcataaagaattccctccaaagtgagagagggtctctgtcaa
tcttatggagcatgggaaggggaagaccacctgacagtagggcagggagaggggctgcca
ggtaagcttgaggggcccttgatgcagcctggcaccccctagcctgccctgtgcctacag
CCTCGTGTGCATCACCGGGGCCAGTGGGGAGGAGGTGGCCGGCGCCACAGCGGTGGAGGT
GCCGGGAAGAGGACGTGGTGTCTCAGAACACGACTTTGCCTACCAG
gtacctgactgctgagccacccccagctgccagcgggccaacctctctggtggctcctct
caacccatctggttattccttggtggggctcccagtcctgggccagcctgtctctcaggc
tgtccctgcctccatgtgtctggtctgatgctcatctctctccctgtctgtcccacagga

Exon 11 +       9645       9781   0   Internal    137    85        Good
aggtacctgactgctgagccacccccagctgccagcgggccaacctctctggtggctcct
ctcaacccatctggttattccttggtggggctcccagtcctgggccagcctgtctctcag
gctgtccctgcctccatgtgtctggtctgatgctcatctctctccctgtctgtcccacag
GATCCGAAGGTCCATTCCATCTTCCCGGCCCGCGGCCCCAGAGCTGGGGGCACCCGTCTC
ACCCTGAATGGCTCCAAGCTCCTGACTGGGCGGCTGGAGGACATCCGAGTGGTGGTTGGA
GACCAGCCTTGTCACTT
gtgagggccacttcctcatcctgcaaaaatccatctgctccaggggaaagatggaggggt
ctgagatcctggggagagcagaaaggggaagagggccagtctgctccttcagagagtggc
cagaccctccctagccagctgtggtgggagtgcacctccagggacacctggtggagactg

Exon 12 +      10053      10260   2   Internal    208    87        Good
agggccagtctgctccttcagagagtggccagaccctccctagccagctgtggtgggagt
gcacctccagggacacctggtggagactgcagtcagcgcttgagggaagccagttggggc
ctgagtggtccaagttttccctgcctgcgcccctgcattcattcccacctcccctcccag
GCTGCCGGAGCAGCAGTCAGAACAACTGCGGTGTGAGACCAGCCCACGCCCCACGCCTGC
CACGCTCCCTGTGGCTGTGTGGTTTGGGGCCACGGAGCGGAGGCTTCAACGCGGACAGTT
CAAGTATACCTTGGACCCCAACATCACCTCTGCTGGCCCCACCAAGAGCTTCCTCAGGTG
TTGGGCCAGGGGTGTGGCTGCATGGCAG
gtggcagggaggtctttgcagctccactatgtgggggtttgtagggctttatgttgaggc
actgagaatcccatgctgctagtaggggcaaggggtcgtgtggtttggggctggggctga
gctgacctagccgggactgggctgtgctttaggtccaggtaacataagccatcttacgtt

Exon 13 +      10771      11013   0   Internal    243    87        Good
cccggagacggcatgttcccttggaccctcctgcagtagccagcaagtaggacacccttg
ggtacccccacactctccccttgccccataccacaccctggggacagccagagcaggtgc
cagaggaggctcttcccatctttgcttggcccctcgtcaacctgcctgtcttccttccag
TTTGAGGAGCCGTGCCATGTCAACTCCTCCCAGCTCATCACGTGCCGCACACCTGCCCTC
CCAGGCCTGCCTGAGGACCCCTGGGTCCGGGTGGAATTTATCCTTGACAACCTGGTCTTT
GACTTTGCAACACTGAACCCCACACCTTTCTCCTATGAGGCCGACCCCACCCTGCAGCCA
CTCAACCCTGAGGACCCCACCATGCCATTCCGGCACAAGCCTGGGAGTGTGTTCTCCGTG
GAG
gtacagctcctacttggacctggcagggccccgagacccttcccttggctggacagcact
gctgtgtgtggcggagaggccgagacagtagagcaagggccggtggatggacatggctcc
tcatccttgctgtggtgggggcagagggggctggtggggggtgcctagcctagcatctgg

Exon 14 +      11741      11917   0   Internal    177    99   Excellent
aacaaagggtgatgaggagcagcttggaggacactgtgtgactggcctgcactcgggaag
ggtgctgagaggctgtcagctttgctgctgcggctgggtctcagggtccttcccacattt
ggggaggacaggatctgagggaagggtcctgagtgactgatcggtgaccctctgttccag
GGGGAGAACCTGGACCTTGCAATGTCCAAGGAGGAGGTGGTGGCTATGATAGGGGATGGC
CCCTGTGTGGTGAAGACGCTGACGCGGCACCACCTGTACTGCGAGCCCCCCGTGGAGCAG
CCCCTGCCACGGCACCATGCCCTCCGAGAGGCACCTGACTCTTTGCCTGAGTTCACG
gtcagtgggcaggtccctggccgggctgggcattgacctgggccaaacccttgctcacag
gtggctcctgacacaggtgcagatggggaacttgcgcttctccctgggtcacgtgcagta
tgacggcgagagccctggggcttttcctgtggcagcccaggtgggcttgggggtgggcac

Exon 15 +      12036      12142   0   Internal    107    84        Good
agcagcccctgccacggcaccatgccctccgagaggcacctgactctttgcctgagttca
cggtcagtgggcaggtccctggccgggctgggcattgacctgggccaaacccttgctcac
aggtggctcctgacacaggtgcagatggggaacttgcgcttctccctgggtcacgtgcag
TATGACGGCGAGAGCCCTGGGGCTTTTCCTGTGGCAGCCCAGGTGGGCTTGGGGGTGGGC
ACCTCTCTTCTGGCTCTGGGTGTCATCATCATTGTCCTCATGTACAG
gtgggtgcagccagatgtggctgggctggggcaggtcgtgggatctggctggactgggaa
gggacagaccgggccaggagtcaggaaacattctctgtaaatggccagagagtaaatatt
ttcgctttgcaggccaagtggtctctgttcaacaactcagctttgccactgtggcacaaa

Exon 16 +      12643      12743   2   Internal    101   100   Excellent
ggtgtgtgtgacttgcttgggacgggacaggctgaatcgtactgggctaggcttgagctt
ggctggcatggctgcattggactgtgctggatgaggccggggtgtgcctggggattgtca
ggcaggcctgggcgagtaggactcatctggccatcctctcctgaccctggggctgagcag
GAGGAAGAGCAAGCAGGCCCTGAGGGACTATAAGAAGGTTCAGATCCAGCTGGAGAATCT
GGAGAGCAGTGTGCGGGACCGCTGCAAGAAGGAATTCACAG
gtgtggctgggagaatgggccccgccctccagaactctgcccaaacccactcccatcaca
cgggattggtgcttaacaggtgcttaacctggcctcttctgcttaacagacctcatgact
gagatgaccgatctcaccagtgacctcctgggcagcggcatccccttcctcgactacaag

Exon 17 +      12853      13070   1   Internal    218    99   Excellent
taagaaggttcagatccagctggagaatctggagagcagtgtgcgggaccgctgcaagaa
ggaattcacaggtgtggctgggagaatgggccccgccctccagaactctgcccaaaccca
ctcccatcacacgggattggtgcttaacaggtgcttaacctggcctcttctgcttaacag
ACCTCATGACTGAGATGACCGATCTCACCAGTGACCTCCTGGGCAGCGGCATCCCCTTCC
TCGACTACAAGGTGTATGCGGAGAGGATCTTCTTCCCTGGGCACCGCGAGTCGCCCTTGC
ACCGGGACCTGGGTGTGCCTGAGAGCAGACGGCCCACTGTGGAGCAAGGGCTGGGGCAGC
TCTCTAACCTGCTCAACAGCAAGCTCTTCCTCACCAAG
gtacccccagctgcatcttcctggcctgcccctggccctgccccttctccagggcatggt
ttctgagcccgcccctctgtccccctaaaccccttttcccatcccttctctttggctgca
gttcatccacacgctggagagccagcgcaccttttcagctcgggaccgtgcctacgtggc

Exon 18 +      13192      13370   0   Internal    179   100   Excellent
tggagcaagggctggggcagctctctaacctgctcaacagcaagctcttcctcaccaagg
tacccccagctgcatcttcctggcctgcccctggccctgccccttctccagggcatggtt
tctgagcccgcccctctgtccccctaaaccccttttcccatcccttctctttggctgcag
TTCATCCACACGCTGGAGAGCCAGCGCACCTTTTCAGCTCGGGACCGTGCCTACGTGGCA
TCTCTGCTCACCGTGGCACTGCATGGGAAGCTTGAGTATTTCACTGACATCCTCCGCACT
CTGCTCAGTGACCTGGTTGCCCAGTATGTGGCCAAGAACCCCAAGCTGATGCTGCGCAG
gtctgtgtggctgttggggctgggtgggccctggacagctggagctggggtggggcctcg
ggctggggggtctgcaggatagagaggcccgcagccccacctgctgaccctggcactccc
ctttcccatcatctcaggacagagactgtggtggagaagctgctcaccaactggatgtcc

Exon 19 +      13508      13574   2   Internal     67   100   Excellent
ttgcccagtatgtggccaagaaccccaagctgatgctgcgcaggtctgtgtggctgttgg
ggctgggtgggccctggacagctggagctggggtggggcctcgggctggggggtctgcag
gatagagaggcccgcagccccacctgctgaccctggcactcccctttcccatcatctcag
GACAGAGACTGTGGTGGAGAAGCTGCTCACCAACTGGATGTCCATCTGTCTGTATACCTT
CGTGAGG
gtgagggggcagaggtggacagggctcctgtccagggagggtcaggccctccaaacttct
aagccctcagccaccatgcagctcggacacttgtgccagagcagagactcctgctcagcc
tgtcctcagtccccttaagcccatgtcctgtccccttccccagtgtgcgtcatgtcccat

Exon 20 +      13803      13988   0   Internal    186   100   Excellent
ctccaaacttctaagccctcagccaccatgcagctcggacacttgtgccagagcagagac
tcctgctcagcctgtcctcagtccccttaagcccatgtcctgtccccttccccagtgtgc
gtcatgtcccatacacctctgccacctgctggggggccctaactgcctgtgctctcctag
GACTCCGTAGGGGAGCCTCTGTACATGCTCTTTCGAGGGATTAAGCACCAAGTGGATAAG
GGGCCAGTGGACAGTGTGACAGGCAAGGCCAAATACACCTTGAACGACAACCGCCTGCTC
AGAGAGGATGTGGAGTACCGTCCCCTGGTGAGGGTGTGCAAGTGTGTGGCCTGCAGTCTG
AGTGCG
gtgagggcgagggtggagagtgtgtgggtgtgtggggtctggacaccagcttctgatgtg
gtacctggatgtagagctgggttgacctctggctggctcctggagagagcccatcagact
agcttagcaggatagcagtttagggcagactttgatgataaggcctctatgtgccccagg

Exon 21 +      14813      14944   1   Internal    132    70        Good
aggtgaagagacgagaattagggattgtgtggtgcgtggggattggaggcagcagtttct
catgagttgtctctgcccttggcctgtgtcttggtcatcctgagtgcacatgaaccctga
tggctcctgtgtgtcctgcacagaccttgaatgcactattggctgtggggcctggggcag
GAGAGGCCCAGGGCGTGCCCGTGAAGGTCCTAGACTGTGACACCATCTCCCAGGCAAAGG
AGAAGATGCTGGACCAGCTTTATAAAGGAGTGCCTCTCACCCAGCGGCCAGACCCTCGCA
CCCTTGATGTTG
gtgagggcgtggagagcccctggggacctgagccactgttgggcctgggctggccccgga
ccaactctgcagggacaactcatcactcagggtggggaggatgctgggaggcaggcagaa
gctggctttggaacatctttcttggacagcctctcatctggggagggggtccctgctctt

Exon 22 +      15254      15357   1   Internal    104    59    Marginal
ggaacatctttcttggacagcctctcatctggggagggggtccctgctcttggtctttgg
agaggttgagtaaggctgccccatgatggaggggctggtgtccctgtggaggaggagatg
ggctccactatgggaagggtatcttccagccctgcacccagttctgccttgcccttgcag
AGTGGCGGTCTGGGGTGGCCGGGCACCTCATTCTTTCTGACGAGGATGTCACTTCTGAGG
TCCAGGGTCTGTGGAGGCGCCTGAACACACTGCAGCATTACAAG
gtaggaggagtgggagctggaggagggcatggtggggtgggactggtggagggatcacca
gctgtgctcagcaggtcccagatggagcaactgtggccctcgtcccctgcctcaccaagc
atgtgctccgggaaaaccaggattatgtccctggagagcgtgagtaccgctcccatcacg

Exon 23 +      15735      15907   1   Internal    173    87        Good
tgcccagcccggagtcatggggaaggtcctctgggcctcagggcaggcttgtgcctattt
ccattcggcccaggaaatccctcaaccaggtgcccccacccctgggagagctggcaagaa
acagggggcctggggaggtggcacctggggaggggtgacagctgtgggctcttggcacag
GGACCCCAATGCTGGAGGATGTAGATGAGGGGGGCATCCGGCCCTGGCACCTGGTGAAGC
CAAGTGATGAGCCGGAGCCGCCCAGGCCTCGGAGGGGCAGCCTTCGGGGCGGGGAGCGTG
AGCGCGCCAAGGCCATCCCTGAGATCTACCTGACCCGCCTGCTGTCCATGAAG
gtggggtggggcctgccaaggtagtggggcctgggctgagagggagcatggccactcgtg
ggatttgggggtggtgtggggctcgtgcaggcacagtgccggggggtgtctgaggctggg
ctgctgctgagggccctttgctgaccacacctctctgcttcttccttcccacagggcacc

Exon 24 +      16082      16242   0   Internal    161   100   Excellent
atgaaggtggggtggggcctgccaaggtagtggggcctgggctgagagggagcatggcca
ctcgtgggatttgggggtggtgtggggctcgtgcaggcacagtgccggggggtgtctgag
gctgggctgctgctgagggccctttgctgaccacacctctctgcttcttccttcccacag
GGCACCCTGCAGAAGTTCGTGGATGACCTGTTCCAGGTGATTCTCAGCACCAGCCGCCCC
GTGCCGCTCGCTGTGAAGTACTTCTTTGACCTGCTGGATGAGCAGGCCCAGCAGCATGGC
ATCTCCGACCAGGACACCATCCACATCTGGAAGACCAACAG
gtggggtggagctgggtgggctctaggtgtgtgtggggggtcttctcttctgcctcccca
gcacattcatcggccatgcctgccccacccgcagcttgcctctgaggttctggatcaata
taataaaaaacccgcagtttgtgttcgacgtgcaaacatctgataacatggatgcggtgc

Exon 25 +      16304      16643   2   Terminal    340   100   Excellent
ctcagcaccagccgccccgtgccgctcgctgtgaagtacttctttgacctgctggatgag
caggcccagcagcatggcatctccgaccaggacaccatccacatctggaagaccaacagg
tggggtggagctgggtgggctctaggtgtgtgtggggggtcttctcttctgcctccccag
CACATTCATCGGCCATGCCTGCCCCACCCGCAGCTTGCCTCTGAGGTTCTGGATCAATAT
AATAAAAAACCCGCAGTTTGTGTTCGACGTGCAAACATCTGATAACATGGATGCGGTGCT
CCTTGTCATTGCACAGACCTTCATGGACGCCTGCACCCTGGCCGACCACAAGCTGGGCCG
GGTGAGCGAGTCTGGGATGGACACGGGGGGGATGGGTGAGGGTGGACAGTGCTGTGTGTG
CACTCAGATTCCAGGCTTTTCTGAGAACTTCAAGGAGGGCTTAGGGGAGACCTCTGACCT
CCCAAGCCAAGGCTTCATCCCGGGGCCACCTCAGTTTTAA
gggatgagcaagaggaggggacactgtgtgccaattcacaggtgaagttgtgtgcagcaa
gtacagcctggtgtggctggggcatagaatgctggccaggcgtggcagtaggccagggcc
agttggtcaggactcactcctggggcagtgggagccacagaaggtctgggaacagggaag

Exon 26 +      18476      18547   0    Initial     72    58    Marginal
cagacctgcttgaaatcctagctcagccactggggagagaggtggtctgtggccgcttag
gtaatgttctgggtctgtttgctcatttttaaaatgatgaccctgggagtgaacagcatg
cgtcctgccctacgtaccgggctcttgctggatctagatggtggcatgtggagctgagaa
ATGATTTCCGATGACATCAGAGACTGGACATTGGTGGAAGGGAGGGAGCAGCAGAGGCTC
CTGCGGAAGGAA
gtaggcgagggtgaccacctgtcctggttttccgggactcaggggcttcctgggatgtga
gacttttccttttcaaaactgaagcagtactgggaaacccaggacacttgatcactcgaa
cagggaccctcatccttccttccttcctcttttgctgtcctcctgctatgtccaggactc

Exon 27 +      18723      18802   0   Internal     80   100   Excellent
aggaagtaggcgagggtgaccacctgtcctggttttccgggactcaggggcttcctggga
tgtgagacttttccttttcaaaactgaagcagtactgggaaacccaggacacttgatcac
tcgaacagggaccctcatccttccttccttcctcttttgctgtcctcctgctatgtccag
GACTCCCCGATCAACAAACTTCTGTATGCACGGGACATTCCCCGGTACAAGCGGATGGTG
GAAAGGTACTGGAGGGCACG
gtgggtagaggttggagggcgtgtgcagctgaggcttggggggtgggctctggttgggag
caggggagtgggcttgtttacccagcagctgctgtgccctggctctctggcaggtactat
gcagacatcagacagactgtcccagccagcgaccaagagatgaactctgtcctggctgaa

Exon 28 +      18916      18991   2   Internal     76    89        Good
acaaacttctgtatgcacgggacattccccggtacaagcggatggtggaaaggtactgga
gggcacggtgggtagaggttggagggcgtgtgcagctgaggcttggggggtgggctctgg
ttgggagcaggggagtgggcttgtttacccagcagctgctgtgccctggctctctggcag
GTACTATGCAGACATCAGACAGACTGTCCCAGCCAGCGACCAAGAGATGAACTCTGTCCT
GGCTGAACTGTCCTGG
gtaaggcctccctctgcttcttgggttgggcataggcctcctgccacaacggtccttccc
ccttcacactgcccctttgcagggaagcccttgggaacctcagcagccctgtgagctggt
tggggcaggaaacataaatgcagaatgttccaactgccactgaaagaccagggctcccac

Exon 29 +      20016      20090   0   Internal     75   100   Excellent
gcacacctggcctggggtccctgggccatggaggggactctgcttcccactgtagtgccc
atcccattctctacctctcaggtccccttctcccccagcccttccctggggtcctgggct
gcctcctgtggctctctgcacccctcgtctctctcacctttcatttggcctcttccctag
AACTACTCCGGAGACCTCGGGGCGCGAGTGGCCCTGCATGAACTCTACAAGTACATCAAC
AAGTACTATGACCAG
gtgggcaggccctggaccccgactgggaggctgacccaaggcctcccaggagacttaagg
ggctctgaccctgtgactcacgttgggggctttggtcttccccagggacagagtagtggg
gggccgggccccttggtggcttgagaagtgttttccaggcgggcttcctggcattggctg

Exon 30 +      21224      21328   0   Terminal    105    88        Good
gatgttattacccctcccgccagcgaggccctgaggtcccagaaagtacgtgaagtgacc
ggctgggtttcttggcctcctaccccactcatgccacagcgtcttaggagggctgttgaa
ttttgcagcaaacacgttggccaaagaagtctcccctgatggcattggtctctgtttcag
ATCATCACTGCCCTGGAGGAGGATGGCACGGCCCAGAAGATGCAGCTGGGCTATCGGCTC
CAGCAGATTGCAGCTGCTGTGGAAAACAAGGTCACAGATCTATAG
gaacccaggagccacggcctgctgttgcttcagcctggcctgggcagccctggaagctcg
gaggagaggccaccttcttaggtgcctgtagtgactgacaagcagagttagtggaaggtg
actcccagtctcctggtggctctggcctcggccctgctggatccacctcctagacccggg

--------------------------------------------------------------------------------