--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (111583 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (23 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1490       1518   0    Initial     29    53    Marginal
ccctacccctaccgggctgggtccgcacgccgccgcccgctagggtcgggcaggcggcgc
aggggtcgtggagaggccgggccgcggcctgcgaggctgctgggcagggcagggctgggc
gggcccggggaggggtaacctgggggattcagagcgcccgcctgccggggggcgaccgcg
ATGCAGCGTTCCCTGCCGCTGGAGTCGGG
gtgacagcccggacccccacccagtgggccgccggacgacgtgacgctgtttggcccgag
agagcctgggaagccacccaaggagggtgtggttaaaaaaaaaaatcttgtatatggata
tcatatgtatttatatttacactaaagcagtctatatgcctccagttttgtttctatgca

Exon  2 +       2240       2467   0   Terminal    228    73        Good
ataattctccagaggccttcacggggtgtaagagaagagaggagctagactccttgcttg
gggacacacccttggtatagaatacttgaggaggtatggcggtaggtgtaggtaataggg
aaatacttagttttgttttaaccatgagtaattaagtggagattttctccttatctgcag
GAGTTTAGTGGAAGTGCTGATGAGCTGAGAATGCAGGGTGCTCCCCGAGTGCCAGCTGGC
CTCATGGAGAAAAAACTATCATTAGGAATCCTGGCTGGCTCAGTTTTTTTCTTAATAACC
AAGGAGAGGGATGGTGGTGGGAGGTGGATGGTGTCTCTCATTGACTCTGGAAAAGCAACT
TCCAAATGTGTGGCATTATTGCTGGCAGGAGAAAAACATCACCCATAA
atcacagtaccatgtaatgcctttattttgtgtatgtttcttttttaaattgcgaattgc
tttttaagtgacaaattaatggagctggcaagagtttcagaaactgaattttatgaagat
ataagtgtttcaaatattgcagtaatttactgtaatatgttatatgtgagaaaagcccta

Exon  3 +      10773      10925   0    Initial    153    60    Marginal
agccaggcgcgggatataatttcctggtgtgccgtttgctaagaccattggaaaagcgca
gtattagagtgggagtgtcccgattttccaggtaccatttgtcacggcttcccttggcta
ggagagggaactccccgaccccttgcgctttccaggtgaggcaatgccccaccctgcacc
ATGGGCTGCACCCACGGTCCGACAAGCCCCAGTGAGATGAACCTGGTACCTCAGTTGGAA
ATGCAGAAATCACCCATCTTCTGCATCGCTCACGCTGGGAGCTATAGACTGGAGCTGTTC
CCATTCCGCCATCTTGGAACCTCCCACCCTAAA
gtgatttttttttaactcaaggtttacagacagttttttgtcattatatgacacagttaa
gagaatttatatgagatctatgttaatagatcaaggaaagtagagatttctctattaatt
ttctttctcttgacaatattcatctcccttttgtctgtactattgtgtggtagggagtaa

Exon  4 +      14155      14301   0     Single    147    61    Marginal
cctgaaattattataaggcaatcatggactaacactacaatctcaaacccagctcaacta
tagattaaaaggattgagcctccactcccagtttcccagcaacttaattgaagaaggaac
tttcctttatggagataaattaatgttcttttatacgcagtatctggcatgaaataaatt
ATGAGATATACAAAGAAACAAGAAAATGTGATCCATGGTCAGGGGAAGAAAGAGGCAACA
GAAGCAGTCTCAGTGATGGCCCAGATGTTGAACAACATGGATAAACAGAGAAAATTTCAG
CAGAAAGATGTAAAGTGTGAAAGATAA
agatgtaaactatttctccaagtagaaatgctagaaatgaaaaatatattagaaatgaag
aattcatttgataggcttaatagcagactgcacacagcagaagaaagcaccagtaaactt
agggacagatcaataaaaaatcagcattcaagatctgtgggacaatacaaaattgtctag

Exon  5 +      21423      21484   0   Internal     62    55    Marginal
taggacataaaatattttatattactcaatattagaatatggtggctgcatgaaattagt
cacaccctatttgtaggacaataattggggccgttctgatctagtagtataaaaacaatt
aattttttccacattgattaaagaacattttcacaatttcctttttttttttctttccag
GTTTTCTCAAACAATGATGAAGGCCTTATTAACAAAAAGTTACCCAAAGAACTTCTGTTA
AG
gtaaatgtagataaattctggatgaagagtttagatctgatttagtcatcaagttccaag
actatcttctttctcactgtgagtccatagcatagaaaaacagacagaattagcctaact
gactttttgtttttgttttatagaatgctgttcagcttgttgttaaattttacttggtct

Exon  6 +      23550      23579   0    Initial     30    48    Marginal
tagcttctttgtggtagtgatcacatttcagggacttcagagggtgtttcattagtcatc
aggtgttgtttgacactgttgtcatgagctccttctcagttgattaaaaaaactgagaca
ggattgtatgaaaaatatcaattatattttccaataagacaaatatttggataagagaga
ATGTTCTTTGGCATTTTTGACAAGTTTAAG
gtaagaaagtggtgacaagaaagaaatgtatgtttgccatataaacccaaaaggctttgc
tcaagcacagtaagttgttagaagcaataccgctgtgtcccggtgggcagattgtcacta
tacaactgcacggatgccatccacattgactacagtgtagatggtgccccctaggattat

Exon  7 +      25155      25228   1   Terminal     74    73        Good
tgggacagtgtagtctgttgttcctaatcttgttgaattcctattcaccttcagtcttac
ttcctcaatacatgtgaattctttgactttgagacagacctatttgctttcagtccagat
cattttctcttctgccacttttgactgcttctgttactgccatctttaattctcaactag
CTTCCAATACTGATCACATCAACCGAAGCTTCAGCTTCCCCTTTGGAACCATTAACAAGC
ATAATCTGGAATAA
tatgctgcttttcatctctctgttatcactttgaatccactcagaaaaatctatgttttc
ttttcatctgattttattgatagttttacgaatatatattatttacagattccttctcta
ctacccatttttagtttgttactgaacaagtttttacagttttgctttttaaaatccagc

Exon  8 +      31663      31764   0    Initial    102    45    Marginal
aacgataatgcaaatgcagtataatttagctttggcaaatttgggtgaagaatatgcaaa
aattatttgtcatacttttgcaactttactgtaaatcagaaattatttaaaaataaaaac
tagttggtttctcatcctctgaaggtgaccacatagatttttttaaaaagttataaattt
ATGAATTTAAACATATTTGATAATTTTCAGTCCATTGAAATTACCTTTATTGAAAATCAC
ATTGTCTTGTCTTTGGCTCCTGAGTCCATTTACATGATCTTA
gtagggtttgtttgtttttagttttttgttgttatttttgtttgtttgtttgttgaggca
gggttttactgtgttatccatgctggccttgaactcctcagctcaagcaatattcctgcc
attgcctcctcagtagctggaaccacaggcacctgccactgcacctggcttcttgtagct

Exon  9 +      52442      52551   0    Initial    110    40        Poor
tagagcggtggaacagaatagagaacctagatatagatccctgtacttacagccaactca
tttttgacaacggcaccaagaacataaaatggggaaaggatagtttcttcaataaatggt
gctggggaaactggataaccctatccagaaaaatgaaactagacccctgtctctcaccag
ATGCAAAACCCAAAATGGATTAAAGACTTAAATTTAACACCTGTAATTGTGAAACTTCTA
GAAGAAAACATTGGGGAAACACTCCAGGACGTTGGTTTGGGCAAATTTGT
gtgtgtgcatgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtgtaagacctcaaaaatcaca
ggcaaccaaagcaaaaatagacaattgggattacatcaagctaaaactattctgcacagc
aaaggaaaccataaccaaagtgaagagacaacccacagaatgggactaaatgtttgcaaa

Exon 10 +      60402      60482   0    Initial     81    64    Marginal
tgtgaaaggtaaaacagattctagaagaaaatacacaagaatatctttataatctcaggg
taagcaaatatttcgtcaacatgacatactgtatcttcataaccatttaaaataattgat
aaattggacttcactgaagtaggaaattgtttattaaaaaacaactgagcgcagtgactc
ATGCTTATAATCCTGGCACTTTGGGAGACCGAGGTGGGTGGATCACGAGGCCAAGAGATC
GAGACCATCCTGGCCAATATG
gtgaaactccatctctactaaaaatgtaaaaattagctgggtgtggtggcgtgcacttgt
agtcccagctactcaggagggtgaggcaggggaatcgcttgaacccaggaggtagaggtt
gcagtgagccgagatcccaccactgcactgcagcttggtgacagagctagactctgtctc

Exon 11 +      61219      61260   0   Terminal     42    90   Excellent
tcatatccaaaagataaaaagaactacaaatctatcagaaaaagaaacccaatttaaaaa
aatgagtgcttcacaaaaacccccaaaatggccaataattatatgaataggtgctcacaa
tcatcacttgtagcagggaaatacattttaaataatacaatatcattatatccttattag
AAGGATGGTGTTAAGAAGACCAACAATACCAAGTATCCATAA
aggtgtgaaataattgaaactcttgtaaattattcatggaaggataaattggcacaactg
ttatagtttagaaaacttttagcaataactactaaatgggaagttctagccatagcaatc
aggcaaaagaaagaaagaaaagggatccaggtaggaagaaaggaagtcaaactatcagtc

Exon 12 +      62881      63082   0    Initial    202    59    Marginal
aaagagcttctgcacagcaaaagaaactatcaacagagtaaacagacaccctacagaatg
ggagaaaatatttgcaaactatgcacctgacaaaggcctaatatccagaacctataagga
atttaaataaattcacaaacaaacaaacaaaaaaacccttttaaaaagtgggcaaaggac
ATGAACAGACACTTTTCAAAAGAAGACATACATGTGGCCAACAAGAATATGAAAAAAAGC
CCAACATCATTAATCATTAGAGAAATGCAAACCAAAACCACAATGAGATACCATCTCACA
CCAGTCAGAACAGCTATTATTAAAATTCAAAAAACAGATGCTGATGAGGATGCAGAGAGA
GGGGAATCCTTATACACTACTG
gtgggactgtaaactagttcagccactgtagaaggcagtttggagatttctcaaacaact
taaaacagaactaccattcagcatggttgcagctggaggccattatcctaagcaaactaa
ttcaggaacacagaaccaaatactgcatttttttaaataagtgagaactaaacattgagc

Exon 13 +      63879      63954   0    Initial     76    46    Marginal
cagagcaaaaagtacaaactgctgcatcatgcaacagcatggacaaatttcacagacagt
taaaggtgaaaaagtaaaaccaaagactgcatagtgtttgattccatttatgtgaagtgc
aatatcagttgaaattaatctatggtaataaaattcagaggtgtttacttctgggagggg
ATGTATTTTGTTTATCTCTGGGTGCATAAAAAGGCAAAACAGAATCTTTTGGTGTTGAAT
GTGTTCTATGTCGAGA
gtgagatagtggtattataagtttgtatatgtatttttatacctaggatttgtatacctt
agtggatgaatgttatactttaataaaaaatcatttttgtgggggcgtattttagatctg
gctactgaacatgcaataatgaccatccgatatcattgtgctgccttagcatccatatta

Exon 14 +      70392      70508   0     Single    117    42    Marginal
tcctaactactcaggaggatcccttgagcccaggatttcaaggttacagtgagctatgat
caccccactgtactccatcctgggtgacatagcgagaccccgtctctaaaaataaataaa
taagtaaataaataagctttaaaaaataaaaaggagtagaaattaaggaaattaataaca
ATGGAGAAAATAAGTGAAACCAAAAGCCAGTTCTTTGAAATGTTCAGTAAAATTGCTAAT
CCTTTAGTCAGACTAACCAAGATAAAAGAAGAACTGAAGTACCAAGATCAAAAATGA
aagggattgttgttgctggtcacatgggcattagaaggataataaaggaatattatcaac
aactctgtgttcagatttaaaaaaaaattttgtggatacacagtaagcatatatatttat
ggggtatatgagatactttgatacaggcatgcagtgtataataatcatatcagggtaaat

Exon 15 +      73677      73811   0   Internal    135    83        Good
tttactttagtgactttttattatggctttgatctcatgttcacaaatttgataacttag
atggaaaggactaattccttgaaagacacaaactaccaaaaactcacacaaagagaagta
aactgaataggcatatataataaagaaatgtaattaatagttaataaccttccaaaacag
AAAGCACCAGACCCGGATGGTGGTTTTACTGGTGAATTCTACCAAACATTTAAGAAAGAA
ATGATACCAGTTCTCTATAATATTGTCCGGGAAATGGAAGCAGAAGACTTCCCTAACTCA
TTCTGGGTGCCCAGT
gttactataataccaagaccatataaaaatattacaaaaaaggagaactcaagaccaaca
tttttcataaaaatagatgcaaaaatatttaacaaaatattagtaagtcaaatccagtga
tgtataaaataattatatcccacaataaagcagaatttatttcaaatatgcaaggatatt

Exon 16 +      83042      83116   0   Internal     75   100   Excellent
aattttattatcttttatacttaatataacataatggtataattttgcatttgatgatta
acttaatatacatcaaaaataggagtttggaaataaaggttaatcaagactttctttaat
agtctcaataaatgtgtttctttcatcccaatccctcttcctttacctcccaccttccag
GCTTGGAACATCTTAGCCCTGGATGGAAGCAACTGGCAAAGAATAGATCTTTTTAACTTT
CAAACAGATGTAGAG
gtaagttagctttggtttagacaaaaaactttttaaaaatatgagtagctgttccccctt
tcctgactttttattttactgcatttagatctaatattaaagtgctgaggtagaacagaa
agaagaaaaactggaagggatttgcatacatcaaaacaaaaccctgcttgcattttaaat

Exon 17 +      96072      96227   0   Terminal    156    46    Marginal
ttgcctaggctggtctcaaactcttgggctcaagggatcctcctgctttggtctcccaaa
gtgctgggattacaggcatgagccaccatgcctggcctgtacttaattcttgaggggcac
cctccacagatctctggagttctctttgtgacgttctctctactccaatgctcttgccag
ATAACTCCAGCTGCCTTGGTCTTCCTAGAATTTCAGCCCCATTTCTTCATCTCAGACAGT
CCCATCAGGCTTGGTTCCCCCTACCGGTACCAGGGCAGGTTGGAAGGAGCAAATCTCAAA
GCTGTATTTCAGAATGATGGAGACGACCTGAGCTAG
tccttgctgaatatgttaagcagtgagtggtgaatagggcgttttaatgtgctgcttctg
gccttgctaccaacccacagatcaatgaggaagttcctcttcatgactgaatgtcctcac
cagtaaaatgagtgggtcttgatactgattaactgctagacgtcttctatcaatcgccag

Exon 18 +      96851      96919   2   Internal     69   100   Excellent
actgtcgagccccattctagatctatcatcagaatctgcactgtgacaagaaccctagct
gattgttacgcgctttaattaagtttgagggagcgctgttctaagcgtgaatggtttcat
atgccctctagtggctgtccagcaacttgcagggagctttaaaatgttttctcattttag
GACCTTTGCACAGAACTGCCGAAACATTGAACATTTGAACCTCAATGGATGCACAAAAAT
CACTGACAG
gtaagtaatgaagattaattggtgaccaaatagccacggggagagagaagggagagaaac
gtggttgaaaatatctttagtgcgtctgctctttttcagcacgtgttatagccttagcag
attctgttccaagctgaaacatctggatctgacctcctgtgtgtctattacaaacagctc

Exon 19 +      97337      97463   2   Internal    127    99   Excellent
tatgaacattctggaaaccttcttaatggtcacgttggatccagcaagaaataggtgact
ccaagaggtcccaggcatggtctccccttcggaatttcttgtgatgtactaaactcagag
ttggtcattaactctctacaggagagactgcacataagtttttgtttcttgttctctcag
TGAGGGCTGCCGAAACCTGGAGTACCTGAACCTCTCTTGGTGTGATCAGATCACGAAGGA
TGGCATCGAGGCACTGGTGCGAGGTTGTCGAGGCCTGAAAGCCCTGCTCCTGAGGGGCTG
CACACAG
gtaccagagggttgatacagctgtttgtgttatgtgtcaggtgtgggcacatcatccaga
aagctgcttttgcatttttcttggtgtcccactgttccctcacctggattccagctgtct
tttgttttctctgtccactcagttagaagatgaagctctgaaacacattcagaattactg

Exon 20 +      97606      97680   0   Internal     75    72        Good
gaggcctgaaagccctgctcctgaggggctgcacacaggtaccagagggttgatacagct
gtttgtgttatgtgtcaggtgtgggcacatcatccagaaagctgcttttgcatttttctt
ggtgtcccactgttccctcacctggattccagctgtcttttgttttctctgtccactcag
TTAGAAGATGAAGCTCTGAAACACATTCAGAATTACTGCCATGAGCTTGTGAGCCTCAAC
TTGCAGTCCTGCTCA
gtaagtagcgtgcctttcctgaacactgtttgctctatcttgtctcccaaagcagtctgc
ctcaggcctccctgcagccccctaggcacctgagatgggctgtgttgccacaccctgatt
tccatcctgtgtccttatataacctaccaatttgtcacaagctggaacaacaacaacaac

Exon 21 +      98208      98259   0    Initial     52    60    Marginal
ttaaggatgatgactcctctcacgttgtttcagtggataaaatgaaataacacatgcaaa
aatgctttaaagaataaaacgcataggcaagagcaaggtggcattttcatcaggacatta
gcctatgaaaaactattggtccttctccactgccattgtaaatgttgataattgaagagg
ATGCTTGCTACATCCTACCAGGTTTTCAAGGGGAACATAGATTTTGAGAAAG
gtaagggaaaacccttgcattcagctttaaatgaatatattataaatctttagagtccct
agtggtggggaaaaaaaccagaaactatcttatggacaaacgttgaccatatgggccagg
actactcaaaaataggaccttgacttacgtgtagcatagcagtggctgatggcttgaagt

Exon 22 +     102444     102500   0   Internal     57    69    Marginal
gcatctctagaagtgggcagattttagagtgctggtgaagagaggagctcccagccccag
agtgtttgagatgagtttttaattcttttacaccttttgattctcgtgttcaggagaagc
caggattaggtattaagttctggtgtagaagccacactgacacagcatgtttctctccag
ATAACCGACAGCACACTCATCCAGCTCTCCATTCACTGTCCTAAACTGCAAGCCCTG
gtgagtctgagtttttctgacattattcacctgttaaagatgaaagagccctcccaccac
aacaagaagctgtttgggttctctttctgtaaggtatcatctctcttgatttcaaaaatc
tattaattgggctaacttgggaggcaaggtatctaaatatttgattactgctttcattga

Exon 23 +     107748     108041   0   Terminal    294   100   Excellent
gaacagaaacttctcatagttctgaaggctgggaagtccaggggctggcatctgctgagg
gcattcttgctgtgtcatcccattgcagaagggcaaaaaggctagcttccagcttttttt
taggacttgagccttggaataagggtcctgcaaacatttactcatgtcttcctgttccag
AGCCTGTCCCACTGTGAACTCATCACAGATGATGGGATCCTGCACCTGAGCAACAGTACC
TGTGGCCATGAGAGGCTGCGGGTACTGGAGTTGGACAACTGCCTCCTCATCACTGATGTG
GCCCTGGAACACCTAGAGAACTGCCGAGGCCTGGAGCGCCTCGAGCTGTACGACTGCCAG
CAGGTTACCCGTGCAGGCATCAAGCGGATGCGGGTAGGTATGGGGCAGGGGAGTCAGTCA
CACCTGACATTTCTAAGCACCAAAGGAAAACATCAAGAATCAGACCGGGGCTAG
gcacgcggtggctcacgcctgtaatcccaacactttcagaagccaaggtgggtggaccac
ttgaggtcaggagttcaagaccagtctggtcaaaatggtgaaaccccatttctactaaaa
atacaaaaattagccaggtgtggtggtgggcacctgtaatcccagctactcgggaggctg

--------------------------------------------------------------------------------