--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (19122 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        939       1087   0    Initial    149    86        Good
aaaggagagagaaatggtgtgatgggggaggagacgcggagttgggtagaaatgcctttt
aataagatattgggaaaaaagtattaaacctaaaactgcagctcttgaaggatcattttt
tcatctttgtgttaggatttacaagtacagtgcatagtaatttttggataattggagtga
ATGAATGAAAAGCGTGAAACGCCTTACAGGAGCGAGAAGATCCACGAGAGAAAGCGAGCA
GGGACGCAGCTCTGGTGCCTGGTCCTGCCGGGTGGTCCCCACGCCGCCAGCCGCGCGTTC
CCCAACCGGGCGCTCCCGGCGCCCTCTCG
gtgagccgccctgaaaccgccagggggcgctccccggctgccggggctgaggcgggcgga
gctgctttaaatcgcggcgcccagcggttctgcgtctcagttcccgagcctgggagcaac
cgcagcttctagtatccagactccagcgccgccccgggcgcggaccccaaccccgaccca

Exon  2 +       1401       1643   1   Internal    243    91   Excellent
atccagactccagcgccgccccgggcgcggaccccaaccccgacccagagcttctccagc
ggcggcgcagcgagcagggctccccgccttaacttcctccgcggggcccagccaccttcg
ggagtccgggttgcccacctgcaaactctccgccttctgcacctgccacccctgagccag
CGCGGGCGCCCGAGCGAGTCATGGCCAACGCGGGGCTGCAGCTGTTGGGCTTCATTCTCG
CCTTCCTGGGATGGATCGGCGCCATCGTCAGCACTGCCCTGCCCCAGTGGAGGATTTACT
CCTATGCCGGCGACAACATCGTGACCGCCCAGGCCATGTACGAGGGGCTGTGGATGTCCT
GCGTGTCGCAGAGCACCGGGCAGATCCAGTGCAAAGTCTTTGACTCCTTGCTGAATCTGA
GCA
gtgagtgcacccccacctcacagcggccgtccagaggccccagtccccctgcagctccct
tatgggctcattctgttgtgtgattccatggttatcagtcttcagttgatcaagtcttct
gatcatgtgctctgtcataaggaaatgaagagaatcctggtttgaggaaagcgacgccca

Exon  3 +      10591      10755   1   Internal    165   100   Excellent
ttttctggagaagatactgtatattgggttaccagcggaaacatcagtatgactggggtc
tctagattcctagtccagttttctctcttccatacaacagtgacatatacttggtcttct
tccatttttctcttgttggtccaagcatatttttacatgttttaaaatgttttctgccag
GCACATTGCAAGCAACCCGTGCCTTGATGGTGGTTGGCATCCTCCTGGGAGTGATAGCAA
TCTTTGTGGCCACCGTTGGCATGAAGTGTATGAAGTGCTTGGAAGACGATGAGGTGCAGA
AGATGAGGATGGCTGTCATTGGGGGTGCGATATTTCTTCTTGCAG
gtaatagaggctgtgcccccctttcaccttactaacctgttcctggtatgatttgaaatc
tattacgttggattcattatacttgatttcagtctctaaggcaaactgcaaacatagacc
tgaagtccagttgactttcatgttctcaaacacaaactaaatgaaaatgtgagagctctg

Exon  4 +      13374      13458   1   Internal     85   100   Excellent
ttttaatagatacttggaataaatcatatctggacttctaatctccctaataccaaaata
aaaatgtcaacactattgatgagatttaattcttgcaaaatatgttttggtttaacaggt
tgtgtatttaggctcagtgttccatggtgattaacagtcttttgttttgaatttctatag
GTCTGGCTATTTTAGTTGCCACAGCATGGTATGGCAATAGAATCGTTCAAGAATTCTATG
ACCCTATGACCCCAGTCAATGCCAG
gtaacgctattcaggcgtaaaatagtttgttttctgagaaaatgccctttttatattcta
caaagtcctgctagtgccatcatttcccagatttgctttcaagaattttatgtcaaacct
acaaacaatttaaatgatctctgacttatgtcaaaatgagtttgataattgctttaacac

Exon  5 +      15188      15417   1   Terminal    230    67    Marginal
ttgcaatataaacattctttggcgtgtatgttcagaaatcttaaagtacttcccaaggga
tattcaggggttattttcaatgaaaaaaatacaatgagtattgattttttttccttttat
tatattagaaaagttgccaataattcactgattaacaagcacatgggtttttccttttag
GTACGAATTTGGTCAGGCTCTCTTCACTGGCTGGGCTGCTGCTTCTCTCTGCCTTCTGGG
AGGTGCCCTACTTTGCTGTTCCTGTCCCCGAAAAACAACCTCTTACCCAACACCAAGGCC
CTATCCAAAACCTGCACCTTCCAGCGGGAAAGACTACGTGTGACACAGAGGCAAAAGGAG
AAAATCATGTTGAAACAAACCGAAAATGGACATTGAGATACTATCATTAA
cattaggaccttagaattttgggtattgtaatctgaagtatggtattacaaaacaaacaa
acaaacaaaaaacccatgtgttaaaatactcagtgctaaacatggcttaatcttatttta
tcttctttcctcaatataggagggaagatttttccatttgtattactgcttcccattgag

Exon  6 +      16572      16660   0    Initial     89    72        Good
caaagtgctagactttctggagtgataatctggtgacaaatattctctctgtagctgtaa
gcaagtcacttaatctttctacctcttttttctatctgccaaattgagataatgatactt
aaccagttagaagaggtagtgtgaatattaattagtttatattactctcattctttgaac
ATGAACTATGCCTATGTAGTGTCTTTATTTGCTCAGCTGGCTGAGACACTGAAGAAGTCA
CTGAACAAAACCTACACACGTACCTTCAT
gtgattcactgccttcctctctctaccagtctatttccactgaacaaaacctacacacat
accttcatgtggttcagtgccttcctctctctaccagtctatttccactgaacaaaacct
acgcacataccttcatgtggctcagtgccttcctctctctaccagtctatttccattctt

--------------------------------------------------------------------------------