--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (104082 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (30 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       3262       3416   1   Terminal    155    73        Good
gtctgttactgagagaaataatgcaggctgttttctgaaatgctctggatttccagaact
taacaccacagtagttcctattccttaaaacagaacttcatcagtcacaccttgctgttg
cttttcccatctccactccaggattccctaactggcatgcctaggatttttcctctgtag
GAACCTGGGAGAGCGGGTGCTTTATACCTGCCTCCCAGGTGTCCAATGAAGGGGCTGAGG
GACAAAGCTTTGTGGTGGACAAAAGGGGAGGGGAAGATGTAGGAGAAGTTGGAGGGGAAG
TAGGAAGGAAGAAGCAGGCCAAGACCCTTGAGTAG
agaagactcctcaagcacagagccctgtcatttgggaacagtctccatataatttctaag
agaccacacatgcgagttacttcctgccaatacagcacagtcagctctgttccaagactt
ctatgctagaccaaaacatagtaagtgaaaaaaaaaaatcagcaaatcaaccagtttttg

Exon  2 +       5298       5355   0    Initial     58    43    Marginal
ggtcaattctaccaaaggaggaagggtcagggaaaggttcttggaggaggtaacgcttga
gttgaatcttgaaagatgaggagtgacaccaggtagacaaaagaagaaggtataatggga
gagagattcatgtgcaaaaacaagcaattaacaacaactaaaccagaggcatgaaacatc
ATGTCAAGTTCTAGGACCTGCAAGTGGTTCAAGGAGCTGAAGCATAAGGAGCCAAGAG
gtagggaggctagcaaagtggctaaagtatgcatgatggggtcacagaaacaaagatttg
agtcgtggttctgccactttctagctgtgggacctcagttaagtaatttagccacagtaa
ttaatggtaataaaggtaatactttcctcataggattgctgcaaagattcagataagata

Exon  3 +       9412       9517   2   Terminal    106    62    Marginal
tataaagaactcatagaatttaataggaagaacattaagaccatggtttcaaaaaagtag
ccaaaggttgtaatggttttcaaatgaagacaatcacatgggtggtgaaacatacaaata
ttttaacttttcttcaataagggaaacatttttacaatgatataccaatttccttatcag
GAACATTAAGATGTTGAAGATAATGCTAGTGGAGTGGGGCACAATGGAAACTGTCATAAC
AAATTACCTGGAAAACAATTGCCTTAAAACTGTTCACAGCCTTTGA
ccaaagaatttcattttggggattgtatcattaagaaattatcagaaatatggttaaaga
cttatgcccaatgatgttcttcacagtgagaatttgaaactgaaacacaagaaaaagcct
atgaatccaataataagggaatggttaaatacagtgtggtggataggaagcagcataggc

Exon  4 +      15255      15438   2   Terminal    184    58    Marginal
ctcctcagtttctttaataactctttttttcttaatttgggttttcatttgtttttcttc
tcttttgactcagggtgttttgtttgatccagtgtcaggactaggccacttcccaactgc
cttgtgctgttgattcatattgatctcctaaactcatcacatcgcctccccttctttcag
GCTTCAAGATGTCCTTGCAGAGTGCCCCATTCCTTCTTCAGCTTTTCTTTCTGCTGTCAT
CACTTTGATCATCTGCCTGCCAGCTTTGGCTTCCTTCATTGACCCCCTTTCATTCCTCGC
CTATAAAGTCCACCTATCAGTCTCTCATCTATTTTTATTCTTCATTGACTGTTTCAACTG
CTAG
tcctgagtctaatcatttaagcctttgatttgggccttccctgaagcattttttcagatc
ttttaaaaaatgtctcaccactctgacttctcagagctctgcagagctttctgactgatg
cttttttctttaggtcataattgattatagaaggaataattaacctcaggagataaaata

Exon  5 +      15663      15799   1   Internal    137    74        Good
agcattttttcagatcttttaaaaaatgtctcaccactctgacttctcagagctctgcag
agctttctgactgatgcttttttctttaggtcataattgattatagaaggaataattaac
ctcaggagataaaatactgaaacaacatcaattagcattccttctattaaaaaagtttag
ATGAAAAGCAAGTCGTCTCCATAAAGAGCAAATTATCTGTAGCCAACTCAGAGAAAAGGA
TTTATGACACAGAATTTCCACCTCTCAGAATAAATGCTGAGGAGATGATCAGACAAATGT
TAAATAAGTACTTGAAA
gtaagtaattgaaatgttatttgtagtagtaaaaacttaagaaatatcttaaatgcccac
cagtacacaattggctatgtgaattttgactcatgcatactgtgaattactaggagtcat
taaatattatgtttttgtgataatatgtatgtatttatgataacaaatatatattttgaa

Exon  6 +      28238      28613   2   Terminal    376    52    Marginal
aggacctcttcaaggagaactacaaaccactgctcaaggaaatcagagaggacaaaaaca
aatataaaaacattccatgctcatgaataggaagaaccaatatcatgaaaatggccttac
tgcacaaagtaatgtgtagattcaatgctattcccattaaactattgacattcttcacag
AATTAGAAAAAACCACTTTAAAATTTATATGGAGCCAAAAAAAAGAGCCCATATAGCCAA
AATAATCCTAAGCAAAAAGAACAAAGCTGGAGGCATCATGCTACCCAACTTCAAACTGTG
CTACAAGTCTACAGTAGCCAAAACAGGAGGGTATTGGTACAAAAACAGACACGTAGACCA
ATGGAACAGAATAGTGTACTCAGAAATAAGACTGCACATCTATGACCATCAGATCTTTGA
CAAATGTGACAAGAACAAGCAATGGGGAAAGGATTCTCTGTTTAATAAATGGTGTTGGGA
GAATGGGCTAGCCATATGCAGAAAGTTGAAACTGGATCCTTTCCTTACACCTTATACAAA
AATTAACTCAAGATGA
attaaatacttaaatttaaaacctaaaactatcaaaaccctagaggaaaatctaggcaat
accattcaggacataggcacgggcaaagatttcatgacaaaaatgtcaaaagcaattgca
acacaagcaaaaactgacaaatgggatctaattaaactaaagagcttctgcacagcaaaa

Exon  7 +      29642      29906   2   Terminal    265    54    Marginal
gcttttacattgttagtgtaatgcaaattagttcaaccattgtggaagacagtgtggcat
ccctcaaagacctagaacgataaatagcatttgacccagcaatcccattactgagtatat
acccaaaggaatataaatcattctattataaacatacatggacacttatgttcattgcag
CACCGTGCACAATAACAAAGACATAGAACCAACCCAAATGCCCATCAATGTTAGACTAGA
TAAAGAAAATGTGGTACATATACACCATGGAATATTATGCACCCATAAAAAGAAACCAGA
TCATGTCCTTTGCAGGGACATGGATGGAGCTGGAAGCCATTATCCTCAGCAAACTAACTC
AGGAACAGAAACCCAAACACGGTATGTTCTCACTTATAAGTGGGAGCTGAACGATGAGAA
CACATGGACACAGGGAGAGGAATAA
cacacactggggcctgtggaagttggggtcagggagcacatcaggataaatagctaatgc
atgctgggcttaatacctaggtgatgggttgataggtgcagcaaaccaccacggcacatg
tttacctgtgtaacaaacctgcacatcctgcacatgtataccggaacttaaaataaaatt

Exon  8 +      34471      34541   1   Terminal     71    90   Excellent
gaaaggtagtagcttatatgtcatgagtgacttttgacacatgaaagagtgcctcatcaa
cagtgagatactgttaatcatgcataatttacaaatgtaattttgccatttggaatgtct
actttttgatttgtatccattcattcaacatatatttattgagtgcttactatatgccag
GCATTGTGCTGTGCATTGAACATACAGTGGTGAACTACACAGACCTCATCCACGTGGAGC
TGACTGTCTAA
caaaggagacaaacagtaaacaaataactatagcaatgaatatttgtctagaacttgttt
tgagtgcagtgaagggaaagtaaaatttttttttttttttgagacaaggtctggctctgt
cacccatgcaggagtgcagcgacatgatctcagctcactgcaacctccatctcccgggct

Exon  9 +      43868      43909   0    Initial     42    75        Good
gttcttaaagccggcgtgtctggagtttgttccttctgatgttcggatgtgttcggagtt
tcttccttctggtgggttcgtggtcttgctggctcaggagtgaagctgcagaccttcgca
gtgagtgttacagctcttaaggcagcgtgtctggagttgtttgttcctcccggtgggttc
ATGGTCTTGATGGCTTCAGGAGTGAAGCTGCAGACCTTCGCA
gtgagtgttacagctcataaaggcagtgtgaacccaaagagtgagcagtagcaagattta
ttgcaaagagcaaaagaacaaagcttccacagcgtggaaggggacccaagcgggttgcca
ctgctgtctcgggcagcctgcttttattctcttatctggccccacccacatcctgctgat

Exon 10 +      44722      44823   0    Initial    102    49    Marginal
agggtgctgattggtgtgtttacaaaccttgagctagacacagagtgctgattggtgtac
ctacaatcccttagctagacacaaaggttctccaagtctccaccagactcaagagcccag
cctcctcacccagtggatcccgcaccgggaccacaggtggagctgcctgccagtccagcc
ATGTGCCCACACTCCCCAGCCCTTGGGCGGTTGGCGGGACTGGGCTCCATGGAGCAGGGG
GTGGTGCTCATCAGGGAGGCTCCCGCCACACAGGAGCCCATG
gtggggggttggggtggggagggctcaggcatggcgggctgcaggtcccaagccctgccc
cacggggaggcagctaaggcccgtgagaagtcgagcacagcagctgctggcccaggtgct
aagcccctcactgcccggggcttgcgggccagccagctgctccaagtgcagggccgctga

Exon 11 +      49453      49860   2   Internal    408    52    Marginal
tcacaaaaaaaaaaaaaatcaaagaactctcaggactatctcattttatagcctttttca
cactaaacaatttaccttgcattctcttctaacattgtaaataccgacgggcttgagcag
taccgataggcagattcagattacagtcacccctgagccaaagacctctctgtgattcag
GGGTGTGAAGGGCTCCTGGCTGTGCACTGGCCTTTCCAGCACACCCGCATGTCCAGATAG
CCATCGCAGGAAGGACGACGTGGGGATGGGATCATCAGATTCACCCTCCAGCTACTTGCA
ACACCTCAGCAGTTTTACTTCAGCTTGTTGTATTCTTTCCTTGCAACTGGACTGTAAGTT
TATATTGCAACCCCAAGAAAAGATTCACAATCCCTTTTTTTTATTGTACTATAAAAAGAA
TTCTAGTGATAGAACCTCCACAGGGCTTGAAGTGAAGCAGCCATTCATTAAGTGTCTGCT
GTGTCCTGAGTATGCCAGCAATGAACAAGACAGACCAGGTCCCTGGCTGCATAAAGAGCA
AGAGGGACTGTGGCAGGGAAGTGCCACGCAGATGCAGAGAGCACGAGA
gtgaggcctggagaaccaggaggggcttccttgagaagtggtgtttgagccactgaagga
tccctgaagaatgcctcatccctgatggatgaagagaaatgaattaagcaagaggcacag
gtcagaggggtggaagagcattctgagagggatgggaagggcccaaggcaataaagaact

Exon 12 +      59978      60103   0   Terminal    126    82        Good
acctatagactccaccaaaaaaactattagaatcaataaacaaattcagtaaagttgcag
gatacaaaatcaacatacaaaaactagtagcatttctatatgccaacagtgaacaactta
aaaaataaatcaaaaaagtagtcccacgtataatagtcacaagtaaaattaaatacttag
GAATTAATCAAAGAAGTGAAAGATCTCTACAATGAAAACTATAAAACACTGATGAAAGAA
ATTGCAGAGGACACAAAAAAGGAAATATATTCCATATTCATGGATTGGAAGAATCAGTAT
TGTTAA
aatgttcatactgcccaaagcaataaaagatttaaggcaactcctatcaaaataccaata
acattcttcacagaaatagaaaaaacaatcctaaaatttatatggaaccacaaaagaccc
agaatagccaaagctatgcttagcaaaaagaataaaccagaggaatcacattatcgactt

Exon 13 +      60300      60464   2   Internal    165    82        Good
aaagcaataaaagatttaaggcaactcctatcaaaataccaataacattcttcacagaaa
tagaaaaaacaatcctaaaatttatatggaaccacaaaagacccagaatagccaaagcta
tgcttagcaaaaagaataaaccagaggaatcacattatcgactttcatattatgctacag
AAGTATGGCAACCAAAACAGCGTGGTACTGGAATAACAACAGACACATAGCTCAGTGGAA
CAGAATAGAGAACCCAGAAGCAAATCCACACACCTACAGTGAACTTGTTTTTGACAAAGG
TGCCAAGAACATGCATTGGAGAAAAGACTGTCTCTTCAATAAATG
gtgctgagaaaattggatatccaaatgcagaagaatgaaactagacctctgtctctcacc
atatacaaaaatcaaatcaaaatggattagatacttaaatataagacctcaaactatgaa
actactaaacaaaaacactggggaagctctccagaacattgtagtgggcaaaaatttctt

Exon 14 +      60659      60766   1   Internal    108    82        Good
ggatatccaaatgcagaagaatgaaactagacctctgtctctcaccatatacaaaaatca
aatcaaaatggattagatacttaaatataagacctcaaactatgaaactactaaacaaaa
acactggggaagctctccagaacattgtagtgggcaaaaatttcttgagtaacactccag
AAGCACAGGCAGCCAAAGCAAAACTGGATAAATGGGACCACATCCAGTTAAAAACCTTCT
GCACAGCAAAAGAAACAATCAACAAAGTGAAGAGACAACCCACAGAAT
gtgagaaaatattcgcaaactagccatctgacaagggattaataaccagaatattacaag
ctctaacagctctataggaaaaacatctaataatccgatttaaaatgggtaaaagatctg
aatagacctttctcaaaagaagacatatgagtatgaaacaggaatatgaaaaggtgctca

Exon 15 +      60919      60985   0    Initial     67    63    Marginal
aacaaagtgaagagacaacccacagaatgtgagaaaatattcgcaaactagccatctgac
aagggattaataaccagaatattacaagctctaacagctctataggaaaaacatctaata
atccgatttaaaatgggtaaaagatctgaatagacctttctcaaaagaagacatatgagt
ATGAAACAGGAATATGAAAAGGTGCTCAACATCACTGATCATCAAAGTAATGCAAATCAA
AACTACA
gtgagatatcatctcaccccagttaaaatggcttttatccaaaagacgggcaataatgaa
tgctggcaaggatgtgaagaaaagggaactctcatacgctgttggtgggaataaaaatca
ctacaaccactatgcagaactgtttggaggcccctcaaaaaactaaaaatagagctacca

Exon 16 +      61041      61151   0     Single    111    43    Marginal
ccgatttaaaatgggtaaaagatctgaatagacctttctcaaaagaagacatatgagtat
gaaacaggaatatgaaaaggtgctcaacatcactgatcatcaaagtaatgcaaatcaaaa
ctacagtgagatatcatctcaccccagttaaaatggcttttatccaaaagacgggcaata
ATGAATGCTGGCAAGGATGTGAAGAAAAGGGAACTCTCATACGCTGTTGGTGGGAATAAA
AATCACTACAACCACTATGCAGAACTGTTTGGAGGCCCCTCAAAAAACTAA
aaatagagctaccatacaatccagtaatcccactgctaggtatatataccccaaagaaag
gaaatcagtatatcaaagggatatctgcactttcatgtttgttgcagcagtattcacaaa
agccaagatttggatgcaacctaagtgtccatcgaaagatgaatggatacaaaaaatgtg

Exon 17 +      63964      64162   2   Terminal    199    72        Good
ttgctcacagcaaaaatccagatttattggtttgttttcgtgtttatatccctgttgctg
ttaataaaaatgaaaggtttaatgtgttgaggaaatcagggtaaaatatgtgcaagaatt
taaaataatgcacacgtaatgttagaacactaaaatgcatgcttttggtttctattttag
CTACAGCGGAGCCACAAACTTGGCTTACAGCTTCCTAACACTCAAAGAAGGAAACAGGAG
AAGAGAGAAGATTTGTAATGCCTATAAAATAATTTTGGCCAGGTTTTCCAAAGAAAACCA
GAATTTCCATGTGCTTAGAAAGATGTCCCCACGATGTGCTAGAACAGGCTTCTATCGGCG
CTTGAGAGCCGATGGTTAA
atattcagattttttacaaatatgttgttaaaccattggtagcttgaaactgaccatggt
gggaatatttagcatacaccacaagtcaggtcttgtttttcttttagaagccagactaca
agcacaccaccacatgtccccagtggtcctcagacaaagacactgtgtgaggtcaggaga

Exon 18 +      65714      65759   0    Initial     46    46    Marginal
tcacacctgttgtcagggagatggagggcaagaccatgtgcagctggcaggcagacagca
gaagccgggcttgggcttgcgggaggcagccaagggtgaccgggcaatttgtgtttcccc
cagtgccgaaagagggccctcattttaaaacaacatgtgccttgctttggtacagaagga
ATGAAGTCTGATATAGAACTAGGGATGGCCGTATTGGTGATGGCAG
gtaagagtccctaattctttggcaaatgtgcaccagctgtgtatagaaacccatattgtg
gatgtctcttcagcaagaggtaaaggaagctgcaactacagccaggcacgtgagtttggt
gattattgattaaactttttcaggtttatttttcctgttcaccctcattaaaacatacac

Exon 19 +      67535      67790   2   Terminal    256    46    Marginal
tatataataacagtggtttaaaccagccagaagccttttttctctgtcaggcaaaagtcc
aggaatagttcaatattaaggttctgctctatgaaaagcttagctcatggcaccatcatt
tcctaggttgtagctccttgttcaagatggtctctagctgtcatatccacctccgtgcag
CAGAATAGAGGAAGCGGGGAGAAGGGATAAGGGGCAACCAGGAGTCAAGTACAAAGAAAA
TAAAGCTTTTACAACATGGAAGGTGGAAGGTGATGGGAGCTGGACGAAGGCACTGGCCAC
AGGAGTGTGTAGGAGAAGGCAGAGTGGGAAGCAATGGCAGAATCACAGGACCAGGAGACT
GGATGTTGGAGGACAGGGAGATGGAGGATCTAGAATGACCCTCAGCTTTGGAAGCAAATT
CGACCCTGACAACTGA
actcaaaagggtggtttgaagaatatgttagactgagagagttaactgctacaaattgac
cccaaatctctccttcctctattccttattgccattaattttctgttgaatgaactaatt
aagttaataaactccaagtagttaatatttcacaggaaaaatttaacaggtctcagtgac

Exon 20 +      71708      71892   0    Initial    185    73        Good
caagtctggattgaggaaggcagaaatggagattcaaacaccacgtcttctattatttta
ttaatcaatctgtagacatgtgtccccactgcagggagtgaactgctccaagggagaaac
ttctgggagcctccaaactcctagctgtctcatcccttgccctggagagacggcagaacc
ATGGCATTTTATAGCTGCTGCTGGGTCCTCTTGGCACTCACCTGGCACACCTCTGCCTAC
GGGCCAGACCAGCGAGCCCAAAAGAAGGGGGACATTATCCTTGGGGGGCTCTTTCCTATT
CATTTTGGAGTAGCAGCTAAAGATCAAGATCTCAAATCAAGGCCGGAGTCTGTGGAATGT
ATCAG
gtaagaagaggggcctaatctgccaatctcttctcttctgagtggttggagaaaagctgc
accaaacgcaaaataattttttcaaactttgtcctatcttttcaagaatagtgattgatt
ggtaatcatgctgaagcttattgcccccacaacctgccttttttttcctgaagacttctt

Exon 21 +      74599      74980   2   Terminal    382    69    Marginal
gtgagccaccacgcccggccatgtcatccccattttaacagagagggctctgtacagagc
atgccatgaagccagagagtagtaacagttcgatgattcaaacccagctttgccaggtct
ttactctaaagtcgttgactagaaagcttcccattttcttccacttcttctttcttccag
GTATAATTTCCGTGGGTTTCGCTGGTTACAGGCTATGATATTTGCCATAGAGGAGATAAA
CAGCAGCCCAGCCCTTCTTCCCAACTTGACGCTGGGATACAGGATATTTGACACTTGCAA
CACCGTTTCTAAGGCCTTGGAAGCCACCCTGAGTTTTGTTGCTCAAAACAAAATTGATTC
TTTGAACCTTGATGAGTTCTGCAACTGCTCAGAGCACATTCCCTCTACGATTGCTGTGGT
GGGAGCAACTGGCTCAGGCGTCTCCACGGCAGTGGCAAATCTGCTGGGGCTCTTCTACAT
TCCCCAGGTACTCAAGCCTTCTCAGGCGGGGCACTGGGAGCAGGATCAGAAGAAGCAGGC
TTGGGGGTGCCATGCCCAATAG
ccatacggtttaccatattcccatctctggcacaaaagacctatgatttagttgatatgc
tgtatcatgaccatttgggatttctgaaactccagtgtccacaatatcaatgataccttc
actatgcttccaaaattcttttaaatgtaccttgcataaaactgtgtctttttttaaaaa

Exon 22 +      77618      77694   0    Initial     77    52    Marginal
cattctcccaaatacctttgacttgttttcttaagaagtttaaaatctctctggaaaaac
tagagaacacaagatattaagctacttcatttcctagaagaaattccatttgtgtaaaaa
tgtttcgttcttcagaaaaaatggtcccataacttggaacttcctaagtggtgagccatg
ATGACACAGAGTGCTGCAAATGAGCTGAAGCCGGCCTCATCAAAGATGTGGATCTCCTCA
AGTGTTGGGGTGACCAG
gtggggcctgagtggtcagagcactcccaccagggttgatcagcttcctctgtttgctcc
atgtgttgccataatgtgaaaagaagtgggaaagctctgcactaactaatgctttacatg
gtatttggctacttcttcaagcaacgatctcttaacatcaagggcaagactttcttccct

Exon 23 +      79069      79324   2   Internal    256    99   Excellent
ccttaccctttctttcatcctgtatacagtgaacagcatagttgataaatgagaccaagg
catgctcagaaagccacctccacaacagcctggaggctcactcagcacctcttcactcac
tcactcactcattcaccatgttcttggttctctccaggtcagttatgcctcctccagcag
ACTCCTCAGCAACAAGAATCAATTCAAGTCTTTCCTCCGAACCATCCCCAATGATGAGCA
CCAGGCCACTGCCATGGCAGACATCATCGAGTATTTCCGCTGGAACTGGGTGGGCACAAT
TGCAGCTGATGACGACTATGGGCGGCCGGGGATTGAGAAATTCCGAGAGGAAGCTGAGGA
AAGGGATATCTGCATCGACTTCAGTGAACTCATCTCCCAGTACTCTGATGAGGAAGAGAT
CCAGCATGTGGTAGAG
gtgattcaaaattccacggccaaagtcatcgtggttttctccagtggcccagatcttgag
cccctcatcaaggagattgtccggcgcaatatcacgggcaagatctggctggccagcgag
gcctgggccagctcctccctgatcgccatgcctcagtacttccacgtggttggcggcacc

Exon 24 +      79369      79930   2   Internal    562    97   Excellent
tgcagctgatgacgactatgggcggccggggattgagaaattccgagaggaagctgagga
aagggatatctgcatcgacttcagtgaactcatctcccagtactctgatgaggaagagat
ccagcatgtggtagaggtgattcaaaattccacggccaaagtcatcgtggttttctccag
TGGCCCAGATCTTGAGCCCCTCATCAAGGAGATTGTCCGGCGCAATATCACGGGCAAGAT
CTGGCTGGCCAGCGAGGCCTGGGCCAGCTCCTCCCTGATCGCCATGCCTCAGTACTTCCA
CGTGGTTGGCGGCACCATTGGATTCGCTCTGAAGGCTGGGCAGATCCCAGGCTTCCGGGA
ATTCCTGAAGAAGGTCCATCCCAGGAAGTCTGTCCACAATGGTTTTGCCAAGGAGTTTTG
GGAAGAAACATTTAACTGCCACCTCCAAGAAGGTGCAAAAGGACCTTTACCTGTGGACAC
CTTTCTGAGAGGTCACGAAGAAAGTGGCGACAGGTTTAGCAACAGCTCGACAGCCTTCCG
ACCCCTCTGTACAGGGGATGAGAACATCAGCAGTGTCGAGACCCCTTACATAGATTACAC
GCATTTACGGATATCCTACAATGTGTACTTAGCAGTCTACTCCATTGCCCACGCCTTGCA
AGATATATATACCTGCTTACCTGGGAGAGGGCTCTTCACCAATGGCTCCTGTGCAGACAT
CAAGAAAGTTGAGGCGTGGCAG
gtgcgtccttcacttatatagcaatttgctgtataataaagcagagttgggctgcaactc
caggcaagaaaaatagtggtcatttgaaaagggcaatatttaaatgaagccactaaatgg
agctttggattcaaagtaccttttttaaatcttgagcaactgatttgaacaaaattgata

Exon 25 +      88969      89044   0    Initial     76    44    Marginal
tacagaaggaaataaggcagttcctgctttagagaagtttggtctaatgaagtgtgggta
caacattcctagccacaaagattccagagtgcttccttctccagataagatgtttacatt
gccatctcttccctcctgcctactctttatctccctgccacatccgaagttggacttgcc
ATGTCTCATTACTCAACTCGCTACACCAAGTATCCTAGAGGCTACCTTGTTATCAAGGAT
CCTGCCAACTACAAAT
gtcggtttcactaattaattcatatttggatttttaaagtccttttccatgccttctttt
ttgcaacagctttataagatgtaattcacatgccatacaattcagtcatttaaagtatac
aattaagtggcttttaatacattcacagttatgcaaccataaccacagtcaattttagaa

Exon 26 +      90507      90641   0     Single    135    41    Marginal
tcatgagttttttaatgactacttagaaactttaagaaaatgatttttgattgtttctcc
tttgaagttaggattatggtggaaatctccagcccatgccaacaataatgcagaagactt
gtagccagggatgagctttaagtcacttgtctgaccagtgtgaaagatgaccagctaatt
ATGAAAGGATCTTGTGCAGTTCCCCTCCCCACTTCTACCCTGATGCTGGGAGAGTTCCAC
TGCAGAGAACTAGTGGACAAAGGAGAAAAGCAGCTTGTTGCCTGGCATGTTAAGAACCAA
GGAACTGAAACCTAA
ataggaagaagaaatgtatgctaactactagagctttaccacaatatatgcatttcaata
aggatgtattactgacctctaacaaacatttgccatggacactgtaagcaatttatatta
gaggtgtaggatgatgttgtagaaaagccttgtttaacccgtagctccagcacttagtgg

Exon 27 +      93330      93560   0   Internal    231   100   Excellent
ctgctgctaacaccggcaagtactttggtgtgaattagaaaaagctgtctcttcctcaag
tcacgttcctcccactttgttggaacaagatagtctaccgttgttgtgcagggcacagcc
tacctaattagttctatgtggcagccctggggcttgtactcattctttgctcctctttag
GTCCTGAAGCACCTACGGCATCTAAACTTTACAAACAATATGGGGGAGCAGGTGACCTTT
GATGAGTGTGGTGACCTGGTGGGGAACTATTCCATCATCAACTGGCACCTCTCCCCAGAG
GATGGCTCCATCGTGTTTAAGGAAGTCGGGTATTACAACGTCTATGCCAAGAAGGGAGAA
AGACTCTTCATCAACGAGGAGAAAATCCTGTGGAGTGGGTTCTCCAGGGAG
gtaggtgctgtccatcagaaaaccagatgtctccaccaggggcaggaaactgtgctgggc
tttgggagggcctttggtttccccactggacttccaaaataaagagtccacttccctgaa
ctctctggcctttgcaatcttggggctccctgtgaaatccacagtgtttagtgtaaagag

Exon 28 +      98605      98677   0    Initial     73    59    Marginal
ctctctacctctaagatacatatgctgttgcaaaacggacttcattcttatgatacattt
cttgtctttgaaacatatacattgttagatagtaaatgactaataaattcctagaatgaa
taatcaattagctggtgcaaagaatgagatagaagcaggacttcttgaaatggtgaagca
ATGATAAAATTGAACAAAACTGGACAAAAACCACTGAAGAACCTGGAAGTTAACCAGAAG
CACACAACAAAAG
gtgaagggttttgtttatttgttttgttttgttttgtttttaacaaaaactaatgaaatt
ctggtaagaacactggtagtctatggcattttagcctgggcctgctcttcagttgtttct
aataattcggttgttcttttgggttttctttatggcaaccatatcatctgcaaataacta

Exon 29 +      99631      99754   0   Internal    124    98   Excellent
cctttcacagatatcagaaccaaggacctctggacctccctttgcctggaatgggcccaa
cgtctgtcacactgattcttgtgcccaaactcctccctcttacatgttttgaagagacag
tagggctggcccctgaccctacaactacagccactcacctttgtgctgtctgtcctccag
GTGCCCTTCTCCAACTGCAGCCGAGACTGCCTGGCAGGGACCAGGAAAGGGATCATTGAG
GGGGAGCCCACCTGCTGCTTTGAGTGTGTGGAGTGTCCTGATGGGGAGTATAGTGATGAG
ACAG
gtaagggaacccctcttgggcactgtgcagggcttggtccacttcggaggcctggggtca
gtgaagcccatggaagggctgggctgagatggtgctttgcacagtttctcatttaacaaa
ggtatatctgagcatcacaaaatgttgggcatggaggtggaacagaaaaagaatgttaga

Exon 30 +     101205     102709   1   Terminal   1505    93   Excellent
ttaaacatgtcggggttcagcatatttttgataatgtaaaaatcagaatgatttcatcaa
aatggagaaaatatgtagtgaccacatccaaaaaactatgtattcccaccaccacatgta
cactcacacattttagtctgtgccacacaataactcactcttcactgggacattttacag
ATGCCAGTGCCTGTAACAAGTGCCCAGATGACTTCTGGTCCAATGAGAACCACACCTCCT
GCATTGCCAAGGAGATCGAGTTTCTGTCGTGGACGGAGCCCTTTGGGATCGCACTCACCC
TCTTTGCCGTGCTGGGCATTTTCCTGACAGCCTTTGTGCTGGGTGTGTTTATCAAGTTCC
GCAACACACCCATTGTCAAGGCCACCAACCGAGAGCTCTCCTACCTCCTCCTCTTCTCCC
TGCTCTGCTGCTTCTCCAGCTCCCTGTTCTTCATCGGGGAGCCCCAGGACTGGACGTGCC
GCCTGCGCCAGCCGGCCTTTGGCATCAGCTTCGTGCTCTGCATCTCATGCATCCTGGTGA
AAACCAACCGTGTCCTCCTGGTGTTTGAGGCCAAGATCCCCACCAGCTTCCACCGCAAGT
GGTGGGGGCTCAACCTGCAGTTCCTGCTGGTTTTCCTCTGCACCTTCATGCAGATTGTCA
TCTGTGTGATCTGGCTCTACACCGCGCCCCCGTCAAGCTACCGCAACCAGGAGCTGGAGG
ATGAGATCATCTTCATCACGTGCCACGAGGGCTCCCTCATGGCCCTGGGCTTCCTGATCG
GCTACACCTGCCTGCTGGCTGCCATCTGCTTCTTCTTTGCCTTCAAGTCCCGGAAGCTGC
CGGAGAACTTCAATGAAGCCAAGTTCATCACCTTCAGCATGCTCATCTTCTTCATCGTCT
GGATCTCCTTCATTCCAGCCTATGCCAGCACCTATGGCAAGTTTGTCTCTGCCGTAGAGG
TGATTGCCATCCTGGCAGCCAGCTTTGGCTTGCTGGCGTGCATCTTCTTCAACAAGATCT
ACATCATTCTCTTCAAGCCATCCCGCAACACCATCGAGGAGGTGCGTTGCAGCACCGCAG
CTCACGCTTTCAAGGTGGCTGCCCGGGCCACGCTGCGCCGCAGCAACGTCTCCCGCAAGC
GGTCCAGCAGCCTTGGAGGCTCCACGGGATCCACCCCCTCCTCCTCCATCAGCAGCAAGA
GCAACAGCGAAGACCCATTCCCACAGCCCGAGAGGCAGAAGCAGCAGCAGCCGCTGGCCC
TAACCCAGCAAGAGCAGCAGCAGCAGCCCCTGACCCTCCCACAGCAGCAACGATCTCAGC
AGCAGCCCAGATGCAAGCAGAAGGTCATCTTTGGCAGCGGCACGGTCACCTTCTCACTGA
GCTTTGATGAGCCTCAGAAGAACGCCATGGCCCACAGGAATTCTACGCACCAGAACTCCC
TGGAGGCCCAGAAAAGCAGCGATACGCTGACCCGACACGAGCCATTACTCCCGCTGCAGT
GCGGGGAAACGGACTTAGATCTGACCGTCCAGGAAACAGGTCTGCAAGGACCTGTGGGTG
GAGACCAGCGGCCAGAGGTGGAGGACCCTGAAGAGTTGTCCCCAGCACTTGTAGTGTCCA
GTTCACAGAGCTTTGTCATCAGTGGTGGAGGCAGCACTGTTACAGAAAACGTAGTGAATT
CATAA
aatggaaggagaagactgggctagggagaatgcagagaggtttcttggggtcccagggaa
gaggaatcgccccagactcctttcctctgaggaagaagggataatagacacatcaaatgc
cccgaatttagtcacaccatcttaaatgacagtgaattgacccatgttccctttaaaatt

--------------------------------------------------------------------------------