--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (126748 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (26 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1498       1567   0    Initial     70    93   Excellent
tgctgcgggacggatggtggcggcggggcgcgggccagcgcgggcgccgtgagccggagc
tgcgcgcggggcatgcggctgcggcccccggccctcggcccccgcgctccggccccagcc
ccggccgccggcccccgcggagtgcagcgaccgcgccgccgctgagggaggcgccccacc
ATGCCGCGGGCCCCGGCGCCGCTGTACGCCTGCCTCCTGGGGCTCTGCGCGCTCCTGCCC
CGGCTCGCAG
gtaagccgcgccgcccacggcgcccagagaaactttgtcgcacactcagccgcgggcggg
cgtctcggaggggcggggagcgcaggcggtgcctgagggcggagggcgccttcggggcac
tccctggtgggccagtcgctgggggacagccccgcggggcgctccccgcgcgcagccccg

Exon  2 +       2837       2930   2   Terminal     94    58    Marginal
gggtctgagcaaacaataacttcgttcagaccctaattcaaacttaatactgtagcaagg
tttttggtttttgttttaaatgggaaaataatcactccagagcttggagagtagatgagt
ggattccaaacacccatccggcagccagtgcccatcacggatattttcatgggtccctag
GGAAAGCGAGGAGCAGGAAGATGTAGCCTGCATCACACAGGAATGTATTGTTGTCAACGC
TCCCCTGCTCCACAAGGACTTTCCTTTAGTTTGA
aattaggcactttttctttttttggtgggaacattttcttttaatacttcttaataatat
tagtagtttttaattttggcaaaataagaaaatctgacaaccctatgttaagctcccctt
ctctttttctgtttgtttcttttgttttgtttttaaatcttagttttctttgaaatccaa

Exon  3 +       9774       9895   0    Initial    122    51    Marginal
gctatcatctgggctgctagttcctgtttccatgacctagacctaacactgacatttgtg
aactccgtgtgtttagttttttattcattgcttccttccttttcaaaatgcttattggtg
ccaaatgactcatccagcaaagtccaaactctgaaatattaataggtggagagaggagag
ATGCCAAAGGGAGTGAGTCTGACATTACACATACCAGCACACAGCCTGTGGTTTTGGATC
CTGGAGTACCTGTCTGGTACCTGGTACCCGGCACACTGTGAGTTCCTGGACATCAAGGGC
TG
gtaggtcattcacctgtgcatttctagcatccccccagtccagtgctcagcgtttagggt
gtgttaagtgcagagtttcttgaatttgaatgtgtcccaacagcaactgaattttagggc
aatcattttgagtacaaacgactttacttttccatgtgaatatttaataataacagaaac

Exon  4 +      16436      16566   1   Internal    131    57    Marginal
gcctcttgcttgctatatgaactctctaaaatgccaattttaaaactttgggagttctca
atttactttgagagtggaatcttcccaacatataaacctttaatcatatttgtgattaat
tgtaccatctttgttatcacccttctttaaaatcttcctttcgttctctatgacctgcag
GGCAGATCCAAGCTCTGTGGCTCTTGCCTTCCTCCTACCATCATCTCTTGTCTGACCTGA
CATTTAGCCAGAGGGAACCACCTGCAGATACCCAGAGAGCCCAGCTTGAGAAACCCTGCC
TGATCTTCCCG
gtgtttctcccctccctggagagccttcctggctttttcttcctcctttccttcttttat
ttatttatttatttattatttatttttatttttatttttattttttgagacaggatcttg
ctctgtcacccaggctggaatacagtgatgtgatcatagctcactacagcctccatctcc

Exon  5 +      29052      29260   0   Internal    209   100   Excellent
atccttacaatacttggtgaagcatctgggatagggattaccatttcctccattttcaga
caatgaaaatggaaagtagagaatttaaggtcaaccagatggagacgcagccacgacatg
cgatgttttcgggagacaccctgaccacctcctgctctcttcctctttttccctgcctag
GACTTCGGAAGCCCACGGTCCATCACCTCTCGGTGTGATCTGAGGGCAAACCTTGTCAAA
AATGGCTGTGGAGGTGAGATAGAGAGCCCAGCCAGCAGCTTCCATGTCCTGAGGAGCCTG
CCCCTCAGCAGCAAGGGTTCGGGCTCTGCAGGCTGGGACGTCATTCAGATGACACCACAG
GAGATTGCCGTGAACCTCCGGCCCGGTGA
gttgcccacagaaagggctggatgctctgggatcaggaaggcccatgggggaggtgggac
ttgttaataatgggacaatgagtcaggccaggctgagatcagagccacgagatggtgatg
gggaggcaaggctcagacctcaggaagcagagtatattcttattgatgtgtctgtggaca

Exon  6 +      34844      35028   2   Internal    185   100   Excellent
acagagatgttctatgtacccttctccgctgtcctcaatgatagcatcttaatataacaa
aagtacattctcaaaaccaggaaaccaacatggttacaatactattaactaaactacagg
taattggttgcttttgggtttcctgccagcccctatttttttcctcccttctccttccag
GTTCTACTTGGAAGAACCAGTTTTTAGGTATTGCTTCTGCAATAAAGTTGCCACCCTGGG
TGACAGTGTACATAGCTTAAATAGACGAAGAAAGTCTTTTGATGATGGCTGGATAAGGGG
TTATTTTAAAGGAAACCAGAAGTATCGAGCCCTGGGCTTGGAGGCAGACACTGTGGAGGA
CAACT
gtgtcttcaggtgacttgttccttggttccataggtcaacagtcacaattctgaggtgga
gagggggtgcagtacagcctggcatccttgttctaaaccagtgaggcaataatttggttc
tagatctggatttaatcctgggatactaagtgccttctgctgtagtgactggaagagctg

Exon  7 +      39940      40189   1   Internal    250   100   Excellent
aggcctccattctcagcaccgtattcccttcaggcactttacttccaagaaaaatcttct
gtgaggcacacaatcactaaagaaaagtaagaggcaaactagctttgaaagcaaatccca
tccctcagccctcagcaggttgcacaacctctaacacacgtggcctctctgttggtgcag
GTGACAAGACCACCTTCCAGCTACAGGTTCGCCAGGTGGAGGACTATCCTGTGGACCTGT
ACTACCTGATGGACCTCTCCCTGTCCATGAAGGATGACTTGGACAATATCCGGAGCCTGG
GCACCAAACTCGCGGAGGAGATGAGGAAGCTCACCAGCAACTTCCGGTTGGGATTTGGGT
CTTTTGTTGATAAGGACATCTCTCCTTTCTCCTACACGGCACCGAGGTACCAGACCAATC
CGTGCATTGG
gtaagtgaccagttgcccttctgttgggtacttaagggtgggagaatggagaagcaggaa
aatttagctcaaagaaagaattaaggaaggcatggttaggaggggtggccaggcttaggc
gtttaatttgattaatgataagcatacattctctcctttcctgacgtgtgaagaagtgag

Exon  8 +      47013      47115   2   Internal    103    85        Good
gtgctgggtaaatagttattggtgcctctcaaggcactcagtgaatgctcagaacacttg
gttaagatttacagacaatgatggaaaagtgactcttctcttcttcctctctagttacaa
gttgtttccaaattgcgtcccctcctttgggttccgccatctgctgcctctcacagacag
AGTGGACAGCTTCAATGAGGAAGTTCGGAAACAGAGGGTGTCCCGGAACCGAGATGCCCC
TGAGGGGGGCTTTGATGCAGTACTCCAGGCAGCCGTCTGCAAG
gtaactttcctttctggtcctgtccctgcatggggaggtcaaggtagagagcgtcagtgg
gtgttggtacttcctgcaggagtctttgagtgccccagcatgtggctcctgaccactctg
aagtcagagggtgagctcagtggaacttctgggaaatctacagcagtcaaatcagccgga

Exon  9 +      55482      55621   0    Initial    140    60    Marginal
aatgtctgtatcctgagtcataggccaagatttctttttcccaaggaaagaaatgctaca
cttttggcctcattaagtttagccacagaacagatttttttaaaaaagatatttcattgc
aaacagtggatggaagtaggaaaaacaaactaaaaagaatgtgtatattgttttaaaggg
ATGGAAATATGCCTGAATGTCAACATGATTCGGGAAACCAATCACAGAGACCCTCTAACC
TTGTTTTCCCTTATGTGCTGTGGAGACTCCTCTGTCCCCAAGCTCAGATCTACTGTGGGA
GCTGCCCACTGGCTGCCCAG
gtcagtcccctttccttcctcattcctgccttgaaacctgtcccctcttcctcagtgctt
gcctgaaaggttaatggacagtgttttgttattacatttgaaaacgtcttgagtacttac
tgtgtacaagacgtcctgttaggtgctgtggggaatgcagagttgaagtagccgtgatgc

Exon 10 +      67024      67185   0   Internal    162   100   Excellent
tctcttcggagcctctgtggaatccctccccagtggttttgtgagtgtgccccaggtaca
catggcaaggggaatgcctctgattcaggccgtgactcctggagaggggccagtgccctg
catgaccagggcaggactgggcagaaagactggtgtacccatccaccttctgtccttcag
GAGAAGATTGGCTGGCGAAAGGATGCACTGCATTTGCTGGTGTTCACAACAGATGATGTG
CCCCACATCGCATTGGATGGAAAATTGGGAGGCCTGGTGCAGCCACACGATGGCCAGTGC
CACCTGAACGAGGCCAACGAGTACACTGCATCCAACCAGATG
gtgagtgccgggaaccagatcccccctccctgttgcctctcttgtgaccctgcccgtggt
cttagtacttgcccagccttgaaaccttcctctggccctcagtattcactggctttctga
tcccttcttggggttgggtttcattattcagtcttctccaactgggtttccggaactcct

Exon 11 +      68664      68759   0   Internal     96    95   Excellent
tactcagttccttagttcaggagctaccaagaaggcttagttattaagggactctaaggg
gccacctaaggaaaaggtgcttccctggcaaatgctggctgctgactgtgcattggagcc
aggtgctggtatctacacctgttaggaatgtcatagccttgacttttgccttggccctag
GACTATCCATCCCTTGCCTTGCTTGGAGAGAAATTGGCAGAGAACAACATCAACCTCATC
TTTGCAGTGACAAAAAACCATTATATGCTGTACAAG
gtatgctgggagggagggaggctagtgatttgtggggtgaagtgggtggtgaggagtgtt
tacaactctgcctatctgggggaaattcaaaggaggggtggaatatagcccagtcttgat
ctaatggaaaataataggaggaaacaattaagcattcgcatagcagtgaataccttacaa

Exon 12 +      70943      71039   1   Internal     97    60    Marginal
tcttttctttactttttttcccaagaattttacagccctgatacctggaacaacggtgga
gattttagatggagactccaaaaatattattcaactgattattaatgcatacaatgtaag
tcatcagtttcttcccccactgccacctcccttccaccctctcccactgaggccctgcag
CTGCCGCGGGCTCAGGTGGGCAGTTCTCCGTGCTGCTCTTCTTGGCTCTGCTCCCCCATC
CCCTTGAGTTTGGTATCTTCTTCCTGCTTCACTCAGG
gtcagggtggagaaacccatccttgcttgatgagtctccctctcacctctgccatcttga
ctctcatctgcagatctcagtgagccaaggagtggctcagactcaggctggtggcctggg
aagtgcttaggttctgacacctcgcataggcaggcagtggtattctccacctacccagtg

Exon 13 +      79342      79476   0   Internal    135    99   Excellent
gtgagtgcagagagaagggaaaggatgagggagggccagggaaccaagctcactggctct
tcctttggcttgggattcctgagttagaggaagccacgtgggcctcagaaaaccagtgtg
ggagcacctcagccacagcctttattaaatggttgggcttcattttctctctccattcag
AGTATCCGGTCTAAAGTGGAGTTGTCAGTCTGGGATCAGCCTGAGGATCTTAATCTCTTC
TTTACTGCTACCTGCCAAGATGGGGTATCCTATCCTGGTCAGAGGAAGTGTGAGGGTCTG
AAGATTGGGGACACG
gtaagtctcaccccaagtttgtatgaactcttgttagcattggtcatcagtctttgggtt
ctaataacttttgtgacttattaagagtcctttcggaatttatattctgttttccaattc
agcatcccagaggagtctcctaagcctgttttgcatgatgtgttcagagtctcaggtgaa

Exon 14 +      79991      80179   0     Single    189    54    Marginal
cctgtctttcattcctagtcttctgcaaatagctctgttccttggataatctgaccctca
cttttccgttctgtgaaatgtaaagaaagccactccccccattctgttttggtgaaatag
aatggatgactctacagcagtggaggacacagatgccttgtccagattaagtttattcaa
ATGATGTGTGAAGATGTGTGCCTCTGCGCTAAACCAAGGACTTGCGTGAGGGAGCAGGGA
GGAGGATATGTGGGCAACAAGAACACAGACACAGACACGGGCACAGAGGCCGCGAGTGGT
GATGGAGAGCTAGCCACACATCTTCTGGAGGTCCTGCTGCTAGAAGCAGATCATGAGCTC
CATTCCTGA
cttgctttgttgacaggtccagtgctcagaaaacagaaagccagtgagggataattctct
tctacacttaaaagaatctagttagaaacaaaaaaattatagagaccttacaaataggtg
gctatatcctcttggcattcatagcactcatgacggccaaggcggatataagctgactca

Exon 15 +      84939      85179   0   Internal    241    49    Marginal
ggagcctccacgggagagtgccgctgactgagcccccctgcaccatgtggggagcccagc
gctcgcgcactgctgacaggcagcctgggatttgaggatgagcgtgacttgccccagctc
acccagctaagagacagtgaactcacaagccaaaccaaggccgttccccctccacaccag
GTCATCTCGCTCATCACTGCCTCCCCATTACAGAGCAAATTGTATTTGTTTGCATGGAAT
GGGGACATCCAATGTGCCGTGTCCAACGTGCCCCTTACTGTGGTGGGGGCATTACTGCTG
CTGTCTGCCTCTTACAGCAGCTTTATAAGGGAGCTGTTCCTTCGCCATTTTATGTATGAA
AAACTGAGACTCAAAGTGGGGCCTGAGAAGCGTGCCAGAAGCCTCAAGCATCGGGAGCCA
A
gttgggggctgcttccgaggccacagtgcatgcgtttcccacacactttggggagtaaca
gcttttaggaagcatacagtggtgtcatggccacttatggatggacaccctagtgtacag
attttgatttttgctgggatacctcagaaaaatggggaaattgtccagaacttgaaaaag

Exon 16 +      91681      92097   0   Internal    417    86        Good
aagcatgggagcttgctggttctgaggtctcttcctactccggccatcttggtggttcta
cctgagtgcgtggagagggctggagttcgcagctgctcttcatcaagggccctgcccctg
ggtgaatgggagaccctggcttgccgcagccatgatatcccttctcttccttctgcccag
GCATCTTTTGAAGTATCATTGGAGGCCCGAAGCTGTCCCAGCAGACACACGGAGCATGTG
TTTGCCCTGCGGCCGGTGGGATTCCGGGACAGCCTGGAGGTGGGGGTCACCTACAACTGC
ACGTGCGGCTGCAGCGTGGGGCTGGAACCCAACAGCGCCAGGTGCAACGGGAGCGGGACC
TATGTCTGCGGCCTGTGTGAGTGCAGCCCCGGCTACCTGGGCACCAGGTGCGAGTGCCAG
GATGGGGAGAACCAGAGCGTGTACCAGAACCTGTGCCGGGAGGCAGAGGGCAAGCCACTG
TGCAGCGGGCGTGGGGACTGCAGCTGCAACCAGTGCTCCTGCTTCGAGAGCGAGTTTGGC
AAGATCTATGGGCCTTTCTGTGAGTGCGACAACTTCTCCTGTGCCAGGAACAAGGGA
gtcctctgctcaggtaagtgtccccagcaagcactttagctctgagccaggccaagatgc
cgttaggacaccctcccaaagcctgccttttactcagtggtggtagaaagtgtcactacc
atggctctccttggagaagacagtgggcaagccttgctacccgtaggcaggaggtgggga

Exon 17 +     104449     104511   0   Internal     63    96   Excellent
gcatcagcattgagaaatcaggtggctaagaccagaaaggcaaagatagcctttgagacg
gttctgttgctttttacaatggagtcttagatttctagccagtaccatcatctcagaaag
ttaatgctgaggtttggagaaccttggcttaaagcaatatcaccttatttttttttatag
CAGTGGTATTTTGCTACTCAGATACAGAATGCCCCATGTAGTCCAGCCGATGAAGGACAA
AGG
gtgaggggcttgtcagggcattgcctgttgggaaacaccatcagctgactgatggggctg
gtttgttaacaatatgccgcggacagaggagcagctgtccctgagactaaagatgtgtca
ttgtttgtatctctaaagagctttttgctggagaaacccaaacaatgtgcaagaaaagtg

Exon 18 +     104910     104997   0   Internal     88    89        Good
tgttcttccagagaaaagagaattcttaattgtctttttctcatgttactctgaagtctc
tgggtttcttggacatttgttaagaatctgaaatatctcaagaatcacatttaagttctt
caggtatcaataatacttctgttccttttcttatgtccagcattggatgtcttcccccag
GGTTTGAGGTTTGTCCTGGTGATATTGTCAACCACAACCAAAGGACAGCATGTTCTGAGC
ATCTTCTACACGCCTGACACCATGCTAG
gtgtggggcacagaaacataaaacagaggctttgattgcgtgtgggtttgtaggctaatg
agatgaggcagaccagcaaacaaacaagtccatcagtgtgccaagtgattctatacctac
gtctcttaactaagtcttctggtcagcttttgaacatgctcaggtctgtttaatctctct

Exon 19 +     107420     107524   0   Terminal    105    65    Marginal
agacagaggccgcagtccttggaagcttatgtatgtgtttggccacagtgagcccatccc
gggtctggctctggtgctccagagaggactgtggttggcccagcatgtgagcgccaagca
ggtctgtcaccgagctctccccagccactgcgcattccgcactttgtaatctcatcccag
GCTGCCCTGGCTCGGCAGTGTCACACGGCCCTCAGCCACACAGACACCAGCGAACTGAAG
CACACAGCTGCTGACTTGGCTTCCTGCTCTGCCTACGACAGTTGA
tggagagttccagaaactgggcccagagtctcacacagagctggctagaacacacatgaa
atctgactttgggtgatgatagggaaattacctcccatgtgtaaaggcttccagccacac
tccctctatgtctttgagccacttcctgtttacatggccaccttttcggaggagagggga

Exon 20 +     110364     110487   0   Internal    124    73        Good
acagctgaaaatctgtataaatagacacatttacaacttcctgtccatttggctatcaat
cattgtaacaaaggtactaataataacaacttgcatgtgtagcagttcacagcttgcaca
gggatttcacatgtccttcagtatccctatctatgtgtaatgaaaatattttttccgcag
GCACTATTAAATTCAACTCACTTTGCCAAGGTAGCATTAGATGTTAGCTTTGTTTTGATG
AAGAGTCCTGACTTAGGTCCTCTGAGCACTGTCCGCCAGGATGTTGTTCCCAATCCCCAT
GATG
gtgattgataggttattgatccttgggacagggccaaatgacgctggtccttttgatgac
atgtgttcctcctagggcagtaggagggtctggggctgaccagaagatgcaggcaatctc
tgagcacgcaggctgagggaaaggcaggttgaggctcaactgcaggagctgagacatttg

Exon 21 +     112286     112391   2   Internal    106    61    Marginal
aattgaaaccaggctcttgaccagtgtgctccctgaggccagagggtgagggagttgtgt
ggattggatccatttcacctgtgaaggctccccgtggggagttcctgctgccaaggctca
aaagtggtgctggtcccagactggtggagaggaggggcaggaccgccctctcccttccag
GGATGAGCTCATGCTGCCCATTGCCCCAGCCTCTGCTATGGAACCCTTGAGCTGCGAGAC
ACTGCCCTTTCCAGTGGCTTACCCCTCACACGCCCGCATCTACACA
gttaagactgcattccacagcggactccgggcccgagtctggctttccttccctctcctg
gagggcttgccatctgcttcagcgctgcctgtgacatgggagggcacctgctcagcacac
atttgctgtggctctgagacccctgggtaagcagagaggctgtctgagcacaggagggtt

Exon 22 +     114586     114824   1   Terminal    239    52    Marginal
cccctgctgtcccttcatgctggctctaggccctctgtctatctccccaaacaggctctg
agggcagagttggtgttccattctctgctgaatcccagtcctggcatgtggggcaccaga
tggttatgtgctcatgtgtaaaggtgagcaggtgctgatgtgccacatgtatccttttag
GCCATGGCGAGTGTCACTGCGGGGAATGCAAGTGCCATGCAGGTTACATCGGGGACAACT
GTAACTGCTCGACAGACATCAGCACATGCCGGGGCAGAGATGGCCAGATCTGCAGCGAGC
GTGGGCACTGTCTCTGTGGGCAGTGCCAATGCACGGAGCCGGGGGCCTTTGGGGAGATGT
GTGAGAAGTGCCCCACCTGCCCGGATGCATGCAGCACCAAGAGGTACTGGTTCCACTGA
cagccccaccttacttctcacccaggccaggcctgtggtccagccaggcagccctcaggg
ccggctagcctccactcctcacctcctgcatctcccacccagcaagcctcgctggggagc
cgcattcttaccaaccgtaactgaaactgtggctttcaaatgctggttccataagggttt

Exon 23 +     122153     122272   1   Internal    120   100   Excellent
ctgcattcttggtgtgagaaaactgaactcatcttcaaaggcccagcctccccttaagat
tttctgcccacaccccccatgccctttcctttttcaaggcactcggctccctgccccgac
catcagtggctgtgggctgctcagagagactcaggccattcccgcttggttttcttccag
TGAAAGATGACCAGGAGGCTGTGCTATGTTTCTACAAAACCGCCAAGGACTGCGTCATGA
TGTTCACCTATGTGGAGCTCCCCAGTGGGAAGTCCAACCTGACCGTCCTCAGGGAGCCAG

gtaggtgagggctgcaagggctcggcccactcagccagccctcagttctgatttctgatg
ccattctctgctctgggaccactgccctttctgtcctcatcggccttttgaaactgcagg
gagaggagggatacaatttcttctttttctttttttttttttttttgacacaggctgtca

Exon 24 +     123941     124107   1   Internal    167    80        Good
ctgtcccttttgaatctttcattttttgtacattggggaaaccctcctgaggatctaagg
gagagccgaggagaaggcctttggaaggggtgcaactttcatctcagaaatgcctgcagt
tgcgtgagaggggcatggtgatgctagtggctttgcttaccatgcttctggtccccccag
AGTGTGGAAACACCCCCAACGCCATGACCATCCTCCTGGCTGTGGTCGGTAGCATCCTCC
TTGTTGGGCTTGCACTCCTGGCTATCTGGAAGCTGCTTGTCACCATCCACGACCGGAGGG
AGTTTGCAAAGTTTCAGAGCGAGCGATCCAGGGCCCGCTATGAAATG
gtaagcacgtgggaaatgggaagcagaggagacttcaagctcagaggcgtggttgagttc
agcggtatgttagcaatagaggctcactaatgtctttggcattaaaaacaaaagaatcaa
caccagaaacgctgtgcccagttctggagagagagaattgcacagccccagtgcagagtg

Exon 25 +     124780     124875   0   Terminal     96    90   Excellent
gcgatggctttcctggggaacacagagctgtcctagagcccacggccgtctcctcctgag
tgctctgcctgctgctgtcgcagggggctgacctgggaagggatcctagggcctgcgtct
gtcggtttgagtgtgtgagctaacatgtgtcctcatcctcttccccgccgtgttctgtag
GCTTCAAATCCATTATACAGAAAGCCTATCTCCACGCACACTGTGGACTTCACCTTCAAC
AAGTTCAACAAATCCTACAATGGCACTGTGGACTGA
tgtttccttctccgaggggctggagcggggatctgatgaaaaggtcagactgaaacgcct
tgcacggctgctcggcttgatcacagctccctaggtaggcaccacagagaagaccttcta
gtgagcctgggccaggagcccacagtgcctgtacaggaaggtgcctggccatgtcacctg

Exon 26 +     125588     125700   0    Initial    113    56    Marginal
atgcctgttgaaggtacatcgtttgcaaatgtcagtttcctctcctgtccgtgtttgttt
agtacttttataatgaaaagaaacaagattgtttgggattggaagtaaagattaaaacca
aaagaatttgtgtttgtctgatactctctgtgtgtttctttctttctgagcggacttaaa
ATGGTGCCCCCAGTGGGGATTGAAGCGGCCGTGTACTTCCTCAGGGATGGGACACAGGCT
GGTCTGATACTCCAGACTGCAGCTTGTCAAGTAAGCATGAGGTGCTCGGGGCA
gtgagggctgtgcaagggggaacactgagcagatacctttggccccttccagcttttact
gacagagagttccaggctagacaccataaaaaccaccccttgttctgaggggctgaggct
ggaaatagattgtacagacaagcaagggttgagtggtggttcccacacgaagtcatctct

--------------------------------------------------------------------------------