--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (74017 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (18 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1315       1432   0   Internal    118    68    Marginal
gggggtgaggaggagggagagggaaagagaaagagggaaagacacacacacacacagaca
cacacacacacgcacacacacacacacaaacacacgcgcacgcaaacagcagtgaggaag
agaaaagcagagataagcaaggctccgcagcagcctcctttctaacttgaccctcgccag
ACCCTGGCCAGCATGGTTGTCCTGAATCCAATGACTTTGGGAATTTATCTTCAGCTTTTC
TTCCTCTCTATCGTGTCTCAGCCGACTTTCATCAACAGCGTTCTTCCAATCTCAGCAG
gtaaatgatggccacaactttcctctcttccatctgtcaggggacagggggaggaaggaa
gattgttttgcaatgtgtcctgatgtttttgccattcaactgttggtggagggaggttgg
aaggaagacggccaccccagcagcttcctgtcacccgagcttgtctcggaagccccttct

Exon  2 +       3532       3642   2   Internal    111    50    Marginal
gttaagggaaccaacaaggaatgctgaggcacctagagattagcaactgcaatatgcctt
taccaccctgtgcttgaaaaggcaagaggggcaaataggaaaatggatcccaggcagatt
tggagccttagagaaggggccattaagcaagagcattggtcatggaaggccctaaagcag
GGAGAAAGTGAAGGAGAAGTACACCATCTTCTCTCTCCTCCCATCCAAGCACCTTTTGGC
AGCGCCTCTCATTGGCCAACCCAACTTGAAGCCAGAGGGCAGAGCCTGGAG
gtcagggactggaacactgagggcagagagccaaggggagggttgggatggagaacaacc
agtgcgcacatccacaggcacttctggctgggaatgtggtcattagacattagggaaaac
aatggaatagacctagcgggaatcactaaggtaaccagctcagtatcacaaagatatgtt

Exon  3 +       6370       6501   0    Initial    132    69    Marginal
tgccagggtactgatttatctctgctttgatggttcttgcattttaatggaggttaagga
tctaagctaaacaatactctagtgaaatggtgtcaaccagggtgtttgggggtggggagc
caggggaatccacttcacaagccttccctttaggcattgtgagccgacccatccccatcg
ATGACCCTGCAGACACATGTGGTTTCCCTCATTGAATACAGGATTTTCCAGGAAGGCAGG
ACTCTTCAGGTGATGTTTGGGTCCGGGTCTCAGAAACCAGATGGTGAGAACACCCAAATC
CAGTCCTGTAGA
gtgagatcagatggaaggatgtgatttctgtctgggtactggaatcttctcctgttgcct
gctgggatgtaacccagggcaggcattttgtggcctgtagggcctgatgtccagccccgt
gctcccctgcctggaagccagccaggccaccacttgggaactatccatattcttggcact

Exon  4 +      19108      19226   0   Internal    119    94   Excellent
tttactcatgggagtttacaaaccaggaaactgaaacccagagatgaacagtcattgggt
ttgattggaaagacgtgattctgggcgttggtaagtggttccaaccttagctggctgagg
cgacacttctggctcttttgggtgccatttcttctgaggtttcctgctcattctctctag
GTGGTGGTGGTGGAGGAAGATCTCCACCGTGTGCTGGTAACTGAACCTCCAGAAGTCTCT
GGAGTCAGACATCCAGATTCAATCCTGGCCTACTGCCTACTGGTTGTGTTTGACCTTGG
gtgcatcccttaatctccctgagccttacctgaaaatgaggatgacagtactaatatata
ccttgtggggctgttgcggggatcaaaggattgaatggggaacatcacggaatgtgtccc
attgttggcacctcactactgggttagggcaatgctatctgctgtaacaggtgagcattt

Exon  5 +      23820      23923   2   Internal    104    61    Marginal
atctaaaatattgtgtgtgtccatgcttgtgcactgggtgtgcctataaagtaccagata
gatttaagcatgtaactggtatatgccgcttcatccaaaaagacttgcctacatgccctt
tggaaatctatatattttgtttgtttgtggtttcgttgttgttgttttagttacgtttag
CTTTGTCAGCAACACTTTGGCCCAGACAGGATTAGAGCTGAGACCCCTGGCCATGAAGGT
CTTCCCTGAAGCAGAGGAGGGCAGGCTCCCCTTGGACGGTCTCG
gtggggggttgactttgaggcttaccagagcagtcaatactgctgtggtattttgagtca
agtcggtttttgagccaaatgaaaagcagcctgtttgattgctctcaatttcctcttggc
ttgcagggggataagtatccctgggctcccaacctcatatcctcccctgggctgaaggca

Exon  6 +      35239      35340   0    Initial    102    50    Marginal
acacttgatgacagtgccccttatgtaaccattgacccctcctgtggacccagaggtgcc
tgcgttcagcacaggaaagtggaggtgcagaggagatggtttcctgcctcactgggcccc
caggtattgctaccaagcagcccacccctccccaccaaagctaaaggggaaacagtcaaa
ATGCTGCAGAAAGGATTTCTAGACAAACAAGAGTACCCTCCAGAGACCCCACCCCACAGA
GTCCTGGCCCCTCTGGCCTGCCTCCAAGAGGGTGCTCCATCG
gtgagggacagctgggtctgagccttccatggggaggagaaagagggtgtaaggagcagt
tagttcccaagtgccttcccatgcagggggcgtaaaaatgacatcacccacctgggtaaa
cactcctgtggcttctggacacttgaaggctcacctggattacaaagccccacaagaggg

Exon  7 +      40305      40388   0    Initial     84    44    Marginal
ttcatagccaaattctaccagaggtacaaggaggagctggtaccattctttctgaaacga
ttccaatcaacagaaaaagagggaatcctccctaactcattttatgaggccagcatcatc
ctgataccaaagcctggcagagacacaacaagaaaagagaattttaaatcaatatccctg
ATGAACATTGATGCAAAAATCCTCAATAAAATACTGGCAAACCAAATCCAGCAGCACATC
AAAAAGCTTATCCACCATGATCAA
gtgggcttcatccctgggatgcaaggctggttcgacatatgcaaatcaataaatgtaatc
cagcatataaacagaaccaaagacaaaaaccacataattatctcaatagattcaggaaag
gcctttgacaaaattcaacagcccttcatgctaaaaactctcaataaactaggtattgat

Exon  8 +      40954      41583   0     Single    630    72        Good
ggaagtcaagttgtccctgtttgcagatgacatgattgtatatttagaaaaccccatcat
ctcagcccaaaatctccttaagctgataagcaacttcagcaaatctcaggatacaaaatc
aatgtgcaaaaatcacaagcattcctatacaccaataacagacaaacagagaggcaaatc
ATGAGTGAGCTCCCATTCACAATTGCTTCAAAGAGAATAAAATACCTAGGAATCAAACTT
ACAAGGGATGTGAAGGACCTCTTCAAGGAGAACTGCAAACCACTGCTCAATGAAATGAAA
GAGAACAGAAACAAATGGAAGAACATTCCATGCTCATGGATAGGAAGAATCAATATTGTG
AAAATGGCCATACTGCCCAAGGTAATTTATAGATTCAGTGCCATCCCCATCAAGCTACCA
ATGACTTTCTTCACAGAATTGGAAAAAACTACTTTAAACTTCATATGGAACCAAAAAAGA
GACCACATTGCCAAGACAATCTTAAGCCAAAAGAAGAAAGCTGGAGGCATCACACTACCT
GACTTCAAACTATACTACAAGGCTACAGTAACCAAGACAGCATGGTACTGGCACCAAAAC
AGAGATATAGACCAATGGAATAGAACAGAGCCCTCAGAAATAATACCACACATCTACAAC
CATCTGGTCTTTGACAAACCTGACAAAAGCAAGAAATGGGGAAAGGATTCCCTGTTTAAT
AAATGGTGCTGGGAAAACTGGCTAGCCATATGTAGAAAGCTGAAACTGGATCCCTTCCTT
ACACCTTATACAAGATTAATACCTTATTAA
ttcaagatggattaaatacttaaatgttagacctaaaaccataaaaaccctagaagaaaa
cctaggcaataccattcaggacataggcatgggcaaagacttcatgactaaaacaccaaa
agcaatggcagcaaaagccaaaatagacaaataggatctaattaaactaaagagcttctg

Exon  9 +      47465      47707   0   Terminal    243    50    Marginal
tgaaatgtggagtacggagttttgggacctcaggagggagaaagtgggtgcatctggggt
cctcagatttacaagccagccctgatatccccagttccttcccaatcttgcctgtgactt
cctggttcagtttctctaaaaaatatcaccgtgggtcttttcttcttctaattcccacag
GGTGAAAAAGGTGACCTGGGTATGATGGGCTTGCCAGGGTCAAGAGGACCAATGGGCTCC
AAGGTCAGTGTGGGGTCCAAATGGACGTTCCCAGATCTCTGTCAGGCTCTGGAGCAGCTG
CTGTCTACAAACATAGGGACTGGGTGGGGCTGCAGTCCCGGACTAGGGAATGTCGCGGAT
ATTGGAGAGCCTGCCTTTACCAGCCCTTTGGAGAACATCATGCCCTGGGATGCAGGGGCA
TAG
ggatgccattcctgctgttctcttgggcaggaagaaccaagcttctggacatcagagcag
atggaaacctttgatcaggactttgcagagtgataaaagcaatgttccttttaggcctgg
tataaccacaaccctctgggacatctttgtgtttggtgctgcaaccccactaaaactcac

Exon 10 +      49241      49337   2   Internal     97    96   Excellent
taaccatggaaacttctattttgggacgggaagcaagttgcttttcaccctggggagagg
gtggcaggatggtctggagcctccctctagctcaatgggaaggaaaggacaacccatctg
ggttttgggtttttgtttgtttgtttgtttttttgcttttttgcttttcctacctcttag
AGGGCTGTGGTCCTATTCAAATGCAGAAACCTTTCTCACAGGGGACTCAGATCTGAGCCA
CAACGGTCAAAGCCCCTGTCAGCACACAGGCCTCAGT
gtaaggcacaggtgtctttagcttaaggtcactgtgccttattgcagtccttcttcaagg
gcggtgcacatactgccagaaggacacaaaagtatttgaactgaagactgctaacattgt
ttaagagttaaattttgtatttaaatagttaaatattggccaggcatggtgcctcatgcc

Exon 11 +      50067      50193   0    Initial    127    75        Good
gggcaatatagtactatctcatctctaaaaaaaaaaaaattagcaggtcatggtggcaca
tgcctatagtcccagcgactcaggaggctgaggtgggagaattgcttgagcccaggtgat
tgaggctgcagtgagccgagattatgccactgctctccagcctgggcacagagaaagacc
ATGTCTCTGAAAAAAAAGAAAAGAAAAGAAAAGAAGAAAGAAGTGAAGAAAGAGAGAGAG
AGAAAGAAAGAAAAATATTCAGTAAATAGCAAAACAGTGGTATATAGAGATGACAAAAAT
TGTGAAG
gtgactgttgaccaacatatgttttgaaacttttaccgagggttagggttggggaagaag
aacaagggtagttgagggggaatgtcagagaataaagagagaaaagggcatacatggcca
tttggaacagctcctaagctaacatcattttggctcctcatgccataagacattgacatt

Exon 12 +      52370      52416   0   Internal     47    63    Marginal
tgctaaccttgcagggcagcccagttggcatagattcggaatgatcaagtagactgccct
cgtagccaatgactggctagacctgtgtagatgtgcccactccacatgccctaagtcctc
tcttgcttctctttccttctttccagggtgaaatgggtccaaaaggtgaacctgggatag
CAGGACACCGAGGACCCACAGGAAGACCAGGAAAACGAGGCAAGCAG
gtaaggatcccagggcttaccacccgcctgaggtcagaacttcctgacctggcagtgtgt
ggagtggcaggcaggtggcgttaatcagagatattctgtagaccttgactccagcatcct
ctgggctagcagacgggagcagcaccacttccagaagctgctggcatctctaggctagcc

Exon 13 +      54999      55184   0    Initial    186    48    Marginal
cagctccttcaagctttggcacttcctttgctcagagccagctgacatggccgttagaaa
aacaagactgaactgtggctatattaagatgtgtgacttcctttgccatcctgagaccca
gcttggttactgcagggaatgcttcagctaggctgaggcttaagaactccctccataaac
ATGGAATCAGAAATAAACTCTGACCTCACGGATCCCATATTCAGAGTTCAAGAACTCCTT
GCACATTACCAAGACGGCCCCCAGTGCCATGTGGACAAGGCAGCCGGTCACCTGTCACCG
TTGTGGCTGGAAAGGAGTCCCAAGCCTGCCTGCTCCCCAGATTTGAGGAAGATTACATTT
CATCAG
gtgggcaagcctgccaaggcgcaagtgtagtaagaagaaccaggtcaaaaatggcaagtg
tcaatcactgctctgattaggcctgaggcaagagcagacaattagcaaattgctcagggg
aagagtcaatagcatgcaccagccttggtttcggggtgactcctaagagcaaccctgagg

Exon 14 +      56515      56611   2   Internal     97    89        Good
tatctcaaatgtcacttgccctaagcttattaagagctcgatggtcaagacctctggagc
tgcatcccccactgggctcttgctccttaagtgcaaggtgatctctgatttggtgataaa
tggggcgggaagcttgctatgtcatgctttcataacaggctctgcctttctctctgtcag
GGACAGAAAGGGGATAGTGGAGTTATGGGCCCACCAGGCAAGCCTGGGCCTTCTGGTCAA
CCTGGCCGTCCGGGGCCCCCAGGCCCCCCACCTGCAG
gtaagagctacactgcttcacttgatccactgttggagtactggccagcctcccagagag
ggcacaaggagatgccagcagagatgccttgtgtttcaagttagaaactaccagagacac
tccaatatctttgtaatttctccacgatttagctcattcaacttttatgcaagagagata

Exon 15 +      66358      66492   0   Internal    135    91   Excellent
ttaggaactcgattgagaagatgagggaatcaagacactcctctcacttcagaaggaatg
ctagagtgtagtgtgcaaacccctcttcccactgttgagcagcccaaggatagagattct
gtttcctcctccagcttttttcctgccccctgcagaagtgttttctggaatcctcaccag
TGTGTTCTCTGGCAGATTTTTGTGGTCAACAACCAGGAGGAGCTTGAGAGGCTGAACACC
CAAAACGCCATTGCCTTCCGCAGAGACCAGAGATCTCTGTACTTCAAGGACAGCCTTGGC
TGGCTCCCCATCCAG
gtacccccaggccattacctcaggacatactccctgcccaggagagagatgcatccatta
aaggaagggaaggccaccccactgggcctggggagggctttctacagtctgtctgcatgg
gagggctgagcatcctccctcaaactctctctgagcagccctccattcccccaccctgac

Exon 16 +      66933      67053   0   Internal    121    91   Excellent
acccaacatttaaccagctacagagctctgggcaacaggaaaggagtacctttcccaccc
ctgggaggaagtcaaggcatgccccccagcagtgcctttggaccaaaaccaatgacctcc
ctgcctgcggctgcctgggtatgccatgctccagttaatgctgtgtgcttctttggccag
CTGACCCCTTTCTACCCTGTGGATTACACTGCAGACCAGCACGGCACCTGTGGGGATGGG
CTCCTGCAGCCTGGGGAGGAGTGTGACGACGGTAACAGCGATGTGGGTGACGACTGCATC
C
gtgagtgaggcccagaccaggaggacctgaggcctgaacagcaggggggtgggactcagg
gccagccctggacaccagctgtggtgctttgggacctttctagagccagagaagggtata
cccaggccaccttgtgccacccaccccagtccctgctgccccagtttcagcccaaatatt

Exon 17 +      69021      69123   1   Internal    103    79        Good
atcgctgtgggaccagagcctgtgggcagtccctggaggagtgtgaagcttaatggaggt
cagttctttaaggggtgcagcacttaggttggatcccttgggccgcatggtccttacaag
ctgaggcaagcctatcgcctctgctccttctcaagactgcacctccttatgtcccctcag
GCTGTCACCGTGCCTACTGTGGAGATGGTCACCGGCATGAGGGTGTGGAGGACTGTGACG
GCTCTGACTTTGGCTACCTGACATGCGAGACCTATCTCCCTGG
gtagggatgactcccctccctccctctcccccttctttctccctccctcctctttgcttt
ccttctttccttcacaaatattttgagtgcctctccactttgtggtgccttctagacact
gaggtatggtgatgaatgacacaacacgtgctccctgcctaccacgtgccctcttggtca

Exon 18 +      71239      71308   2   Terminal     70    88        Good
agacctcaaggcaaaaatcccagagacatgattcaactcccccaggcctctcactccaaa
tgagaatgggaaaaagttcttgtagagccattggcccttggccgctgtttgataaggttt
gaccggaagtcaccagcatataagaggtggccttttagaacgtgtctttgcctccctcag
GTCATATGGAGACCTGCAATGCACCCAGTACTGCTACATCGACTCCACGCCCTGCCGCTA
CTTCACCTGA
gggccgtgaggagaaggtgggctgcgccccacagaactggcagcagcttctccactgtca
tcaaactggccatgtcctggccccgtctccaccaacctttgtgtgacaaaaacaaggaca
aattcctgctactaagacatgctgttaactcagtctgactggaagaatttaggaccactg

--------------------------------------------------------------------------------