--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (40401 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (11 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3442       3569   0   Internal    128    54    Marginal
caccacaggagaagccttaactactgcatgagttaccacaagtcacacatacaaccagct
ccctgttacagggctggagtccctggacccaggaaataccacctccaaggactgtgggag
ctggggactatgggaactgggatcaactcagtcctgattccttttggcctgctgggttag
TGCTGGCAGCCCCCTGAGGCCAAGGACAGCAGCATGACAGTCACCAGGACTCACCACTTC
AAGGAGGGGTCCCTCAGAGCACCTGCCATACCCCTGCACAGTGCTGCGGCTGAGTTGGCT
TCAAACCA
gtgagttttctacctctactattgaaagggcaccttgtcccacagaaccgagtcttgcct
gcatgtggtcagtgccaccaggtccttcttctctccactttacagcccagctcggctgaa
gctatggccagaggcactgctttaaggccactccatatctaggacaggtcaacagacacc

Exon  2 +      12600      12688   0    Initial     89    43    Marginal
tcaggagtttgagaccagcctggccaacatggtgaaaccccatctctactaaaaatacaa
aaattagatgtggagttcagagtggaaacaggtgtgagagggttcaacagaagaaaacat
agctgccaagtgtttgagtccatcggcaagtttggactggccttagctgttgcagaaggc
ATGGTGAACTCTGCCTTATATAACATGGATGCTGGGCACAGAACTGTCATCTTTGACCGA
TTCTGTGGAGTACAGGACATTGTGGTAGG
gtaagggactcactttctcataccatgggtacagaaaccaattatctttgaccaccgttc
tcaaccacataatgtgccagtcatcactggtagcaaagatttacagaatgtcaatatcat
tccgtgcatcctctttgggcctgtcactagccagcttcctcgcatcttcaccaggatcgg

Exon  3 +      12863      13097   2   Internal    235    92   Excellent
ggtagggtaagggactcactttctcataccatgggtacagaaaccaattatctttgacca
ccgttctcaaccacataatgtgccagtcatcactggtagcaaagatttacagaatgtcaa
tatcattccgtgcatcctctttgggcctgtcactagccagcttcctcgcatcttcaccag
GATCGGAGAAGACTATGATGAGCGTGTGCTGCCATCCATCACTACTGAGATCCTCAAGTC
AGTGGTGGCTCGCTTTGATGCTGGAGAACTAATCACCCAGAGAGAACTGGTCTCCAGGCA
GGTGAGCGACGACCTTATGGAGCGAGCAGCCACCTTTGGGCTCATCCTGGATGATGTGTC
TTTGACACATCTGACCTTCAGGAAGGAGTTCACAGAAGCAGTGGAAGCCAAACAG
gtggctcagcaggatgcagagagggccagaactcactggccactgcaggggacggcctga
tggagctgtgcaagctggaagctgcagaggacatcacgtaccagctctctcgctcttgga
acatcaccaatctgccggcagggcagtccgtgctcctccagctgccccagtgagggccca

Exon  4 +      13146      13266   1   Internal    121    98   Excellent
gaactggtctccaggcaggtgagcgacgaccttatggagcgagcagccacctttgggctc
atcctggatgatgtgtctttgacacatctgaccttcaggaaggagttcacagaagcagtg
gaagccaaacaggtggctcagcaggatgcagagagggccagaactcactggccactgcag
GGGACGGCCTGATGGAGCTGTGCAAGCTGGAAGCTGCAGAGGACATCACGTACCAGCTCT
CTCGCTCTTGGAACATCACCAATCTGCCGGCAGGGCAGTCCGTGCTCCTCCAGCTGCCCC
A
gtgagggcccaccctgcctgcacctccatgggccaactaggccacagccccagtgattct
taacactgccttccttctgcctccactccagaaatcactgtgaaatttcatgattggctt
aaagtgaaggaaatacagataaaatcacttcagatctcaaaaaagaaaaaaaaaatttag

Exon  5 +      27946      28168   2   Terminal    223    84        Good
tacagctctctttataacaattccaacccccattccccgctttttttccccatgagaggt
cagctcccgagttcacaggcccaaatgtgagtgatgcatagaagggacagagtgtttcct
ctgaggcctctacacatccctgtccagtcttttcattctctgtggttttctcatttctag
TCCAAGAGGCCCAGAAGCAAACCTGGAGGTGAGACCCAAAGAAAGCTGGAACCATGCTGA
CTTTGTACACTGTGAGGACACAGAGTCTGTTCCTGGAAAGCCCAGTGTCAACGCAGATGA
GGAAGTCGGAGGTCCCCAAATCTGCCGTGTATGTGGGGACAAGGCCACTGGCTATCACTT
CAATGTCATGACATGTGAAGGATGCAAGGGCTTTTTCAGGTAG
agttacccatcagccttcacccacgtgccaccactgacccactgggtaacgtctcagggc
ctcagcttgacctgtcccccaggttcagagtgtgggctggtggcccacccaaaggccttg
taattagtctcaagggagccatttatatcccagaggaatccttcatcttcagtcttcctg

Exon  6 +      30785      30911   0    Initial    127   100   Excellent
agggactcccacctacacccttcccataaagcctgacccagctgggacgcaaaggctagt
gtccccctccccgagtcggtaggggctggggagggaggtggtatggcccggagccccagg
ccgagggcccgggcacccgtgcatccccccttctgctccccattctctcacaggagggcc
ATGAAACGCAACGCCCGGCTGAGGTGCCCCTTCCGGAAGGGCGCCTGCGAGATCACCCGG
AAGACCCGGCGACAGTGCCAGGCCTGCCGCCTGCGCAAGTGCCTGGAGAGCGGCATGAAG
AAGGAGA
gtgagcagtgggcgcgcgggcgggccggcgccggggtgcacggctctgagtaaggacgtg
ccgtgggtgtgggcatgcttgtgtggagatgcgcgccgagtgtgcgcgtgaacacacgtg
cacatgtgagctggtgtccgtgtgcaacaggcagccacctgggggagcgcttgcagtcgg

Exon  7 +      32256      32443   1   Internal    188   100   Excellent
gtttctccagaagagcccacaggcctcttgagtccagacaggggagaattgcttgtcacc
attactttctcttttgcctaacggcttctgctgccttgagagggttacacagtggctctc
cagggggctggaggctcaccaggggcacgtgtgcctgagccagcctcactgtccctgcag
TGATCATGTCCGACGAGGCCGTGGAGGAGAGGCGGGCCTTGATCAAGCGGAAGAAAAGTG
AACGGACAGGGACTCAGCCACTGGGAGTGCAGGGGCTGACAGAGGAGCAGCGGATGATGA
TCAGGGAGCTGATGGACGCTCAGATGAAAACCTTTGACACTACCTTCTCCCATTTCAAGA
ATTTCCGG
gtaggaggaactgcacagtgacccgaggtgtcactgccatcttcattctcacatagaaac
tgaggttccccaaggataagaaacttatacaaggtcacagctaatcagtggtggagggta
gatttggagagctggtcctgcatctgtgctagctcctcaaagccttagtctcattcccaa

Exon  8 +      33403      33677   0   Internal    275    88        Good
aaatgctgtgtgtgtatatgtgtgaggacacacgcatgcatgtgggtgtgaatgcctgca
tttgtgcatcctctcgagctgcaactgtggctgtgcatgtttggctggggcctgagttgg
gacctgtctatgaaagcacatgctgtctctcctctgtccacctcctggcatgtgtcctag
CTGCCAGGGGTGCTTAGCAGTGGCTGCGAGTTGCCAGAGTCTCTGCAGGCCCCATCGAGG
GAAGAAGCTGCCAAGTGGAGCCAGGTCCGGAAAGATCTGTGCTCTTTGAAGGTCTCTCTG
CAGCTGCGGGGGGAGGATGGCAGTGTCTGGAACTACAAACCCCCAGCCGACAGTGGCGGG
AAAGAGATCTTCTCCCTGCTGCCCCACATGGCTGACATGTCAACCTACATGTTCAAAGGC
ATCATCAGCTTTGCCAAAGTCATCTCCTACTTCAG
gtaggacatggagactgggtggttgggtgtggaaaagaactggaagtggccaggaggttc
aaagggcctggggtagatcctgaatttgggggatattggtgtcagaagaccctccttttc
ctgtgccctttccccgggcagccagtgctgctggggagtagagcccttgctgtatggctg

Exon  9 +      35696      35838   2   Internal    143    91   Excellent
gctgggttgtgaggggagagatgagaggcagccagacagcagccacagtcatcctcaggg
aaaggagccatcctccctcttcctctcgcccccaacttctggattatgggatggctgctg
gtgccggtctgtgggctgcctcccagggagctgtcctcccctccccatccttgctgccag
GGACTTGCCCATCGAGGACCAGATCTCCCTGCTGAAGGGGGCCGCTTTCGAGCTGTGTCA
ACTGAGATTCAACACAGTGTTCAATGCGGAGACTGGAACCTGGGAGTGTGGCCGGCTGTC
CTACTGCTTGGAAGACACTGCAG
gtgcccgagagagcctgcctgccctggcagagggagggaaacactgcagttatgggagga
agggagctacgccaggatatgcaggttctgggatggcagggcaggaagatggaatggtgg
aaaacaagatattggtgagggatgattagatcttggtcagcttgctgagaagctgcccct

Exon 10 +      36040      36118   1   Internal     79   100   Excellent
ccctggcagagggagggaaacactgcagttatgggaggaagggagctacgccaggatatg
caggttctgggatggcagggcaggaagatggaatggtggaaaacaagatattggtgaggg
atgattagatcttggtcagcttgctgagaagctgcccctccatcctgttaccatccacag
GTGGCTTCCAGCAACTTCTACTGGAGCCCATGCTGAAATTCCACTACATGCTGAAGAAGC
TGCAGCTGCATGAGGAGGA
gtatgtgctgatgcaggccatctccctcttctccccaggtgaggatctcccctaggctgc
ctgacatcccccccagccttatctgccctccccagggaaggtcccagtctatggccttgc
tcctcattcactgcgcagccaggatgggggctctcgctggtttctcctggggtcagtggg

Exon 11 +      37785      37929   2   Terminal    145   100   Excellent
caggctgttctgcctttctcatctacagggtaaaagagaagcttacggaattcagccaag
ccttgtctcttggctgacctgaaatgtccagagattatgcttgtgcagcctcagagcagc
cctgaggcttgtgggtcagggcgggctgcacccacaatcttttctctggctggcatgcag
GTTCTTGTTCCTGAAGATCATGGCTATGCTCACCGAGCTCCGCAGCATCAATGCTCAGCA
CACCCAGCGGCTGCTGCGCATCCAGGACATACACCCCTTTGCTACGCCCCTCATGCAGGA
GTTGTTCGGCATCACAGGTAGCTGA
gcggctgcccttgggtgacacctccgagaggcagccagacccagagccctctgagccgcc
actcccgggccaagacagatggacactgccaagagccgacaatgccctgctggcctgtct
ccctagggaattcctgctatgacagctggctagcattcctcaggaaggacatgggtgccc

--------------------------------------------------------------------------------