--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (11382 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1316       1352   0    Initial     37    49    Marginal
aggcggagcagggccgtcgcgccttggtgacgtctgccgccggcgcgggcgggtgacgcg
actgggcccgttgtctgtgtgtgggactgaggggccccgggggcggtgggggctcccggt
gggggcagcggtggggagggagggcctggacatggcgctgaggggccgccccgcgggaag
ATGAATAAGGGCTGGCTGGAGCTGGAGAGCGACCCAG
gtgaggaggggaccgggagggccaggggctggggaggccggatgggcccgggacgcgcct
gcctgaccatcaccccctcctcttgtcgccccacccaggcctcttcaccctgctcgtgga
agatttcggtaagagccttttctccctgccggaccggggctgtggcggcccacccctgcg

Exon  2 +       1451       1640   1   Internal    190   100   Excellent
gagggagggcctggacatggcgctgaggggccgccccgcgggaagatgaataagggctgg
ctggagctggagagcgacccaggtgaggaggggaccgggagggccaggggctggggaggc
cggatgggcccgggacgcgcctgcctgaccatcaccccctcctcttgtcgccccacccag
GCCTCTTCACCCTGCTCGTGGAAGATTTCGGTAAGAGCCTTTTCTCCCTGCCGGACCGGG
GCTGTGGCGGCCCACCCCTGCGCCCTCACTCATCAGGGGCTGTCCTTCCCTACTGCTTTC
CTTTCCTCATCGCAGGTGTCAAGGGGGTGCAAGTGGAGGAGATCTACGACCTTCAGAGCA
AATGTCAGGG
gtgagtggctgtacaccagggctgccccttacacccagagtgctggggaaggtcccagag
aacagggccccttagggaagacagtgccaggaaccctacgttgtaaaatctcacagaaag
cagcagccttgctctctgagtgcccgctcctgatcaaactgatactttcttttctcccaa

Exon  3 +       2588       2720   2   Internal    133    64    Marginal
ggtgtgtgagggcacaaggccacttcagacacagtgttgggaagaagccaggggagaggg
gggatcacagcaaggacacctgagtgatgacgcagtgcaaaggattaatgggagaaagaa
gggaatgctgattgtcttctcccctttggctgatctggctctgccccttacttcccccag
CCCTGTATATGGATTTATCTTCCTGTTCAAATGGATCGAAGAGCGCCGGTCCCGGCGAAA
GGTCTCTACCTTGGTGGATGATACGTCCGTGATTGATGATGATATTGTGAATAACATGTT
CTTTGCCCACCAG
gtctgctggactctgtgctttgtttggagggtgggatgctgccatgtttttgcttgggaa
gtggaaatggaggaagacaggaggaggagataggcagattctaggggtggtagctacaga
aatcctctggcagaacgaactgaactcttaattcattaaagggaacagctttagagtagg

Exon  4 +       3117       3236   0   Internal    120    77        Good
ccagtgggtatttggtaggtgcttgttaaatgaataaacattaggcaaagatgaaaggag
ctgagaaggggagttgtccagatatgactgacctgctctggatccccattcttgatgtat
atgggcttggggcttgcagtgaggggtgctgtgtatgggtgactattcttggtttcacag
CTGATACCCAACTCTTGTGCAACTCATGCCTTGCTGAGCGTGCTCCTGAACTGCAGCAGC
GTGGACCTGGGACCCACCCTGAGTCGCATGAAGGACTTCACCAAGGGTTTCAGCCCTGAG

gtaggctgcagtgccttcatcctggctcacagccaactgggcagatctgaccctgagggc
cactgggaatgctaccacatgatattgggtactattaggctgtttctttttcaaatgatt
gtttatgttacatttgactcttaaataaattgtgtaaggccattgtttttagatgcagtt

Exon  5 +       3734       3795   0   Internal     62   100   Excellent
agtccatctctttggggctccagagctcttttctgcccccaccagccttttaagaaagtt
cgtctgtgttccttccgattcctggaatgcctccaggctgctctctgaagctttgccttc
cacccatagtcctacctgaggagaaattattctgatacggccttattttcttccccgtag
AGCAAAGGATATGCGATTGGCAATGCCCCGGAGTTGGCCAAGGCCCATAATAGCCATGCC
AG
gtgtgtgggagctgtgggagctgatgtggggtgggagtagggggagtatcattttttggg
ccctgactctgtttttccccaggcccgagccacgccacctccctgagaagcagaatggcc
ttagtgcagtgcggaccatggaggcgttccactttgtcagctatgtgcctatcacaggcc

Exon  6 +       3878       4020   2   Internal    143   100   Excellent
aattattctgatacggccttattttcttccccgtagagcaaaggatatgcgattggcaat
gccccggagttggccaaggcccataatagccatgccaggtgtgtgggagctgtgggagct
gatgtggggtgggagtagggggagtatcattttttgggccctgactctgtttttccccag
GCCCGAGCCACGCCACCTCCCTGAGAAGCAGAATGGCCTTAGTGCAGTGCGGACCATGGA
GGCGTTCCACTTTGTCAGCTATGTGCCTATCACAGGCCGGCTCTTTGAGCTGGATGGGCT
GAAGGTCTACCCCATTGACCATG
gtaggcaccatgagctggaggcctgttgggtgtctctgcctacctcctagggagctgggg
ctcagggccctctggtatgtggtacccagtggcaggggttgtcggtaccgacacccggct
ctggctggggtttcaccctacaccatattgcccgaccagctcctgattccctggctcaac

Exon  7 +       4287       4365   1   Internal     79   100   Excellent
cagtggcaggggttgtcggtaccgacacccggctctggctggggtttcaccctacaccat
attgcccgaccagctcctgattccctggctcaactgctcttctctgtcttccttcccact
cctggcctgcccaaactcagggtttccttctcgctgattccttgtcttggtctccactag
GGCCCTGGGGGGAGGACGAGGAGTGGACAGACAAGGCCCGGCGGGTCATCATGGAGCGTA
TCGGCCTCGCCACTGCAGG
gtaagggccctgtgcctgccctgttctactctctggagctgtacctactttgggagggac
agagagtatccaggtgatttgtaaattgcaaggccatatggtgaatctggcaagatcagg
cttagatcatgggttctcaacttgttgtcttatttcctgcctgggctgcctgtggcctgc

Exon  8 +       4818       4945   2   Internal    128   100   Excellent
tgttggaaggtaccagctcaggtgcctggcatgtatggctagtcgctgcctgcctgttgg
ggtggggcctatacctacagctgcaggtgtgactgcagggagccctgccaggatatctgc
ctcaacctgatggcggggccggggcgggagctgctctcacggctgcggctgtgactgcag
GGAGCCCTACCACGACATCCGCTTCAACCTGATGGCAGTGGTGCCCGACCGCAGGATCAA
GTATGAGGCCAGGCTGCATGTGCTGAAGGTGAACCGTCAGACAGTACTAGAGGCTCTGCA
GCAGGTAG
gtgccctttcttcctggcctctgcccagcccaaccctccctgcattcctcctcccttccc
ccacagcatttgtctctgattcgtgaacatactctcttgtagatctgggcttcagctaac
cacatcttttctttgcccccattgtgggaaaggtgggacttggagtggggagggagaata

Exon  9 +       5900       6084   1   Internal    185    74        Good
ccatctcattctttgccctgtctcattgcgggatcatgacttagagcttgctgactccca
ttgcaccagctggctgggctgttcttctctgggaagtgctggttcacagggccggggaga
ctgtgagcttttcttggagatcctactggaggtcctgcctgtgttcttgccctgtctcag
ATGGTGCAGAGGAGGCGGCTGGTTCATGCGCACAAGCCCCATCCCACAGCCCTCCCAACA
AACCCAAGCTAGTGGTGAAGCCTCCAGGCAGCAGCCTCAATGGGGTTCACCCCAACCCCA
CTCCCATTGTCCAGCGGCTGCCGGCCTTTCTAGACAATCACAATTATGCCAAGTCCCCCA
TGCAG
gtaagctgggagcacccttgcaggattctctacttgattctcttgagaggctgcaacagg
caattttcccatgtggttccttggtgttcatccttggcatggctgggtcaagctgcctgg
gcctgggttgctaggttcctctgcctgatatgaaaaggcccccacaacagcaggagctta

Exon 10 +       6608       6741   0   Internal    134   100   Excellent
tctatccagtgtaagtgggtggcagcctccccacaagccaaggacaggccatggaacagc
tggaggggttccgctgactcagtctggaaaaccatgttggctttctctctggctgtgagt
gtctaggctcagcctgggccgagcagcacttgtttgtaactgccctggtctttgtcccag
GAGGAAGAAGACCTGGCGGCAGGTGTGGGCCGCAGCCGAGTTCCAGTCCGCCCACCCCAG
CAGTACTCAGATGATGAGGATGACTATGAGGATGACGAGGAGGATGACGTGCAGAACACC
AACTCTGCCCTTAG
gtcagcccagctttctaaggctaccaggttctaggtgcttcggatcccatcctgaatatc
tcagtctgtgtctgagaatgccctgcagcagataatgttgagcacctgcggagtttgggg
ccctgggggaggctggcatgatggggctgaccccaggtccccaggaagtttttggtgggc

Exon 11 +       7516       7778   2   Internal    263    90   Excellent
gagcggttctgctgatgggcaactgtcagtgctgcagcccaacaccatcaacgtcttggc
tgagaagctcaaagagtcccagaaggacctctcaattcctctgtccatcaagactagcag
cggggctgggagtccggctgtggcagtgcccacacactcgcagccctcacccacccccag
CAATGAGAGTACAGACACGGCCTCTGAGATCGGCAGTGCTTTCAACTCGCCACTGCGCTC
GCCTATCCGCTCAGCCAACCCGACGCGGCCCTCCAGCCCTGTCACCTCCCACATCTCCAA
GGTGCTTTTTGGAGAGGATGACAGCCTGCTGCGTGTTGACTGCATACGCTACAACCGTGC
TGTCCGTGATCTGGGTCCTGTCATCAGCACAGGCCTGCTGCACCTGGCTGAGGATGGGGT
GCTGAGTCCCCTGGCGCTGACAG
gtgggccttggactggctcactggccacttggtgcacccaggagggaggagggaagtggc
caagtgaccacaaagtgtcctgcactctgatgattttcttgtgacctctcttcccagagg
gtgggaagggttcctcgccctccatcagaccaatccaaggcagccaggggtccagcagcc

Exon 12 +       7896       8056   1   Internal    161   100   Excellent
tcatcagcacaggcctgctgcacctggctgaggatggggtgctgagtcccctggcgctga
caggtgggccttggactggctcactggccacttggtgcacccaggagggaggagggaagt
ggccaagtgaccacaaagtgtcctgcactctgatgattttcttgtgacctctcttcccag
AGGGTGGGAAGGGTTCCTCGCCCTCCATCAGACCAATCCAAGGCAGCCAGGGGTCCAGCA
GCCCAGTGGAGAAGGAGGTCGTGGAAGCCACGGACAGCAGAGAGAAGACGGGGATGGTGA
GGCCTGGCGAGCCCTTGAGTGGGGAGAAATACTCACCCAAG
gtgagcctccgttgtggttttctcctttaatcctggcagagggtaaggcctgagctcctc
ctgcccaggtgccaagttcttgattggaactttggtgtgaagattggtggctggagccat
gtgccagaagactttctgggttgggtggtggcaggggccttgataggcatggactcgctg

Exon 13 +       8254       8415   0   Internal    162    92   Excellent
ttttctcctttaatcctggcagagggtaaggcctgagctcctcctgcccaggtgccaagt
tcttgattggaactttggtgtgaagattggtggctggagccatgtgccagaagactttct
gggttgggtggtggcaggggccttgataggcatggactcgctgctcatccttgcctctag
CTGCCTATTGCTCGTGGGGCTTTGTTGCTGGCCCGCCCCGATCAGAGGTGCAATGCTGGG
TTTTGGCAGGAGCTGCTGGCACTGCTGAAGTGTGTGGAGGCTGAGATTGCAAACTATGAG
GCGTGCCTCAAGGAGGAGGTAGAGAAGAGGAAGAAGTTCAAG
gtgggtgatttctccagttgcctgatctggcctctcccgaggtccactggtggctgctct
ggcaagattggctccagtgctctcagtcttcttctctcctacagattgatgaccagagaa
ggacccacaactacgatgagttcatctgcacctttatctccatgctggctcaggaaggtg

Exon 14 +       8520       8639   0   Internal    120    93   Excellent
gaagtgtgtggaggctgagattgcaaactatgaggcgtgcctcaaggaggaggtagagaa
gaggaagaagttcaaggtgggtgatttctccagttgcctgatctggcctctcccgaggtc
cactggtggctgctctggcaagattggctccagtgctctcagtcttcttctctcctacag
ATTGATGACCAGAGAAGGACCCACAACTACGATGAGTTCATCTGCACCTTTATCTCCATG
CTGGCTCAGGAAGGTGAGGGGATGCGCTGCTGTCTTAACTGGAATGCCCTGCTGAGGGCC

gtgtccttcagctcccctcccctggcctctcctgaggcttgagcagaccttggggcacag
ggagggccatgagagcctcagctcctggcctgaggcagccagcacctgctcaagggtctc
tacctcttcgcaggcatgctggccaacctagtggagcagaacatctccgtgcggcggcgc

Exon 15 +       8773       8906   1   Terminal    134   100   Excellent
gtgaggggatgcgctgctgtcttaactggaatgccctgctgagggccgtgtccttcagct
cccctcccctggcctctcctgaggcttgagcagaccttggggcacagggagggccatgag
agcctcagctcctggcctgaggcagccagcacctgctcaagggtctctacctcttcgcag
GCATGCTGGCCAACCTAGTGGAGCAGAACATCTCCGTGCGGCGGCGCCAAGGGGTCAGCA
TCGGCCGGCTCCACAAGCAGCGGAAGCCTGACCGGCGGAAACGCTCTCGCCCCTACAAGG
CCAAGCGCCAGTGA
ggactgctggccctgactctgcagcccactcttgccgtgtggccctcaccagggtccttc
cctgccccacttccccttttcccagtattactgaatagtcccagctggagagtccaggcc
ctgggaatgggaggaaccaggccacattccttccatcgtgccctgaggcctgacacggca

Exon 16 +      10186      10270   0    Initial     85    72        Good
ctgccagatggctttgaaaaaggtgatccaagcaggcccctttatctgtacatagtgact
gagtggggggtgctggcaagtgtggcagctgcctctgggctgagcacagcttgacccctc
tagcccctgtaaatactggatcaatgaatgaataaaactctcctaagaatctcctgagaa
ATGAACCCTCCTGTGGTTGCTGGCCTGAGATATGGAGGCTGGGCCTTACTAGACCTCATG
GGCCTAGGGCCCTGGGACCAGAAAG
gtaagaagtatatgatccttgagtgtccagctgtcttgggccagagatccttggaatcct
aggcctgggatttaggacctgagctgaggagggacttcaggtggactgtagacagggtgc
actttctggggagagggccatggctttcaccaaatctgtggctttgcagcctggagaggt

--------------------------------------------------------------------------------