--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (67853 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +      18297      18514   1   Terminal    218    67    Marginal
atggggtttctctgtgttgcccagactgatctcgaactcctggattgctcaagcaatcca
cctgccttggcctcccaaagtgctgggattacaggtatgagccaccgtgcccggcctgat
gttttaattattgagaattttgtattttttgtagagatggggttcttcctctttgcctag
GCACACGACTGTCTATCCCAGATGGCTGCACTGGCCTAGGACAGACGGTTCTTCCCCCAG
TACGTCAAGACCCTGGAGGGTGCAAGCTACAGAACAGCTGGGCTCCTGCATTCCTCCCAG
ACCCTGTCTTCAGTAGGACAACAGGCAACAAACTTAAATTTGGTAATATGAATTTAGAAA
ATGTTAATGTTTTCCAGAACAGTGAAACTACAATATAA
aggttagacttgagaaccaaagttactctctagcttccctcttctgcccttcatgtgctc
agcacttgtatctgtgttctcactacccctgagccctgagttcttctggggttggcccag
gaggtgccttggttcagagagatacctgggaggaaaccacatggaatcaacaacagtact

Exon  2 +      24485      24622   0     Single    138    60    Marginal
tcaaactcctgggctcaagcaatccatcaaccttagcctaccaaagtgctaggattacag
gcatgaaccactgtgccttgcctgcttttcatttttaatccttgggttctaaaatgcaag
aattaatttccaaataattagtatggaatggaatcccactttttcctgtgtgctgagaga
ATGATCAAAGATCACAGAAAAGAGATGGAGACAGAAGAAGCTGAGAGCAAGGGCATCTTT
AAGGATTTCTTCAGTCTTGTTAATCTGGGTGTAAATTCTGTGTGGCTGACAGCCTCTGAG
GATCCCTTGAAGTTTTGA
ggaggaggaaagcgcttgagagtaatggatttacttgattttactttgtatagaagagcc
tgaactggacatatctccaggtatgtgctgtggtctttaacaagcagcccaacatccttt
gctggggaaggccagcaatgtgggagctagtggggcctagcccaggagccttgcgttcac

Exon  3 +      24806      24914   0   Internal    109    52    Marginal
ggaggaaagcgcttgagagtaatggatttacttgattttactttgtatagaagagcctga
actggacatatctccaggtatgtgctgtggtctttaacaagcagcccaacatcctttgct
ggggaaggccagcaatgtgggagctagtggggcctagcccaggagccttgcgttcaccag
GTCACTGGGAACTGGTGCTTTCTGATGCACCTCTATGCAAGCCTGATTCTGAAGTCAGAT
GTGGTGGGCATCCCTGTCCATAGTGTTGGCCTGGCCCACCATTTCACTG
gtcatagaatggctgtagctttgcagagcagggattgcgagaatggaagaatgtcttttg
gctcttctgctctagcttttggaagtacgtcagagaagtttgtgattttttagaatttgt
agctgtggcaaggctgaagcaggtaaaagggccaattagaaccatctgtgggagggaagg

Exon  4 +      41462      41498   2   Internal     37    87        Good
agctacatttccagtgctaaggagttgcacgaaactgttggtttctgtataagagaccat
gggggtaagaggcttgatccaactcggggtagatgtttttgacagtaactcctggaggat
agtatgtgactgaaccactggaattgctcaagtctaaacctgcttttctttttttttcag
GCTCTGTGTGCTCCGGGATGGAGCAGGTGTGCAGAGG
gtgagaacccagctctgggaccaagtcacttgcttccttacttagcaagactatcgactt
gagcaaacttggacctgggatgaggatgtctgtgggcctctcgctgctgctgcccctctc
ggggaggacctttctcctcctgctctctgtggttatggctcagtcccactggcccagtga

Exon  5 +      41725      41862   0    Initial    138    81        Good
aagactatcgacttgagcaaacttggacctgggatgaggatgtctgtgggcctctcgctg
ctgctgcccctctcggggaggacctttctcctcctgctctctgtggttatggctcagtcc
cactggcccagtgaaccctcagaggctgtcagggactgggaaaaccagcttgaggcatcc
ATGCACTCAGTGCTCTCAGACCTCCACGAGGCTGTTCCCACAGTGGTTGGCATTCCTGAT
GGCACGGCTGTCGTCGGGCGCTCATTTCGAGTGACCATTCCAACAGATTTGATTGCCTCC
AGTGGAGATATCATCAAG
gtgagactggatataaagcataaatgaggaagagttctcattttccattttagttttggt
ggcttttccttttcaagtctaagcttcaccaattctgagctcagttcttccagtaccccc
ttagaagagggacagccactgatgttcataagagaatccctatatactcagaatagcatc

Exon  6 +      61840      62052   0   Internal    213    99   Excellent
tagtcttgtgacaggtaaataaactcagttgtgtctctctaggggggaggaatcagcttc
cccagcaggcattctgaattataccttaaacctgtcacacaattcaggttaactgttgtg
atcatattcaggttatgcagtgacaatagtatttttaatttatgcttgtgtctcttctag
GTATCAGCGGCAGGGAAGGAGGCTTTGCCATCTTGGCTGCACTGGGACTCACAGAGCCAC
ACCCTGGAGGGCCTCCCCCTTGACACTGATAAGGGTGTGCATTACATTTCAGTGAGCGCT
ACACGGCTGGGGGCCAACGGGAGCCACATCCCCCAGACCTCCAGTGTGTTCTCCATCGAG
GTCTACCCTGAAGACCACAGTGAGCTGCAGTCG
gtgaggacagcctccccagaccctggtgaggtggtatcatctgcctgtgctgcggatgaa
cctgtgactgttttgacggtgattttggatgccgacctcaccaagatgaccccaaagcaa
aggattgacctcctgcacaggatgcggagcttctcagaagtagagcttcacaacatgaaa

Exon  7 +      61840      64242   0   Terminal   2403    93   Excellent
tagtcttgtgacaggtaaataaactcagttgtgtctctctaggggggaggaatcagcttc
cccagcaggcattctgaattataccttaaacctgtcacacaattcaggttaactgttgtg
atcatattcaggttatgcagtgacaatagtatttttaatttatgcttgtgtctcttctag
GTATCAGCGGCAGGGAAGGAGGCTTTGCCATCTTGGCTGCACTGGGACTCACAGAGCCAC
ACCCTGGAGGGCCTCCCCCTTGACACTGATAAGGGTGTGCATTACATTTCAGTGAGCGCT
ACACGGCTGGGGGCCAACGGGAGCCACATCCCCCAGACCTCCAGTGTGTTCTCCATCGAG
GTCTACCCTGAAGACCACAGTGAGCTGCAGTCGGTGAGGACAGCCTCCCCAGACCCTGGT
GAGGTGGTATCATCTGCCTGTGCTGCGGATGAACCTGTGACTGTTTTGACGGTGATTTTG
GATGCCGACCTCACCAAGATGACCCCAAAGCAAAGGATTGACCTCCTGCACAGGATGCGG
AGCTTCTCAGAAGTAGAGCTTCACAACATGAAATTAGTGCCGGTGGTGAATAACAGACTA
TTTGACATGTCGGCCTTCATGGCTGGCCCGGGAAATGCAAAAAAGGTGGTGGAGAATGGG
GCCCTTCTCTCCTGGAAGCTGGGCTGCTCCCTGAACCAGAACAGTGTGCCTGACATTCAT
GGTGTAGAGGCCCCTGCCAGGGAGGGCGCAATGTCTGCTCAGCTTGGCTACCCTGTGGTG
GGTTGGCACATCGCCAATAAGAAGCCCCCTCTTCCCAAACGCGTCCGGAGGCAGATCCAT
GCTACACCCACACCTGTCACTGCCATTGGGCCCCCAACCACGGCTATCCAGGAGCCCCCA
TCCAGGATCGTGCCAACCCCCACATCTCCAGCCATTGCTCCTCCAACAGAGACCATGGCT
CCTCCAGTCAGGGATCCTGTTCCTGGGAAACCCACGGTCACCATCCGGACTCGAGGCGCC
ATTATTCAAACCCCAACCCTAGGCCCCATCCAGCCTACTCGGGTGTCAGAAGCTGGCACC
ACAGTTCCTGGCCAGATTCGCCCAACGATGACCATTCCTGGCTATGTGGAGCCTACTGCA
GTTGCTACCCCTCCCACAACCACCACCAAGAAGCCACGAGTATCCACACCAAAACCAGCA
ACGCCTTCAACTGACTCCACCACCACCACGACTCGCAGGCCAACCAAGAAACCACGGACA
CCCCGGCCAGTGCCCCGGGTCACCACCAAAGTTTCCATCACCAGATTGGAAACTGCCTCA
CCGCCTACTCGTATTCGCACCACCACCAGTGGAGTGCCCCGTGGCGGAGAACCCAACCAG
CGCCCAGAGCTCAAGAACCATATTGACAGGGTAGATGCCTGGGTTGGCACCTACTTTGAG
GTGAAGATCCCGTCAGACACTTTCTATGACCATGAGGACACCACCACTGACAAGCTGAAG
CTGACCCTGAAACTGCGGGAGCAGCAGCTGGTGGGCGAGAAGTCCTGGGTACAGTTCAAC
AGCAACAGCCAGCTCATGTATGGCCTTCCCGACAGCAGCCACGTGGGCAAACACGAGTAT
TTCATGCATGCCACAGACAAGGGGGGCCTGTCGGCTGTGGATGCCTTCGAGATCCACGTC
CACAGGCGCCCCCAAGGGGATAGGGCTCCTGCAAGGTTCAAGGCCAAGTTTGTGGGTGAC
CCGGCACTGGTGTTGAATGACATCCACAAGAAGATTGCCTTGGTAAAGAAACTGGCCTTC
GCCTTTGGAGACCGAAACTGTAGCACCATCACCCTGCAGAATATCACCCGGGGCTCCATC
GTGGTGGAATGGACCAACAACACACTGCCCTTGGAGCCCTGCCCCAAGGAGCAGATCGCT
GGGCTGAGCCGCCGGATCGCTGAGGATGATGGAAAACCTCGGCCTGCCTTCTCCAACGCC
CTAGAGCCTGACTTTAAGGCCACAAGCATCACTGTGACGGGCTCTGGCAGTTGTCGGCAC
CTACAGTTTATCCCTGTGGTACCACCCAGGAGAGTGCCCTCAGAGGCGCCGCCCACAGAA
GTGCCTGACAGGGACCCTGAGAAGAGCAGTGAGGATGATGTCTACCTGCACACAGTCATT
CCGGCCGTGGTGGTCGCAGCCATCCTGCTCATTGCTGGCATCATTGCCATGATCTGCTAC
CGCAAGAAGCGGAAGGGCAAGCTTACCCTTGAGGACCAGGCCACCTTCATCAAGAAGGGG
GTGCCTATCATCTTTGCAGACGAACTGGACGACTCCAAGCCCCCACCCTCCTCCAGCATG
CCACTCATTCTGCAGGAGGAGAAGGCTCCCCTACCCCCTCCTGAGTACCCCAACCAGAGT
GTGCCCGAGACCACTCCTCTGAACCAGGACACCATGGGAGAGTACACGCCCCTGCGGGAT
GAGGATCCCAATGCGCCTCCCTACCAGCCCCCACCGCCCTTCACAGCACCCATGGAGGGC
AAGGGCTCCCGTCCCAAGAACATGACCCCATACCGGTCACCTCCTCCCTATGTCCCACCT
TAA
cccgcaagcgcctgggtggaggcagggtagggcaggggcctggagacgacatggtgttgt
ctgtggagaccggtggcctgcagaccattgcccaccgggagccgacacctgacctagcac
acactgacacaggggcctggacaagcccgccctctctggtcctcccaaaccccaaagcag

Exon  8 +      64917      65143   0   Internal    227    63    Marginal
gtttaatctgctgtttacctaaacttgtatgtataatttttgggtgggtatggggaattg
ctttgctaaaaataagctcccagggtgtttcaaacttagagaagaccaagggacagtatt
ttttatcaaaggaatactattttttcacactacgtcaacttggttgctctgataccccag
AGCCTGATTGGGGGCCTCCCGGCCCTGGCTCACGCCAAGTCCCTGGTGCTGGGTTTGCTC
TCCCGCTGTTGCCAGGGGCTGGAAGCTGGAGGGGTCTCTTGGGCCATGGACATCCCCACT
TCCAGCCCATGTACACTAGTGGCCCACGACCAAGGGGTCTTCATTTCCATGAAAAAGGGA
CTCCAAGAGGCAGTGGTGGCTGTGGCCCCCAACTTTGGTGCTCCAGG
gtgggccagctgcttgtgggggcacctgggaggtcaaaggtctccaccacatcaacctat
tttgttttaccctttttctgtgcattgtttttttttttcctcctaaaaggaatatcacgg
ttttttgaaacactcagtgggggacattttggtgaagatgcaatatttttatgtcatgtg

--------------------------------------------------------------------------------