Gene XBP1 Variant 1
DNA : 6.01 KbNT_011520
mRNA : 1819 bp NM_005080
CDS : 786 bp NP_005071
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  275 bp
aatgaccccaagtacctttggccagggattgccgctgccacgccggactccatagccacg
gtcctgaaacgccccgccgggcaggccggaccaatggacgccgagctcggccgtgcgtca
cgcgacgctggccaatcgcggagggccacgaccgtagaaaggccgggcgcggcgaggctg
GGCGCTGGGCGGCTGCGGCGCGCGGTGCGCGGTGCGTAGTCTGGAGCTATGGTGGTGGTG
GCAGCCGCGCCGAACCCGGCCGACGGGACCCCTAAAGTTCTGCTTCTGTCGGGGCAGCCC
GCCTCCGCCGCCGGAGCCCCGGCCGGCCAGGCCCTGCCGCTCATGGTGCCAGCCCAGAGA
GGGGCCAGCCCGGAGGCAGCGAGCGGGGGGCTGCCCCAGGCGCGCAAGCGACAGCGCCTC
ACGCACCTGAGCCCCGAGGAGAAGGCGCTGAGGAG
gtgggcgaggggccggggtctggggccagatctgaagccgggactagggacaggggcagg
ggcaggggctgggagcggggacccagcactggccgccccgcagggctccgtcgcctttgg
cctggcgggtcggtgccagcgtggcgcggggcggggcaggaagcccggactgaccggatc
EXON 2  97 bp
attgacagaagactgtattttttattttgttttattgaggggaggagcctgaagtgtatt
ttatcattagtctgtcttatactgtaaataaaaatgaaagcaccagctggtaaagttttc
aaataaagacataaataaggtttgatatgactcagtgtggtatgttccttctcttcctag
GAAACTGAAAAACAGAGTAGCAGCTCAGACTGCCAGAGATCGAAAGAAGGCTCGAATGAG
TGAGCTGGAACAGCAAGTGGTAGATTTAGAAGAAGAG
gtaaaactacttaaggtcaaactcttttatccattgtatacccttccttggtgaatgttc
tgatatttgcttcccatcccaagttgtttcagcccctattagaatacaattgaatatatg
attaaaagttaaactaggctgggcatggtggctcatgcctgtaatcccagcactttggga
EXON 3  129 bp
ttattaagtagcttgcttttccataattatggcctagctttttaaaacctactatgaaca
ccacaagcatagagttttccaaaagttcaagaaggaaaggaaaccaattatactgaatca
ggtagattcttaactgaaataattagatgttttaatagcctcttatgaactttcttccag
AACCAAAAACTTTTGCTAGAAAATCAGCTTTTACGAGAGAAAACTCATGGCCTTGTAGTT
GAGAACCAGGAGTTAAGACAGCGCTTGGGGATGGATGCCCTGGTTGCTGAAGAGGAGGCG
GAAGCCAAG
gtaaatcatctcctttatttggtgcctcatgtgagtactggttccaagtgacatgaccca
gcgattatgtttacagtctggacttctgatcaagagcgttcttgaaattttccttcagtt
ttaagacattttcatgcaggcagagtgttcttcccctaaaggcacttgacactcattttt
EXON 4  146 bp
gcaaatatcttatcttgctcttctcaataataataatgttgttagataataaagttctat
agcaatttaaccctagaatctttttgaaaagtaattctttaaagttgagaatcacagctg
tctagcaagcatttccttgggcacttgaagctgtttattcactttggtctttcctcccag
GGGAATGAAGTGAGGCCAGTGGCCGGGTCTGCTGAGTCCGCAGCACTCAGACTACGTGCA
CCTCTGCAGCAGGTGCAGGCCCAGTTGTCACCCCTCCAGAACATCTCCCCATGGATTCTG
GCGGTATTGACTCTTCAGATTCAGAG
gtagggatcattctgacttattaaagagctatataaccagttaattccatctgtttgatg
cttgacatccctaactagacagatgagggttgaagttagtttttggtggggttggaggtg
aacatcaactaccttcctagttccaggtaatatagaacatggagtgaagtgtagataaat
EXON 5  1172 bp
tcctagttccaggtaatatagaacatggagtgaagtgtagataaatgggtctggtgggtc
ccgaggtcatcttatcacataatgactaatttacattatggaacccagtacaaagtgttc
cagttagattttccattgtattctgacagttgtacttcatttaatttttgcctcttacag
TCTGATATCCTGTTGGGCATTCTGGACAACTTGGACCCAGTCATGTTCTTCAAATGCCCT
TCCCCAGAGCCTGCCAGCCTGGAGGAGCTCCCAGAGGTCTACCCAGAAGGACCCAGTTCC
TTACCAGCCTCCCTTTCTCTGTCAGTGGGGACGTCATCAGCCAAGCTGGAAGCCATTAAT
GAACTAATTCGTTTTGACCACATATATACCAAGCCCCTAGTCTTAGAGATACCCTCTGAG
ACAGAGAGCCAAGCTAATGTGGTAGTGAAAATCGAGGAAGCACCTCTCAGCCCCTCAGAG
AATGATCACCCTGAATTCATTGTCTCAGTGAAGGAAGAACCTGTAGAAGATGACCTCGTT
CCGGAGCTGGGTATCTCAAATCTGCTTTCATCCAGCCACTGCCCAAAGCCATCTTCCTGC
CTACTGGATGCTTACAGTGACTGTGGATACGGGGGTTCCCTTTCCCCATTCAGTGACATG
TCCTCTCTGCTTGGTGTAAACCATTCTTGGGAGGACACTTTTGCCAATGAACTCTTTCCC
CAGCTGATTAGTGTCTAAGGAATGATCCAATACTGTTGCCCTTTTCCTTGACTATTACAC
TGCCTGGAGGATAGCAGAGAAGCCTGTCTGTACTTCATTCAAAAAGCCAAAATAGAGAGT
ATACAGTCCTAGAGAATTCCTCTATTTGTTCAGATCTCATAGATGACCCCCAGGTATTGT
CTTTTGACATCCAGCAGTCCAAGGTATTGAGACATATTACTGGAAGTAAGAAATATTACT
ATAATTGAGAACTACAGCTTTTAAGATTGTACTTTTATCTTAAAAGGGTGGTAGTTTTCC
CTAAAATACTTATTATGTAAGGGTCATTAGACAAATGTCTTGAAGTAGACATGGAATTTA
TGAATGGTTCTTTATCATTTCTCTTCCCCCTTTTTGGCATCCTGGCTTGCCTCCAGTTTT
AGGTCCTTTAGTTTGCTTCTGTAAGCAACGGGAACACCTGCTGAGGGGGCTCTTTCCCTC
ATGTATACTTCAAGTAAGATCAAGAATCTTTTGTGAAATTATAGAAATTTACTATGTAAA
TGCTTGATGGAATTTTTTCCTGCTAGTGTAGCTTCTGAAAGGTGCTTTCTCCATTTATTT
AAAACTACCCATGCAATTAAAAGGTACAATGC
agcatccttgtttgatttcttctagggccgtaagtcttgttttctctccagatgtttatc
tgtgtgctgtggtaggaattaatccaactgaagtgagcctaacgctttttaaagtgactg
aaggcttttccaccttaattactgcctgctttaattctggactgccataagtgatataag