--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9187 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1156       1286   0   Internal    131    62    Marginal
cgagttccggcgcccagaacggcttcatcctctcgtcccgtccgcggcaaatgcatgcgc
ctggaaaacccgccaccctccagggcaactcacacctcacctcacgccgcggcgcaaccg
gactaggaccccgagcagggctgcccagggagcgcctgaaggaccctgcgagggccgcag
GCTATCCAGCGTGGCGCCTGGTGGCCGGGCCCTGTGCCGGAGGACAAGGTGAACCCGCAG
CCGGACTTCTGCTGCACTGGGGCTCCGAATGACCCAGAATCTGGGGTGGGCTTAGGCCCC
GGGTACGAGGG
gtgagggctgcgcggttgcaggcctagagaagtagggggctgggtcgagagttgaggccg
tgagcccggggggctggagggcgtggccacgggggtaggggcgcaggtcccggccgcgcg
tgggtggaccagggctgggccgccgccctccaggaagcgagtggtggccccctcgagtgc

Exon  2 +       4040       4129   0    Initial     90    40        Poor
gagcccaaatgggcaattaaaataatgtatatggccttaagatgaaactgtcaggttctt
tatgagtgtcaggagtgagagcactcgttggcttgcaaggctgcgtggctccaatgtagg
gaaggctgggagtgccgtcctgaagggttcctaatacagctctctaatggcaggagtgag
ATGGCCTCAATCTTGCGAAGCCCTCAGGCTCTCCAGCTCACTCTAGCCCTGATCAAGCCT
GACGCAGTCGCCCATCCACTGATTCTGGAG
gtaagaatgaatcctaagtctctaccgcatgccctgggaattgctactgcttcaggtgcc
attgggccatttatggtgactgacaacacagacttgtgctggatgctgtggaggcaaagc
tagaagccatgaactctgacctaaggagactaagaatccattggagacttgaggcagacc

Exon  3 +       5515       5674   0    Initial    160    57    Marginal
ataacaggaactacttaacaccttctgaccagagtgtgacgtgtcaattatagagtttct
catctatcaagtgtgatggtttggagggagtgagagaaacccaaggcaggaccactaaca
agacttttatggtggtctgagtggtgggtcctgtggtcttgagctcaaggggttataggt
ATGGAAGAGCAGAGACAGCGCATCCTATCCCCTTTCACCCAAGGTGCACACTCTGGCTGT
GTGACTGAAGGTCTTCACCTCACCCCACCTCGTCTTCTCACCCTTCAATGGGACAAACCC
TCAGGTCCTGAGCAACAAGTGGTCCTCATGGTTTCTTTTG
gtcagtttcagtctcctgattgatttttattttggggatggtctttattcaggctgttca
tcagcagattctaagcaacaagttcctgattgtacgaatgagagaactactgtggagaaa
ggaagattgccagaggttttaccgagagcatgaaggtaggatcagtagtcctctgaatgg

Exon  4 +       5727       5829   0   Internal    103    87        Good
tttcacccaaggtgcacactctggctgtgtgactgaaggtcttcacctcaccccacctcg
tcttctcacccttcaatgggacaaaccctcaggtcctgagcaacaagtggtcctcatggt
ttcttttggtcagtttcagtctcctgattgatttttattttggggatggtctttattcag
GCTGTTCATCAGCAGATTCTAAGCAACAAGTTCCTGATTGTACGAATGAGAGAACTACTG
TGGAGAAAGGAAGATTGCCAGAGGTTTTACCGAGAGCATGAAG
gtaggatcagtagtcctctgaatggaaggtgcctcaatcccaagaggccataagagagat
tttacctggaacacaatggcaggctctctgacctaccaaccgtgtacagttgcagccagt
tttctaaaatcttggtttaaaacacacacttttcatgattatccatcttttcccaaggag

Exon  5 +       7321       7481   2   Internal    161   100   Excellent
gcaggcttgatgtacaccagcaggggccctgcatcacctatttgaagcagcattggtact
cagctggaaaggcaggaaaactctcagaacgtagagtgtgtttttattcaggccctgctc
acagcacaccctcctagtctagatggccaggttctttacatgtgcttgttttgttcacag
CGGGCCAATCCGAGCCTACATCCTTGCCCACAAGGATGCCATCCAGCTCTGGAGGACGCT
CATGGGACCCACCAGAGTGTTCCGAGCACGCCATGTGGCCCCAGATTCTATCCGTGGGAG
TTTCGGCCTCACTGACACCCGCAACACCACCCATGGTTCGG
gtgagtcccctgtccatagccataggatattttggggttagcgggcaggctgtgtggtag
agttgacagccaggtccctccagtgagctttcttccatttgtgtttctggtctttgtagc
catgttggcagatgtggcctgtggactttctttacatgccccaggactgaaggggcaggc

Exon  6 +       7753       7875   1   Internal    123    82        Good
cttccatttgtgtttctggtctttgtagccatgttggcagatgtggcctgtggactttct
ttacatgccccaggactgaaggggcaggcagagtagaggctcaggattctgaacctgatt
atgactgcctcttgcttctaccatgtgagaaccccttctctgtcttatctccccttacag
ACTCTGTGGTTTCAGCCAGCAGAGAGATTGCAGCCTTCTTCCCTGACTTCAGTGAACAGC
GCTGGTATGAGGAGGAAGAGCCCCAGTTGCGCTGTGGCCCTGTGTGCTATAGCCCAGAGG
GAG
gtgtccactatgtagctggaacaggaggcctaggaccagcctgatgcaggtctatgaaga
ccagtggtagtgcccagacttctcctagacatctagtctaaaacattctcctaggaccag
ggaagcctggcttacagtgccatttctgctgggcaccaccacctgcctgagggcctagct

--------------------------------------------------------------------------------