--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (16517 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2070       2335   0    Initial    266    59    Marginal
gcactcatcccttcattcttaaccatgtatgtttgataaggattttcaagggggctaaaa
ttgtttaagttatgtcctctgtcccttccctcactgaacgttgatgagaacttacggtta
ctgatttactgtttctttttgtcttttagatcaagggtaaaattccattctgatatcaaa
ATGCAGTATTCGCACCACTGTGAGCACCTTTTAGAGAGACTGAACAAACAGCGGGAAGCA
GGTTTTCTCTGTGACTGTACCATAGTGATTGGGGAATTCCAGTTTAAAGCTCATAGGAAT
GTGCTGGCCTCCTTTAGTGAGTATTTTGGTGCGATCTACAGAAGCACTTCTGAGAACAAT
GTCTTTCTTGATCAGAGTCAGGTGAAGGCTGATGGATTTCAGAAACTGTTGGAGTTTATA
TACACAGGAACTTTAAATCTTGACAG
gtaaagtacacattttattttcagttataaaagctagtcagtagtcttcacagcaaaagt
agatttgtattttttccattcattctctgaactcaaattcttcacctatttatgcacaca
atgtttgtttttataaagaaatcagtatcactgatttaggatgagcaggcaatatttttc

Exon  2 +       6542       7194   2   Internal    653    76        Good
ggagattttttacctaaacattattctgaatgaatttataaatctatttttctcttagtt
atgtctttttcagcattctgcttcattaggtctttaaaatacattgaagtatatatgcag
ctctgtttcgaaagtttttctttgatcagaatattgtcatgtagccttgtttccttgcag
TTGGAATGTTAAAGAAATTCATCAGGCTGCTGACTATCTCAAAGTGGAAGAGGTGGTCAC
TAAATGCAAAATAAAGATGGAAGATTTTGCTTTTATTGCTAATCCTTCTTCTACAGAGAT
ATCTAGTATTACTGGAAACATTGAATTGAATCAACAGACTTGTCTTCTTACTCTGCGAGA
TTATAATAATCGAGAGAAATCAGAAGTATCTACAGATTTGATTCAGGCAAATCCTAAACA
AGGCGCGTTAGCGAAAAAGTCATCTCAAACGAAAAAGAAGAAGAAGGCTTTCAACTCCCC
GAAAACAGGGCAGAATAAAACAGTGCAATATCCCAGTGACATCTTAGAGAATGCATCTGT
TGAATTATTCCTAGATGCAAATAAACTGCCCACACCTGTAGTAGAACAAGTTGCACAAAT
AAATGATAATTCAGAACTCGAGTTGACATCAGTTGTGGAAAATACTTTTCCAGCACAAGA
TATTGTGCACACTGTTACAGTGAAACGGAAACGTGGAAAATCACAGCCAAACTGTGCTCT
GAAAGAACACTCTATGTCTAATATAGCCAGCGTCAAGAGTCCTTATGAGGCGGAGAACTC
CGGGGAAGAGCTGGATCAGAGGTATTCCAAGGCCAAGCCAATGTGTAACACAT
gtgggaaagtgttttcagaagccagcagtttgagaaggcacatgagaatacataaaggag
tcaaaccttacgtctgccacttatgtggaaaggcatttacccaatgtaaccagctgaaaa
cgcatgtaagaactcatacaggtgagacgggtgtgtggggagatattatttttatactgt

Exon  3 +       8364       8523   1   Internal    160   100   Excellent
acactaatttcttttgattctactggtgttttcagtggtctggaaaagattatatttgtt
ttcagttccaacagttaacattttcttaataacaaagctagtactgttgatgaaatctta
tatgacttatgcaaccaaaacactattttcttctaaatataaattttattgttcctttag
GTGAGAAGCCATACAAATGTGAATTGTGTGATAAAGGATTTGCTCAGAAATGTCAGCTAG
TCTTCCATAGTCGCATGCATCATGGTGAAGAAAAACCCTATAAATGTGATGTATGCAACT
TACAGTTTGCAACTTCTAGCAATCTCAAGATTCATGCAAG
gtaaaaaaccaaatgagttgtttgatcttttagtcttttaatcaccatagtcttatgaat
agactattatattagaattcaggacagtagaattgtaattgtggttccaccaaacaatgt
taacacgttcaaggaaccacaaggaagccacagtggttgataggaaataagcagggggtg

Exon  4 +      10239      10417   2   Internal    179    99   Excellent
tttgataataagaaatatttgtttttggcagtgtttacactgaaacaactactgatttta
aatacatagtcttggcctgttaagatgacatgaaataaaatctataaaaaactttatgaa
ttcttgctatatagactgacctccaaattgttttacttatttaactttatttactaacag
GAAGCATAGTGGAGAGAAGCCATATGTCTGTGATAGGTGTGGACAGAGATTTGCTCAAGC
CAGCACACTGACCTATCATGTCCGTAGGCATACTGGAGAAAAGCCTTATGTATGTGATAC
CTGTGGGAAGGCATTTGCTGTCTCTAGTTCTCTTATCACTCATTCTCGAAAACATACAG
gtaagtttgacagggagagactgcttaaaataaagttataaataaaagaaaaaggggact
tgggccttttagcgaagtagatcggaaactttgtagttagatatctgtttatatttctat
aagctatgtttatgatttttgcacatatttgttaaatataaaagctgacttattttctag

Exon  5 +      12396      12482   1   Internal     87    96   Excellent
tgtctaggttgtatagaatctttcatttcactatattataaccaggtgattaaagtgaca
atttgaaaccaaatttaaacactataataatttttgccttgtgttcataaacattgatat
ttttgtcttagctagcagcttttaaaatattgaaatttaaacttctaatttgtttttcag
GAGAAAGACCATTTATCTGCGAATTATGTGGAAATTCTTACACAGATATTAAAAATTTAA
AGAAGCACAAAACAAAAGTCCATTCTG
gtaaatgcttgtgttttgtttgcttgtttgtttgttttaatttggtgctcatattagtgc
tattccttaaaatgctgagatgagatttacatttaagcagtttaaattagatgtctattt
caaaaactaggtatatacatgtgaggaaagtagcttttttgcagaaacattcactctgga

Exon  6 +      14190      14452   1   Terminal    263    61    Marginal
ttgaggcccagattgaatttacatagatagtgaggagggcatatgtacaaaagagaaacc
gcttgagtaaaggtatggtggttggaatgtaatttctgggaatggtaagtacattagtct
acctcaggggtttagttttgttttaaagataatgtagatttttttttccttccattctag
GTGCAGATAAAACTCTAGACTCCAGTGCAGAGGATCATACTTTGAGTGAACAGGATTCCA
TACAAAAAAGTCCTTTATCAGAAACTATGGATGTGAAGCCTTCTGATATGACTTTACCAT
TAGCTCTTCCACTTGGGACTGAGGACCATCACATGCTTCTGCCTGTCACGGATACTCAGT
CTCCTACATCAGATACATTGTTGAGGTCAACTGTGAATGGGTATTCAGAACCACAGTTGA
TTTTTTTACAACAATTATACTGA
ctttgtaaggaatatggaattgctaagatatcattggtagcaaacatctctggtaaggtg
catatattcatattaaattcccattcatttgagttgtgaccattatttttcattcactga
agtaaaagcacctgatgctgcatcacaactgcaatgtttgtttttatttttggctttatg

--------------------------------------------------------------------------------