--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (90936 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (32 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       6439       6508   2   Internal     70   100   Excellent
ccaattcgtcttctttaacatgagtctctaaagagatatggcacctaccaccattaccag
tctttgatacattttggttacactttcagacaataattcaattgttagattctttactac
tacaatttgtgttctttgtgagaagatgctcttaatatacctcattttcatttaaaatag
GCATCCTGCTGTGGAGGATCAGAGGAAGGAAGAAACTGAGAATAAGCTAGAAAAATCATC
TGGTCAACTG
gtaagagaaagtttaattttcattaactgttagttaattgataattaattatatatgcaa
atgcagtaatacatctagtcagtttaattacgtgttaaaattttttgagtgagcctactt
tcctaccttcataagtaaaatggtcacagttaaatcttgctttgatgattgatactgtat

Exon  2 +       9524       9679   0   Internal    156    87        Good
gttcctagagagcagagaacatattattcttccttagattttttataattctgtcataga
agctaggagaacaagggaaaatgagctttgttccttttttaatgctttggctgatcttag
aattaagagtgaatgagaatatgcaaactgtgtaaatttttaatcaataatgtcttctag
AACAAACAGGAAAATGACATACCTACTGATCTTGTCCCTGTTAACCTACTATTAGAAGTG
AAGAAGTTATTAAATGCAATTAATACTCTACCAAAAGGTGTGGTTCCTCACATTAAGAAG
TTCTTACAAGAAGATTTTTCCTTCCAAACTATGCAG
gtaacgtcataagttgttatttggggcagaagtgcagctgtctgtatatgacttttttaa
ttaaaattctttttaaaccacacagtatagccaaggtcttgaaaaaaatctccatcttac
ttcttgtaaagggctttgttgtcaaccttgactgtagacttctaaaaagttgaacaaata

Exon  3 +      14891      15007   0   Internal    117    94   Excellent
tacttaaaagcaaacatatgagaacagtgtatctggttggtatggattttttttttttaa
accgtctttatctctatttttaaaattttctccaatgagcatgaattatttgtataatgt
aaacatatgtagatgtttgttcagacttatagacatttttaactgaataattttccacag
AGAGAAGTTGCAGCTAACAGCCAGAATGGTGAGGAAATTGTTCCTGCTTTGACTTTACGT
TTCTTGATTACACAGCTAGAAGCAGCACTTAGGAACATTCAAGCTGGCAATTATACC
gtaagtgttttctttttggaaatttgatataatggacttggtcaacatttctcagtgaga
aaacagccaatgcatgcttattttaaggtgtgggccaatttttatttttttcttttacct
ctagaaaagggtatgtataaattgattgccttcctgtgtcttgtactttcttatatgact

Exon  4 +      17994      18218   0   Terminal    225    78        Good
tctgtaatctggagacccaggaacgcttgtgatataactcatcccagttctgaaggctaa
gaaccaggtataaatccaaggatgaaggcagaagttgagatgagatgtccaagctccagc
aagcaggccggaagcaaaaagggatgaattcttccttcctctactttttgttctatgcag
GCTTTAATGGATTGGATGATGCCCACCTACATTGGAGAGGGCAACCTGTTATACCCAGTC
TACCATTTCAAAGGCAAATTTCATCTGGAAACACGCTCAGAGACACACCCAGAAACAATA
TTTAATCTGGGCACCCTGTGGCCAGTCAAGTTGACACATGAACTTAACCATCACAAATAC
AATGGACAGGGAGGTCTTGGTGTACCCCTCACACAGTTTCCCTAA
atagttacataattacattactccagaacatattaaaaaaaaaaaaacaggaaattgatg
ttggtccatggggctttgtgtctgggttctccaagaccaccctcatgttcagagatttgc
tagaaggactggactcagcatatggttatactaacatctaagatttattatggtgatgtg

Exon  5 +      24195      24323   0   Terminal    129   100   Excellent
actacatgatctttgtaatcacatgcagagatgccaggattcagaatgtgaataaatgac
cagatgattgtattatttttaaagctgccctaatttctccagtttgagaagtaattgttt
attgtaaaaaaaaaaaaaatgacttttacagtagccaaacctagttttatgttactacag
GATTATACAGAAGCTGAGAATAAATTTCTGGTGATGAAGATGATGATCCAAGAAAATGAA
ATTTGTGAAAACTTTATGTCTTTAGTTTATTTTGGACGTGGTTTACTGCGATGTGCTCAA
AAGAGGTAA
ggattttaattaacgggtagatgttgcctgtgaagtctcagcattgtgaaatggaagtaa
gtgtgcacagtatatcaggcattgtgacatttgtgctctactgttttatccttttcttct
ttgcctatttgtatagataatttctttaatgtagttgagaatattaaatagcaaacttaa

Exon  6 +      27128      27261   1   Internal    134    58    Marginal
gtgcattcaatatcagtttgtttcactttatgattaaatttgggccttattttcagcacg
gattatggccataggggatgagagtctctttcaattgcccccatagaggccttctggctt
tcacagtgtatcctgagttaatagttggctgacctgtgcctgtcattctctttcttcaag
GCCTCCAAGACAGTTTAAAGCCAACCAACTCTACAGTCCCTTTAATTACCATGGCCCCCA
TACTGTTCAAGCTTGAGCTACTACATAATCTAGTGCCTCCCCTTCCACCTGTATTTCATG
CCAATCTGCCACAG
gtgagagtgctagtatttgtatttctatggcatgccagaggttatcaccaccctatttac
cacaaaaaaagggttatttgttgtctcattggtaaaccatgcatctacacagtcccgttc
aaactaaccttattttaaaatgcctttcagatataatggaggactgctagaatttcataa

Exon  7 +      27401      27526   0    Initial    126    89        Good
tgcctccccttccacctgtatttcatgccaatctgccacaggtgagagtgctagtatttg
tatttctatggcatgccagaggttatcaccaccctatttaccacaaaaaaagggttattt
gttgtctcattggtaaaccatgcatctacacagtcccgttcaaactaaccttattttaaa
ATGCCTTTCAGATATAATGGAGGACTGCTAGAATTTCATAAAAGCTTACAAGAAATTGGA
GACAAAAATGACCATTGGTTTGACATAGATCCTACAGAAGATGAAGATTTACCTACAACT
TTTAAA
gtaagaaattatttaagagtaacattttatttgtaactaatcagaataaccaactatatc
atattcttacagcaagcatgttcttttattggcacataactttttatacaagaaacaacc
tttattgcattacctagtgcagaacgtatgattcaacaaggagggagaagtgaggtggca

Exon  8 +      31303      31431   0   Terminal    129   100   Excellent
acattgtttactttgaattagggaaatgttttattactattaaaaaaatacatatataca
agtacttcgaaaagggatatgatatggacatattaccaaggtaaaacatgggtagtctta
attgtggtgttaatttattattagtaattcatgagaattctttctgtttttaaaatctag
GATCTTCTTAATAATTTTATCAAGACAACTGAAAGCAATATAATGAAGCAGACGATTTGT
AGTTACCTAGATTGTGAACGATCTTGTGAAGCTGACATTTTGAAGAACACCAGTTATAAG
GTACTGTAA
ttgtcaattaacagtatttttaaaaagtaattgaaaaattatatataactatataaaata
ataaaaattatattatgtataaaatattttaaaagagcatttagtttaattacaatggta
aagcagttgaaaagttattttactatgagaacttagattcagagtgatcaggaactattt

Exon  9 +      32824      32911   0    Initial     88    53    Marginal
aacagcatgcagcagcaggaatacctgggcacacaatttaatttttgtcatcaaagcaaa
aattttaaaaagcaaggttgtagtttccaggcagggtacagtgggaaagacaagcaatct
ataccctcggattatgcagtagctcaggagctgtcagcaaggcagaaaatctgagttctc
ATGATTGGTAACAGAGGGGATTCAGGCAGTAATGGTATGGAGCTGGGGATGGAGGAAAAG
AGAAATGTAAAAATGGAGATGAAGATGG
gtaggtagcatgttcctctgtagacacactcactgggtttctgatattttgttgtacgta
gaatatggaaaatatattaattttttcaaattattgaccttttttttactgtcctaattt
tcctatctttagtgatgtaaaaatgacttgtaaagttatttggtgatctctgatttctgt

Exon 10 +      35846      35898   0   Internal     53   100   Excellent
ctagttcgtttttttgatcaggattatttattacttaccttgttattcatgttttgtttg
ttttatattcactgtggcttcactctcattgtatgtttcaaatgttaagctaagaaataa
cattaaacattttgaaaattgaactactttagggctattttttttccccattacttgcag
TTTGAAGTTGTGAGAAAGGATGAATATATCACCATTGAAAATTTAGGAGCAAG
gtaagcttaaaataaaatactctgttaccttttttggaatatgcatatattttttggttg
cttaattcttctgtgtttctgtcacctaatagagctgcattaaattttaaggtatgtgaa
aaaatcatatttaattgccatttctttccctctctatcaccacttattgtagacatttac

Exon 11 +      42514      42912   1   Internal    399    69    Marginal
gttttttgacaggcagaaagcagcatgctaattgagcactggctgtggcaaagcactgta
ctatccttcattcttttggaatagtttttatcctacaggagcttaggatacaatgtgaga
gaccaaatagaaaatgagcattaatgtggaatgtcttgacttctcaaaatttattttcag
ATGAAATGCCTATCTTCAAGCTTGATTATAATTATTTCTATCATCTGCTTCATATAATTA
TTATTTCTGGTACTGACATTGTTCGACAAATATTTGATGAGGCTATGCCACCTCCTCTTT
TGAAAAAAGAGCTTCTTATACACAAGAATGTGCTGGAATCCTACTACAACCATCTTTGGA
CCAATCATCCTTTGGGTGGATCATGGCATCTGCTTTATCCTCCTAACAAGGAGTTACCGC
AATCCAAACAGTTTGACTTATGCCTCCTGTTAGCTCTTATAAAACATTTAAATGTGTTCC
CTGCACCCAAAAAAGGATGGAATATGGAACCGCCATCTTCTGACATCTCTAAATCTGCAG
ACATCCTGAGACTGTGCAAATACAGGGATATCCTCCTTA
gtgagattttgatgaatggtctcactgagtcacagttcaattcaatttggaaaaaagttt
cagatattcttctgcgccttgggatgatgcaagaggatattgacaaagtgaaggagaatc
ccattgagaatatctcccttgattaccatcagctatctgtctacctaggcataccagtac

Exon 12 +      46293      46424   1   Internal    132   100   Excellent
tgtacatattatttggtaactgataaatgaacatcacattttcatcgagtaattgaaaag
agtaagatatattttatttctgttttgtgaatgttgcttttttgggcaaacattataaca
ttgataagaagctgaaattgctttcatctagattttgagaattttgtcttttatgtttag
GTATTGAAATAGAAGAGTTACAGAATGAGGAAGAAGAACTAAGTCCACCTCTCATGGAGT
ACAATATAAATGTGAAATCACACCCTGAGATACAGTTTGCAGAAATTAATAAAGATGGGA
CCTCAATACCCA
gtgaatcttcaacagaatctcttaaagatctccaggaagtataagctctcattaatattt
gagttagaagaacttattctgggcctttaatttgttgcatgtgctgtacttaaagcatcc
cagataattttagcttatattttcatagtgtttatacagagcttgaattggaatggtcct

Exon 13 +      47268      47312   0   Internal     45    89        Good
aagactaggattaaaataaaaatgataaaaacaaaaataattgtttccatagaatctaga
aagaaatacctataatattagaaaacaaaagatctcagtggtgagaggaaatatattttg
caaaataacccattgggcaatttgaattacatatttaataaataattttttacctactag
GTTAAGAGTAAACAAAGGAAAAAGAAGAAGACTAAGAATAAAAAG
gtaagagactataatagcattataatactgattatgaacacttgagttaaatacatgaat
tcattgttagaacttaaattagttcaagtagacatatagcacaaatgattcaatagctta
ctgagtatatgattatagagaagtctacatatgttatatcctgaatgattttgaagtacg

Exon 14 +      49487      49512   0   Internal     26    89        Good
atttcagttttatacttaggtataaaagtatatgcataagtgcatatgacatcatgatat
atatttctttagttatgatcaaaaattttttgagaaacactgacctaaatgtaattatat
tactagtatgttgttttgatatagttgatatagattactaattcttatgttatttttcag
AATAAAGACTCAAAAGAAGACCAAGT
gtaagtattagtttatttaatttttaaatttttcttagtatttttaaggcatactttcct
aatatgacacaggcttccttcctttgggaagttttctcactaagagaagaaggatagttc
cttgtcttaataattaacaagttgctgcttttttatagaaagtaacaaaaagttaaatga

Exon 15 +      50495      50598   1   Terminal    104    69    Marginal
acttggtatataaaatagttcatcatttaagttgtgttttcactttctttggcaacaagt
tgagccactggagcaatagttttgttttgttttgtttttaggctgtgtctaaatgccata
aatatagcgtaataaaaatgaaacaatgtcatcaatcactttgccattttgcttacacag
TGGATCCAAATCTGGATGATGATCAGATCATCCAGGAAGCTTTGTCTTTAAATGAGAATT
TTCAAATATACACAGAAGTAAAGAGAATAGTATATATACAATAA
catatatacctataactctgattcaacaattatttatgtttttcacatttgttccatact
tcctttgacattttgttctttattgaagtgttttcaatcccaaacatccttgtaatttca
tcccttcattcttcagtttacatcttagaaatatgaacatcttcctatattatctcaatg

Exon 16 +      52604      52660   0    Initial     57    46    Marginal
tggaagcaatagcttagatgaaaattactatacaattgtaaaagctcacattgattatgt
cacgactacagcccatatgtggtagaaaaggaagagcagttgaggaaagaacaagcaaat
ccacactcagtcagtagacttataaaagatgatgcaagtgatgttcaagaggattctgca
ATGGAAGACAAGTTCTATAGCCTGGATGAATTGCATATTCTGGACATGATAGAGCAG
gtaagcatgattagagagggtgcctgccttctcttattgttatctggtttttcctgtgac
tctttaaacagcatcaccctttgaaaagcccagtggtttatactgtttgtgaggagaaag
agaaaagcataaaaggtaaggagggatatatgaaggaaaatagaataaggaaaaaaaaga

Exon 17 +      55962      57482   0     Single   1521    91   Excellent
aaatgctgagagatttttgtcaccaccaggcctgccctaaaagagctcctgaaggaagca
ctaaacatggaaaggaacaaccagtaccagcaactgcaaaaacatgccaaattgtaaaga
ccatcgaggctaggaagaaactgcatcaactaacgagcaaaataaccagctaacatcata
ATGACAGGATCAAATTCACACATAACAATATTAACCTTAAATGTAAATGGGTTAAATGCT
CCAATTAAAAGACACAGAGTGGCAAATTGGATAAAGAGTCAAGATCCATCAGTGTGCTGT
ATTCAGGAAACCCATCTCACGTGCAGAGACACACATAGGCTCAAAATAAAGAGATGGAGG
AAGATCTACCAAGCAAATGGAAAACAAAAAAAGGCAGGGGTTGCAATCCTAGTCTCTGAT
AAAACAGACTTTAAACCAACAAAGATCAAAAGAGACAAAGAAGGTCTTTACATAATGGTA
AAGGGATCAATTAAACAAGAAGAGCTAACTATCCTAAATATATATGCACCCAATATAGGA
GCACTCAGATTCATAAAGCAAGTCATTAAAGACCTACAAAGAGACTTAGACTCCCACACA
ATAATCATGGGAGACTTTAACACCCCACTGTCAACATTAGACAGATCAATGAGACAGAAA
GTTAACAAGGATATCCAGGAATTGAACTCAGCTCTGCACCAAGCGGACCTAATAGACATC
TACAGAACTCTCCACCCCAAATCAACAGAATATACATTTTTCTCAGCACCACACCACACC
TATTCCAAAATTGACCACATAGTTAGAAGTAAAGCACTCCTCAGCAAATGTAAAAGAACA
GAAATTATAACAAACTGTCTCTCAGACCACAGTGCAATCAAAGTAGAACTCAAGATTAAG
AAACTCACTCAAAACCGCTCAACTACATGGAAACTGAACAACCTGCTCCTGAATGACTAC
TGGGTACATAACGAAATGAAGGCAGAAATAAAGATGTTCTTTGAAACCAACGAGAACAAA
GACACAACATACCAGAATCTCTGGGACACATTCAAAGCAGTGTGTAGAGGGAAATTTGTA
GCACTAAATGCCCACAAGAGAAAGCAGGAAAGATCTAAAATTGACACCCTAACATCACAA
TTAAAAGAACTAGAGAAGCAAGAGCAAACACATTCAAAAGCTAGCAGAAGGCAAGAAATA
ACTAAGATCAGAGCAGAACTGAAGGGGATAGAGACACAAAAAACCCTTCAAAAAATCAAT
GAATCCAGGAGCTGGTTTTTTGAAAAGATCAACAAAATTGATAGACCGCTAGCAAGACTA
ATAAAGAAGAAAAGAGAGAAGAATCAAATAGACACAATAAAAAATGATAAAGGGGATATC
ACCACCAATCCCACAGAAATACAAACTACCATCAGAGAATACTATAAACACCTCTACGCA
AATAAACTAGAAAATCTAGAAGAAATGGATAAATTCCTCGACATATACACCCTCCCAAGA
CTAAACCAGGAAGAAGTTGAATCTCTGAATAGACCAATAACAGGCTCTGAAATTGAGGCA
ATAATTAATAGCTTACCAACCAAAAAAAAGTCCAGGACCAGATGGATTCACAGCCGAATT
CTACCAGAGGTACAAGGAGGAGCTGGTACCATTCCTTCCGAAACTATTCCAATCAATAGA
AAAAGAGGGAATCCTCCCTAA
cttgttttatgaggccagcatcatcctgatagcaaagccgggcagagacataacaaaaaa
agagaattttagaccaatatccctgatgaacatcgatgcaaaaatcctcaataaaatact
ggcaaactgaatccagcagcacatcaaaaagcttatccaccatgatcaagtgggcttcat

Exon 18 +      57755      58780   0     Single   1026    87        Good
tcgatgcaaaaatcctcaataaaatactggcaaactgaatccagcagcacatcaaaaagc
ttatccaccatgatcaagtgggcttcatcactgggatgcaaggctggttcaacatacgca
aatcaataaatccagcatataaacagaaccaaagacaaaaaccacatgatatctcaatag
ATGCAGAAAAGGCCTTTGACAAAATTCAACAACGCCTTCATGCTAAAAACTCTCAATAAA
TTAGGTATTGATGGGATGTATCTCAAAATAGTAAGAGCTATCTATGACAAACCCACAGCC
AATATCATACTGAATGGGCAAAAACTGGAAGCATTCCCTTTGAAAACTGGCACAAGACAG
GGATGCCCTCTCTCACCACTCCTATTCAACATAGTGTTGGAAGTTCTGGCCAGGGCAATC
AGGCAGGAGAAGGAAATAAAGGGTATTCAATTAGGAAAAGAGGAAGTCAAATTGTCCCTG
TTTGCAGATGACATGATTGTATGTCTAGAAAACTCCATCATCTCAGCCCAAAATCTCCTT
AAGCTGATAAGCAACTTCAGCAAAGTCTCAGGATATAAAATCAATGTGCAAAAATCACAA
GCATTCTTATACACCAATAACAGACAAACAGAGAGCCAAATCATGAGTGAACTCCCATTC
ACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCCAACTTACAAGGGATGTGAAGGAC
CTCTTCAAGGAGAACTACAAACCACTGCTCAACAAAATAAAAGAGGATACAAAGAAATGG
AAGAACATTCCATGCTCATGGGTAGGAAGAATCAATATTGTGAAAATGGCCATACTGCCC
AAGGTAATTTATAGATTCAATTCCATCCCCATCAAGCTACCAATGACTTTTTTCACAGAA
TTGGAAAAAACCACTTTAAAGTTCATATGGAACCAAAAAAGAGCCTGCATTGCGAAGTCA
ATCCTAAGGCACAAGAACAAAGCTGGAGGCATCACACTACCTGACTTCAAAGTATACTAC
AAGGCTACAGTAACGAAAACAGCATGGTACTGGTACCAAAACAGAGATATAGACCAATGG
AACAGAACGGAGCCCTCAGAAATAATGCCACATATCTACAACTATCTGATCTTTGAAAAA
CCTGACAAAAACAGAAATTGGGAAAGGATTCCCTATTTAATAAATGGTGCTGGGAAAACT
GGCTAG
ccatatgtagaaagctgaaactggatcccttccttacaccttgtacaaaaaccaattcaa
gatggattaaagacttaaatgttagacctaaaaccataaaaaccctagaagaaaacctag
gcaataccattcaggacataggcatgggcaaggacttcatgtctaaaacaccaaaagcaa

Exon 19 +      60227      60322   0   Internal     96    99   Excellent
caagtaactggtactgtttattaaatgctgtaattgaggggaggtgggtttatctaaatt
gagtgtttgacttgagacaaaaaacgtgaaaggagttagatggcaactttaaatcccttt
caaataactaaaatttttttttgaggaaaataatacatgcatatttcctgtgctcaatag
GGCTCAGCTGGCAAAGTAACTACAGACTATGGAGAAACTGAAAAGGAAAGGCTTGCTCGT
CAAAGGCAGCTTTATAAATTGCACTATCAGTGTGAA
gtaagtatttttgccattagatctgatggaagtgagaagtatttcaaatattaaacttac
tggtgctttctgtttgaaaagaacttagtttgcttttttctttcaatttctggtgacttg
aacataattatctgaaataatattttttattgatcaggatttcaaaagacagttgagaac

Exon 20 +      60480      60607   0   Internal    128   100   Excellent
ataaattgcactatcagtgtgaagtaagtatttttgccattagatctgatggaagtgaga
agtatttcaaatattaaacttactggtgctttctgtttgaaaagaacttagtttgctttt
ttctttcaatttctggtgacttgaacataattatctgaaataatattttttattgatcag
GATTTCAAAAGACAGTTGAGAACAGTGACTTTTCGGTGGCAAGAAAACCAAATGCAGATT
AAAAAGAAAGACAAAATTATCGCATCTCTTAATCAACAAGTTGCTTTTGGAATCAATAAG
GTTTCCAA
gtaagtgtaaatcttttgataaagggaaattctgcgccgtaataaacagtatctttaata
gttaatctctgcataaccactaggtggcactgtgactacacattaggaacctcaaccaca
cgactgcacttgtttaaaaaccaaccatatttttgtcttgccaactggattgagaaataa

Exon 21 +      62759      62901   1   Terminal    143    46    Marginal
cttctagccaaaggatcagtaaaaggaaattataacaatagaaaggctttttgacaatac
ccaccgtactgcagccacacaccagtggccccacaccaccccttggaagtaggcagtaca
tgctgattctcctacctaacataagtaagtagcagcaatcttattttcctgctggggtag
TGTTGGCAGTAGTAAGCAAGCAGCTGACTTCCAAGTTCCACTGGGGAGAAGGAGACAGTG
CTTTAATTCCTCTGCCAGGATGTGTCAGTGTGGTCCAGCTGAAAGCTGAACCTCTGCTGC
TACCCAGCACCAATGTTACTTAA
gccagtctgagacaaaactagtcaatactaggcttcatccttactccctctcactaggaa
ttaagtcttcacccatggggctagttggtattcccttttccccccttccctcagctggtg
ccagaagggcacaacagggagctgaacttctgcctccaccctgcagcaacaaagtattgt

Exon 22 +      63016      63197   0   Internal    182    81        Good
ggatgtgtcagtgtggtccagctgaaagctgaacctctgctgctacccagcaccaatgtt
acttaagccagtctgagacaaaactagtcaatactaggcttcatccttactccctctcac
taggaattaagtcttcacccatggggctagttggtattcccttttccccccttccctcag
CTGGTGCCAGAAGGGCACAACAGGGAGCTGAACTTCTGCCTCCACCCTGCAGCAACAAAG
TATTGTCAGTCCTTTGCTTTCTCCTTTCCTAATGTCAGCAGGGCCCAGCAAGGAGCTGAT
CTTATATTCCACTTGGAGGCAAAAAGGCAGTGTGAGCTGGTGCTCCACTTTCATGGGAAG
GT
gtcagttggactgggaggggagctgaacttgtacatctctcgtctgcactgaggcagtgt
gagtcagtgcccacttttcctggggtgcttttggtagagctcagtgcaaagccatgcata
cacacctccttggcttttacattatgcctcaacaggagactgcctgctaaaaataggaag

Exon 23 +      68031      68099   2   Internal     69    86        Good
tcagaaacaagatacatttcaaaaggaccaggtataggagttcagttgtattcaggctca
agatttgtggccccaaatggacatactttatctcctccacagctgtagttagagctcttc
tgactgtgttaatgagaaataatttctaacatcttttgactttcttgcttgtttgcttag
ATTACAGCGTCAAATCCATGCTAAAGATAATGAAATCAAGAACCTTAAAGAGCAACTTTC
TATGAAAAG
gtacaaacttagctttttctttgggtgcactctctctgaaactgtatttcactcaacact
ttctggctggcatattgatgtaatttatcattcaaaccggggtacttttgaggctgatat
tgaacagtactaataatacactgggacaaaaggtgtaaactgggagtatcttaggcaaat

Exon 24 +      70950      71036   0    Initial     87    57    Marginal
ctcttgtttctatgtgctctatacttttccaagaaataatttcctactgattgtataact
tatctttcttcctcctgaattagatgaaaaaggctctgcttgatgtaatattgcgagtct
ttaatgatcatgtatttcagatctcagtgggaaatggaaaaacataatctggaaagcaca
ATGAAAACATACGTAAGCAAACTGAACGCAGAAACTAGCAGAGCTTTAACAGCCGAGGTA
ACAACAAAACGGGGACAGGGGTATGGG
gtgaggggaaaagttttacttgtataccatcatactaaagaatttgtaaaagattgtttt
ttgtataaacagaaataagacatcttaggatcagccaggaaaatacagttgaaagtcttg
tgcttttttgactcattggcaaatcatgtgtgaatacttcagttttgatgttcttatgtt

Exon 25 +      74136      74223   2   Internal     88    98   Excellent
ttgttatttttagtaacaaacctgtccatacctctttatgtccatttgaagtaattgttg
gtgatgggggtaattttgttttttgttgacatatatgctagaaagcgtgatagacatgtt
tggaaacctaagtgttataaaaagaaagagttttcttttgtgtctccttttctacaacag
CAACCTAGAATCACTTCAATTAAAGGCTGCGGTAGACAGTTGGAATGCCATTGTGGCAGA
TGTTAGAAACAAGATTGCATTCCTCAGG
gtaagtcctgaagtatatttggagaaaattggcttaatgttataggtggtgtaaagttag
aagacatattagtagaaaaatttaaggaagaacatattttccattttagttataaaagtt
tatgccttcactttgagattacttccatgtggttggttgtagataacatcctagactcac

Exon 26 +      75257      75365   0    Initial    109    66    Marginal
tgatgcttagcgtttctgttgggtttattcaaaatttttgcctcaaaagacctgccccat
gttttcttccaagcacatgtcctccatgcagaagtttctaaatgttttgttttataagac
tttccttcccagttcctacgcgttctttacaaaataatatggtaagcaaaagtggggaca
ATGCCAAAAAATGTTGAAAATGTGTTGTTAAACTTCCAGGTTGGAGTTTTTGTCAGAATC
CAAGAGAATAAAATGTGTATGGAGCTAGAACAAGCTAGAGTTACAGATT
gtgagataaacacaatgtagaatttcataagtaatctctaaaatttttccttccgttttt
aaaatgaacatttgcaagtagtttaactgcttgttacaaatatattttttcctgtttttt
agccagtataatatttatagcttcttgaatctttagtctctttttttatttgtatcagtg

Exon 27 +      75847      75948   0   Internal    102    72        Good
tgtggggatggtctatagaatttttttttttttttggtcagaacctgtttttatattatt
tctgacaggttggcaaccactcttgtatgttgtattattcaaaactacatcagatattcc
catatgctgtctctttaaagttggttgttctctaaagtatttttagtcttcttctaccag
ACACAGTACAATGAACAAATAAACAAAGTCAAGCAAGGATTTGCCTTGAGTACCTTGCCT
CCAGTCCAGCTTCCTCCTCCACCACCCAGTCCTGAGATACTG
gtaagaaatacaacattttgaataattgcccttttcattttgacaaaatggtaagggctg
tgaaacactgaatatgcagtatgtttaacgtgtgttcaaaatggaataggcacatattgt
gagtatcacttgtaattatgaccataccttcgagtcaccagatgatataattagatgggt

Exon 28 +      76278      76431   2   Terminal    154    78        Good
tcgagtcaccagatgatataattagatgggtgaggcctatacaataggttgtatcactgg
attttagtgaagcatttgatatacatagagtaatattttctcattcaccctatttcacct
accttgtgggagctaaataatgaatactcagacttcccagtgtcctcatgttaccactag
ATCAGAGGTCCCCAACCTCTGGGCCACGGACCAGTGCACAGCAGGAGGTGAGCAGTGGGT
GAAGAAGCAAAACTTTATCTGTATGTACAGCTGCTCCCCATTGCTCACATTACCACCTGA
GCTCTGCATCCTGTCAAATCAGCTGCAGCACTAG
attctcacaggagtgtgaaccatattgtgaactgtgcatgtgaaggatctaggttatgtg
ctccttgtgagaatctaatgcctggtgatctgtcactgtctcccatcacccccagatggg
actatctagttgcagaaaaacaagcttggggctcccactaattctacattatagtgagtt

Exon 29 +      80033      80283   0    Initial    251    47    Marginal
attgtggaagacagtgtgacgattcctcaagggtctagaaccagaaataccatttgactc
agcaatcccattactagatatatacccaaaggattgtaaatcattctactataaagacac
atgcacacatatgtttattgcagccctgttcacagtagcaaagacttgaaaccaacccaa
ATGCCCATCAGTGATAAACTGGATAAAGAAAATGTGGCAAATATACACCATGGAATACTC
TGCCGCCATAAAAAAGGATGTGTTCATATCCTTTGCAGGGACATGGATGAAGTTAGAAGT
CACCACTCTCAGCAAACTAACACAGGAATAGAAAACCAAACACTGCATGTTCTCACTCAT
AAGTGGGAGTTGAACAATGAGAACACATGGACACAGGGAGGGGAACATCACACACTGGGG
CCTGTCGGGGG
gtgggggctggggagggatagcattaggagaaatacctaatgtagatgacgggttgatgg
gtgcagcaaaccaccatggcacatgtatacctatgaaacaaacctgtacattctgtacat
gtatcccagaacttaaagtataataattagaaaaaaaaagaacagctattatcaaaaaac

Exon 30 +      86326      86446   2   Internal    121    88        Good
tggtttaagataaatgcagatggacctgtgatcacttttttagatcaaagacctaaagag
tcctgtctgtatgctacatatcaatcatgcgataggattttatatctcctttggtgggta
catcctcaaaggtactaaggaaaatcattactgccctttcctttccttgatctcttgcag
AAAGGAACTTACAGATTTCTTACGGAAATTGAAGGATGCTTATGGAAAATCCTTGTCTGA
ACTGACATTTGATGAAATTGTTTGCAAGATTTCCCAGTTTATTGACCCCAAAAAGTCTCA
G
gtaaaatgcaaaaacaaccaaaaaacctgtatctctctgcccttaactctagtagttaac
tgttttaaatatctccataacctgttcagaaaatcagtaacttgtaatcatattaaatca
tctattaacagtaaataacaacttcaacttaacaaatgatatcagaagtctttttgaaat

Exon 31 +      87173      87274   0   Internal    102    90   Excellent
tccatcacagcctgatgctgcccagcccccaaaaccagcctggaggccactcacttcaca
gggtcctgccacatgggaaggagccagtaatccagtgagactgaaatttttgattctgaa
cacatttagatttgggagaaaacaatgagctaaatttaacattttctgtattttccctag
GATGAGGAAGAGGAAGAAGAAGAGCCTTGTGTGATCTGTCATGAGAATCTGTCTCCAGAA
AATCTTTCAGTTTTGCCTTGCGCTCACAAATTCCATGCTCAG
gtaacactttaaattttcccattaatcagctaaatgagattcatactgccttacttatta
tcatatacatgtatcattatccattgttgtctcacaagttccactggatataactctgag
cttttgggtaccacacagaaacatttatgcttttcccatacatagccatggattgcattg

Exon 32 +      90602      90772   0   Terminal    171    55    Marginal
gcaggctcctattgaaataacaaaagttggtagaggaaaaagttttttctcccctacaaa
ggccaagaacattttggctttatatttatatttatattataatgtgaattgattataatt
ataatgtgaattgatagaaatatatatattttttttctgcccctgcttggcacatgacag
AACATGGGCATAGACAGACTGGCTATTGGTAATCCAGTCCTGGGAGATGATCAGGAGGCA
GTACTCAATCCTACTTTCTTCTCTACAGCTTCCCATGGGCTAAAGAATTTACATGTCTGC
CCACAGCAAATGTACTCAGGCTTCTACACTAACATAAGCCCACGGAAATGA
aacagaaagggacagttcatatgtttctgaatagatccagttgaatagtctcattcaatt
tgagactgttgaacaactgttgttgttctacatacatttaaagtcagggcacatgcgtca
ctgcttatttttcttacttgacatattccctgcatttccatgtcc
--------------------------------------------------------------------------------