--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (68694 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (20 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1218       1356   2   Internal    139    73        Good
cagctccgctcgctgccacagtgcagagacctccctgagggagggggacagcctcgcgct
gggattggctggcctcgcgcgagcgccggcgcggagtggctggcgaggttttagagggag
tcccgctctccaattaaagcggcccagctgcgcctggctgcgcacagagctccctcccag
GCCCGCGAACTTGGCCATTCAGCCGCCGCTGTCCCCGCTGCGCGCCCTCGCGCCTCTGCC
TGAGAAGCCAGGCGCTGTTCCCCCACCCCAGAAGAGGATGGCAAAGGTGGCTAAGGACCT
CAACCCAGGAGTTAAAAAG
gtgagtggaaagctgtttgtatttacccagattcttactttttcttgttccccttcccat
ctgttcgcggaaacttcccaaaaggtaatgagaagggaactctttaaattccaaaactgc
atggaaaacaaatagttgggaatacatgtttgagctaacaggcacacacaccccaaaccc

Exon  2 +       3551       3661   0     Single    111    57    Marginal
ttctccttcttgtcaccccctagtgccaacttccttggcctgcaaagggtttgttttcca
tttagatccaattacaggcttagagaaagaatgtggtgggtagagatgaaagggcagatt
ttttttatctcttgggactgcgacaatcaggaggaagatcaccattttgtaggttaacca
ATGCCTTCAACTCAAAATGTGGAGGGGAGGGAGGAGAGCCGAGAAGCTCCCCTTGCTGAA
CTGAATGTCACAGAAGTGATTAAGTACTACGTGATATCAGCAACACGCTGA
aaagcttttactgcatatttattttttaaatctgcaacagtatgtgggggaggtttataa
catttggcttcaggatgcataatcgcacttagacattttgaaacaatttcatagactctt
agagctacaaggggcctatttacaaaatgagaaatggtttaaaatggcatacaggctgtt

Exon  3 +       9541       9720   0     Single    180    67    Marginal
ttttcagaggcagctgaatgtttgggttgtatttttcacagtactgatgtcagggacacc
aaagggcaggagcatagggaaagggctcttggctgactaatgacctcataagaaacctgc
ccttagaagagagcatctgtttgggctgtatgactcagtggcgtttctaggtactgattc
ATGAGGCTGACCATCGAGGTGACTGACCCGTGCAATCTGCTGGCTGAAAGAGGTGAAGGC
AAAGTAGATCCCAGCTCTGCCCTCATCCTGGAGGAGAGCCACCCCTCCTACCACGGCACA
CGGGTGCTCCCCACCCCAACCCTGGCTCGGCCAGCCAGTCTCCTTGTTAAGAGGATCTGA

cactaatgtgggcagaggtcagcatctgggggcttcttattttagaggaagtataagaga
gagatgttttgaaatcttgttagtgaatagaggacagccttttaacctaggatctgtaga
tagaattgagggtgtcagggaacttaaattaggaaaagtattgcattttttatccctaac

Exon  4 +      12209      12274   1   Internal     66    61    Marginal
ctgtcatcacccaccttccacatttccatgagcccagcccagaaatgggaccatcacagg
ggaaatcatcctatatttatttgaataatgtttgtactgtgtatttcagcaattaaaatt
aacttttaagaggtaggaagaggcttagggattctctaggtcaactgccttctttaacag
ATGAGGAAACAGACCCAGCAAAGCCAGATGACTTGCTTGAGGTCACAGAGCTAGTTAGTG
GGAGAG
gtaggattagaattcaaggtactatggcctttcaagttcagaaagacttttaaaaactgt
gttgtgtagaatcacttccccataaacacaagatgagctgggcagctagttgctgtcaga
ataccactgaggaacactcacacctcctgaagatgtctaatttttttaactcctctgatt

Exon  5 +      13580      13620   1   Terminal     41    94   Excellent
ctttgaccttcattttgaatatttatgtgtgtgtgtgtgtgtatatatatttgtgtatat
agatagatgattgatagatagatacatacatacatacatacatagagagatctgggttgt
attcagaatatataaataacttctacaaatcaatttaaaaatccaatttttaaaaaacag
GTGAAGACTTGAATAAGCATGTCACAAAAGAAGATATCTAA
atagctgaaagtataagaaaacatgttcaacatcattattcattacagaaaaacaaacgc
acaatgagacagtgtcacatacccagcagaatggtaaaattaagtaccaacaggacagag
tgctggagaggatgtggagcaactggaactcacagacattgccagggagaatataaaatg

Exon  6 +      15834      15918   2   Terminal     85    47    Marginal
cctcctgagagacaagagccggagggacaaccgaaaactggctgaaatttagtgcaaacc
tctcatagctcagacagctatctactttaagtttctagtccttgatgaatatttatacca
aaatagggccagtggaaaagttccatctgcctggattttaagacttttgcctttcctcag
CCACGTTGACCAAACTCAGGAAAGTGGCGGAATCATTGCCAAGTACATGCTCTTTGAAGT
GCAAGAAATCCTGAGAAGGCCTTGA
attcatcatatttcttcttatcctgaaaacttagagttggcactcctttaaaaaaaaaat
gcttaatatcagcacctctcagtgctttataattttagccaagcccttgacaccatgttg
accacaacactcttgaaggagtggataggtctattcaaagttttgcagggagaaattgct

Exon  7 +      20598      20702   2   Internal    105    51    Marginal
ttcaaagggagctggtgtcaaaggaaaatattagttcagccttaaaaatcctatcacttc
agtccagtggggtcccttatacgtaagatttgtgggcctgctttggatacaacaacatgt
aaacatcagctgtcagcaagaagctggcagccaaaaaggctggtttcctttccccctcag
TCATCTTCGTGTTCGCCCTGCCAACAGAATGTTCAACAAGGAGCCCGTGTCCTGGGCCAG
GACTGCCAGATTCCTAGATGTTCCATGTGCCATCACACAGATCCA
gtcacccagcaatgaatctttgaatttagaatttggaactttttgcctcgttccatactc
ctctttttcaaagtgaccccaactccatcccctttgacagataaaagagagatcctgtga
ctttttccatgcttccccttctcaaaggctgtcgcccatgccaactgggagaaggagccc

Exon  8 +      36561      36785   2   Internal    225   100   Excellent
tttcccaaatgcagttcccaattccaaaggcctttttgtctcaggttaccatttgtccgc
tgctagtttttccaacttaaagttttagcttgctttcaaaagggtagatgctgctagcag
gagaatgtgcctctttttcctggaggttaatctcactggtccccatccacccacccccag
GAAAATATGCAAGTCTTGCAAATGCAGCCAAGAGGACCACTGCCTAACATCTGACCTAGA
AGACGATCGGAAAATTGGCCGCTTGCTGATGGACTCCAAGTATTCCACCCTCACTGCTCG
GGTGAAAGGCGGGGACGGCATCCGGATTTACAAGAGGAACCGGATGATCATGACCAACCC
TATTGCTACTGGGAAAGATCCCACTTTTGACACCATCACCTACGA
gtgggctccccctggagtcacccagaaactggtaagagagcttccccaaccaagcagttg
ttttcctatcctcataaatactagccatgtcaagtgtttctgaatttcaaacatggggtg
gcaagagctcaaggtcacaaaaatgacaggagtggctgtggttttagccctgcccttata

Exon  9 +      38157      38232   2   Internal     76    64    Marginal
tggggccttcgcacgtcctgctccttttctgaaaggttctttccttgctcttcccaaata
gtccttctccagatattcagtttacaatagatgtcacctgccatcctatcacatttttta
tttcttttcgtttctttaacaacttttattgcaaacagattatcttttttctgtgcctag
ATATGAGGGCAGACACCCTGCCTGTCCTGTAAACCGTAACATCCCTGCACCCAGGACGGT
GCAGGGTGCAGGACAG
gtgtgacgagtgttagtgcaatgtcaccttttaggccagagatgctctaagtgtgggctg
tggactggagctcttccgcacagtctttgtgacctggacccaatgaaaaaagttgagaaa
ttgagaatatatgttgggaaaatgttacagcaatttgacatgcaactgtgtgatgggatg

Exon 10 +      40427      40481   0   Internal     55    67    Marginal
tactcatacctcgccctctgcttccagacccatggcaggcattacttatcagtcagagta
ctgtttcccattgacttcttatcggccctcaggatccttcttcacatagcactctcggtc
accactatggactggggttgacttgtcagatgaagcccatttactgttcttggctgccag
CAGAAGAATCAGGAAGAGAAGAATCAGAACAGGGTCTCCGGATTCCAGAGCCCAT
gtgtgtttcactgcctaatccagggtacaggagtgccttcccttccactttgctttgcat
ttttagtttctttcctgatacaggcagattcctggaacctctccacccaagatgtcccga
ccaggttgcagagcaccaagtaactcagaaaggtcctcagggggccaggtgcagtggctc

Exon 11 +      47944      48283   0   Internal    340    92   Excellent
ctaaaattacaaaagtaatctaactgcattaagttaagaaaataaagactgtgggtcttt
cagttgctgagaatgctggaagagaatgcattttcagttttaggtagattctgtcatagt
ttctttgactgatgaagccccatccacatcatgttgtctcttcctcctcctcctccctag
GGACTGCAGTACATGGAGCTCATCCCCAAGGAGAAGCAGCCAGTGACAGGCACAGAGGGT
GCCTTTTACCGCCGCCGCCAGCTCATGCACCAGCTCCCCATCTATGACCAGGATCCCTCG
CGCTGCCGTGGACTTTTGGAGAATGAGTTGAAACTGATGGAAGAATTTGTCAAGCAATAT
AAGAGCGAGGCCCTCGGCGTGGGAGAAGTGGCCCTCCCGGGGCAGGGTGGCTTGCCCAAG
GAGGAGGGGAAGCAGCAGGAAAAGCCAGAGGGGGCAGAGACCACTGCTGCTACCACCAAC
GGCAGTCTCAGTGACCCGTCCAAAGAAGTGGAATACGTAA
gtttctcccatgcttccagccaggctgaaaccatgcaggcccagggctggacagtcaggg
ccccatcacggggctttgttccctcattcatgcatttattcatgaatttgtgcattcagc
agatattgattgctcatttagtctgtgccaggcactgtcccatggaaaatgatacaatac

Exon 12 +      53657      53730   0    Initial     74    49    Marginal
gtggcaggatcatagctcactgcagccacaaactcccgggttcaaaccatcctcccgcct
caacctcccaagtaataaacctctttaactcttggtaacaaccagtgagagaggttgggg
ttgtgatacccatttcgcagatgaggaccctggggcgcagtgaggttaccccacgtgctg
ATGAGAGCGGGGCTTCGGTTCAATCCCCAGTCCTTCTGCTTCACCGGCAGAGTGAAGTCT
GAAGCCGTGTTGGG
gtggggcctcggcagggtgggtccgaccatgccaggggatatatatgtgagtgtttaggt
tctccagggtgggcagccgtgtatggggtagcttgcagctcagcccactgagcatttggg
agcctcttatctgcgtactgagaacaatgaaaggattcccatgtccacccccagttccac

Exon 13 +      58408      58661   1   Terminal    254    68    Marginal
aaagtgtggccccaaccacaccagcatcccctaggaacttgcaaattcttgtgccccacc
ccagatctactgtatcagacactgtggggaggtggtggcggtgggggagcagagatatgt
tttaaccagccctctaggggatactgaggcaggctcaaccctgagaaccactgtctccag
GGGCAGGATCAGATATGGGGAGGAGCAGGCCCTCCAAGCAGGGGATGAGTGGAGCTGAGT
CTGGAGCAGTGGCAAATGATGAAAAACTCACACGACTCGATTCTCTGGCCTTGCACAAAT
GGAGAGAACTGATAGGGGAAAAAATAGAGCTCATCAGTGGCAGGAATGACTTCCTGCTAG
TCTACATGCCCTTGGTATCATGGAAGGAAATCCAGGCCTCCAAACCTGCCTTCAACATAT
CTTTGTCATTTTAG
gaaagtggtttaatccctctgggctttacatttctagcctgcaaggtgggcagagttaag
gaatacacgagattttagcaaatcattattgagcccttataaagtccaaaaattccatta
tgtcatttaactcacaccacaatcctatgaggttgctatcattactatcgccattcaaca

Exon 14 +      59677      59809   0   Internal    133    52    Marginal
taggtgcagtggctcatgcctataatcccagcactttaggaggccaaggcgggaggatcc
tttgagctccggagttcaagaccagtctgcgtaacatagtgggaccccatctctacaaaa
aatttaaatatttttaaaatgtcttaaaaagaaccagtcgtggctacccattgcctccag
AGTGAAGTCCCAACCCATAACCTGGGTTCAAAGCCACCCATGATCACCCTAAACTGCCTT
TTGGACCTGATATCCCCCTCCTTCCTTCAGTGTATCATCAGGGTGCCTGCCGGTGCTCCC
CAGACCAATCCAG
gtgcatttctatccctctccctttccctactttcatgtcaattcacatttgtaaatgtgg
agtggggagccccattgatatatcatggtgttacccaatggggtgtagtttggtgaactg
acacgaagtcccttttgtgtgggagggaaagagctggaaatttcattctgtagaaataag

Exon 15 +      60113      60210   1   Internal     98    50    Marginal
cgaagtcccttttgtgtgggagggaaagagctggaaatttcattctgtagaaataagaag
ccagacagacaactcactttgtattcagacagccctggccaaagagtttacagttcccag
ctatgcaggagggagggtgaaaataagtagatgatgactggtcactgattttttgtctag
ACCCCCTGATGGGCTCCAAGCCAGCTGAGTCTCAATCATGTGAAGAGGAACAGGGTTTTC
ATTTGAGCGAAAAACTCACACCACTCATTCTTGGGGGT
gtaactgaaaccacaaatctagcatgttctaaggaacattatcaggcacagtcaggatcc
agttcaagatatatctagttgaccaaacacattccttatataggcagtcattcaagagct
cctacgctcagaaactgctatcagtacatgacgttccttgttattcagtgttcttttcct

Exon 16 +      63026      63189   0   Internal    164    64    Marginal
tgggtcagagctgcaaccaagcagcctctctctgccctctgcagctagccgcttagtgga
gagaacagatataaattagataattccataggtatttaaaaaataatgttagctaacata
catggagtccttttgggggatctgccaaaatcatgcatgggttccaaataacttatgtag
ATACTTGGCCCTGGAGGAGATGGAGCACTCTTTAGACATGGAGGGCTTGGTGACTTCCTT
CCAAAGAGGATAGTATGGAAGTGGGGAGAAGAGTCACTTTACAGTGAAGAATCTGACAAA
CACTGCCTCCACCAGAAGGTCAAAGTCAACCGCAACAGTGACAA
gtgagggcgacagtatgtacccttgaaggatgtgataagaggagcagtttgccccgtgat
cttcctcccaacgtactcatcatagtaacatcaggcaaatcccaactgagggacattcta
caaaacacctgaccagtactcctcaaaactgtcatggtggccaaaaacaaagtctgagaa

Exon 17 +      64696      65023   2   Internal    328   100   Excellent
acaaaaactctgtaggggtcttgataatttttaagagtataaagggtactgagaccaaac
aatttgggaatcactgtgctaaataaataactttatttagtcctcgtgaatagcctgtta
ggtaggcaatattattgtgtcgctttgcagatgacaaaactgaggcacgaagaggtatag
TGACTTGCCCAAGGTCACCCAGGAAGTAGAAAGGCTGGAGCTGGAATTCGAACCCATGTC
ACTGTGCTCTCCTGACTTCCTTGTCTCCTATGGTCCTTCCCCATCCTTCCAGGTCTGCGA
GCTCTGCAAGGGAGCGGCCCCTCCTGACAGCCCCGTGGTCTACTCGGACAGGGCAGGCTA
CAACAAGCAGTGGCACCCCACCTGCTTTGTGTGTGCCAAGTGCTCCGAGCCGCTGGTGGA
CCTCATCTACTTCTGGAAGGATGGTGCACCCTGGTGCGGCCGCCATTACTGCGAGAGTCT
GCGGCCCCGGTGCTCCGGCTGCGATGAG
gtgggagatagccgcgagatgggttagggggcttgagggacactgctgagggtaaaagcc
cagaggccaagaggagcatggctttgtggatgatgtgttctacagattgggaaactgaag
tcaggcctcactgcatgctctcaaccttcattttctcatctgcaaaatgaggcagacaac

Exon 18 +      65603      65753   0    Initial    151    49    Marginal
accagcgcccatcccatagagtggctatgaggatagatgagataatgcatgaaaatgctt
gccacagggcctgacctaggaacttataaatggtagctgctgttagtcttacgataatat
actataatatgagacttaacattaatatgacacaatacaatacaatatgatagagatgct
ATGAAAGAGATTCAAGTCTCTGATACTGGTTTGATGAAAGTAACTCTAAGGTGTATTAAT
AATGGCAATACTAATTATGATCATAGTATGTACTATTTGCATGCCTTTGGTTGCAGGCAA
TATACTAACTTCATCTTTGGCATGTATGAAG
gttagaaatgtcttctttatattgaaccaacatctattttctaccaccttctacgaattg
gtcaccatatgaagttaagaccctgtagtcctcttacctaataactctgttattaagtga
tattaagaaggaaaaggactgtcacaggcctgccctggagcctcatttttgaagtgacaa

Exon 19 +      66816      66940   0   Internal    125    94   Excellent
accttcaccaaatattatccttactgcctcaaatttatgccagatttttccactaaggct
ttaaaaggtcaaaacaagaataggatgggatgaaccaccaccctataacttgtcctagat
ataccgtctctacctagggacagaaactgagtcatgcatttctcctgctcccctccccag
ATAATATTCGCTGAGGACTACCAGCGTGTGGAAGATCTGGCCTGGCACCGAAAGCACTTT
GTCTGTGAGGGTTGTGAGCAGCTGCTGAGCGGCCGGGCGTACATCGTCACCAAGGGTCAG
CTTCT
gtgcccaacttgcagcaagtccaaacgctcctgaagggctgcccacccacagccagaatc
cacaggatcccaccgagaaggagagccaggtgtgccgagaccatcctaagggtccgatgt
gacagcaagcaagtgaaataaacaatgatttgcttttcagtgagaatatatatatgagat

Exon 20 +      68409      68526   2   Terminal    118    51    Marginal
ttcttgaacttcctcatctgctgccagttttctttaacctcaccatccaaatttcactct
gaccatctcgtacctagaaaacccccattcatgtgctttataagtttcaccaaagccatt
gctatatcctcccaaggcagtggttttctgctcccagctcctttctctagtcaccctcag
TTTCCTCGTCATGTTCATCTTCTCAAAGATAAGTTTCAAGTGTGTCATTTCCTTCACTCA
ATCTCCATGGCTCTTCATTGCCTGCCAAGTTAACAACCAAGTCCTCATGGACATTTGA
atccttccaaaacttggcttatgtctttctggccttggagccctttatttccctagattt
ctagttccctatttcttcctaagcatgcagaagctccctctgatcaagcccttccctttg
cttttgctagttgaagactggctacctgaagaccaactctggctgttga
--------------------------------------------------------------------------------