Gene TOP3B Variant 1
DNA : 25.74 KbNT_011520
mRNA : 3106 bp NM_003935
CDS : -1843250 bp NP_690870
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  337 bp
gcggcgtgcaagtgccactccctggggtgctcccggaatccgcgagccacggaacctaag
aacgccgacccgccggagccggagggcagacgctggcacaccggacgcggggacgccaga
agcggctggacccggaaataggggttgtcggtagccgccccgggaacaaggaccggagct
GGATCCGCGGTGCGGCTGTGGGTGAGCGGCGGGCTGCGGGACCCTCGCCCGGCGGCTCAG
AAAGGCGGGAAGCGCACGCATTTTTCTGGCTTGTTTCCTGAACGTTGGCCGGCGGAGGAC
CCGCGAGCTCGGGAGAGCGCCCGGGCCGGGCTCTGCATTCTTGTTGCCTCTTCCCTGGCG
GGGGTGATACTCTCCCGCGGGGCTTGCTGTGGGGGTTCAGGGAGGTGGAGATGGGCCCGC
CATGTGCCTGCAGGGAGCAGGCGCTGTGGTTAATACTTTTCTTCTTCGAACCCTCCCACA
GCTCTTTAGGGTGAGATCTGCTGTACCAGTCTCACAG
gtagggaaactgaggctcagggaagctgtgcagccaccggggcccagatcggtgcggtac
acacccaggcagcttccactcgccgccccctaggccctggctgggttttgagggcaccca
ggttctctgacctgttatctgtaaatgaagtagggtacttttgtgaacaaattagctgga
EXON 2  168 bp
tgacctggtagttttttcttgtttttaatctcagatgtcttcaagtttccctaattccct
aatttttcttcttcttgcctcaggttggtcttgttttttctttgttaaagtgattttcct
tgtagtggtgtaggttctattgacagcattgctatcctgagtgtcttttcttctctttag
GAGTCAGCATTGGTAATAGTGCTGTGCTGCGGAAGAGTGGAGTCTAAACTTTTTCATTGC
CAGTGCCCCGAAACTGGAGTGTGAAGGACCGAGACAAAATGAAGACTGTGCTCATGGTTG
CTGAAAAGCCGTCCTTGGCACAGTCAATTGCCAAAATCCTCTCTAGAG
gtaggagagaccagccctgctttggtctgtaagcacggtcgtttatgtgttacaggacat
tttttcctaatgtgattccaccctggctggggtagatttggttcgggtcggcaggtggta
atgaagcatctcagtatgtcacagtggggtgcatttgcttccactcctggcaatgtgcca
EXON 3  132 bp
cctgagcgccgtcccacctctcagtgcccaactacccgcaccagtctgcggaatgtcgtc
actcaccactctggggaaggaggactctggccctctgggaggtggcatccgggctggggt
ctccacagggtcttcagctcagctgaagcagccagtcactttgtgcttcctcatccccag
GGAGCCTGTCCTCACACAAAGGGCTGAACGGGGCCTGCTCAGTCCACGAGTACACTGGGA
CCTTTGCTGGCCAGCCAGTGCGCTTCAAGATGACGTCTGTCTGTGGTCACGTGATGACCC
TGGATTTCCTGG
gtaagcccctctaccctccatcctactgaagggagttctgcatggcactggccagggtcc
agttgaagccaggagatgcctctaggcagggaagtttgtcccaactccatgagtcataag
gccagcagatcatgaagtagcaatgagagggtccctggtgcggtgcccagaacccaggct
EXON 4  107 bp
gttaccaaaggcctgaacccacatcctggctctgcctctgatcatcaggatgaccctggg
caaattgttctccaagctttcccctcctcatttgtgggatgaggccaacatcctcctggg
gttatgatggtctcggaggctgagctcctgtgactcaatgtcactgtgactggtttgtag
GAAAATACAACAAATGGGACAAAGTGGACCCCGCAGAACTGTTCAGCCAAGCTCCCACGG
AGAAGAAAGAAGCTAACCCCAAGCTGAACATGGTGAAGTTCCTGCAG
gtgcgtggggctggcctgggcatgagcacaccggggctccccaccctccacagctgccat
gtctttgcccacccttgcttgagtcctaatcccccttggacaggggggcctttgctagct
ttttctgtgagtgccccctgctggcccacgaggcacctgcaggcacccccaacacacaag
EXON 5  75 bp
attcttttctgttggctgagccagcctcaacacagccagctccttacccagcccaggtac
cagtcctcctaactgaggttcagggcctgggaccaagccctgtcctggatgggagcactg
ggggcgggtggcacagaccgggtctgcagcaggtacgtgtgaacctgtgctgtgtggcag
GTGGAGGGCAGAGGCTGCGACTACATCGTGCTGTGGCTGGACTGCGACAAGGAGGGGGAG
AACATCTGCTTTGAG
gtgagtgtgaggctcactttgttcctcacttttggcctttctgacaccagccccaaactg
acaccagcagtcagtcacatcactcctggggccaaaggagggagtaaactgtaccggttt
aaaaacacctctcccctccctttattctgaaactccacagatacttttaactgcataggc
EXON 6  197 bp
agggggatagaggagggtctggcaggtgcaggaaaggggatagaggagggtctggcaggg
gcaggagagggagccgagcacacgtgttctttcctggaaggaaccaggcttcacagtggg
gtggggagctgtggcagggatctgggaggtgggtcacagctggccactccccacccccag
GTTCTTGATGCTGTTCTGCCCGTCATGAACAAGGCCCATGGTGGCGAGAAGACCGTGTTC
CGGGCCAGGTTTAGCTCCATCACGGACACAGACATCTGTAATGCCATGGCCTGCCTAGGC
GAGCCTGACCACAACGAGGCGCTCTCAGTGGATGCTCGCCAGGAGCTGGACCTGCGAATC
GGCTGTGCATTCACCAG
gtgctggccacacccgcagagtcctgggcacaccctcactctccctcagccagagacctg
cctctactggtccccctccggggcccctaggcctcctcgagccaggatgagcaacagggg
atttcaccaaccctgaagaaggccaggcacagtggctaacacctgtaatccctgcacttt
EXON 7  157 bp
tacacacatgaatcctccctaaggctatgcccactctgctcccactggcttctaagtggg
gacaccacctgatgccacctccttcatgcaccacccctggccttgggctggactcacatg
ggtggccataatagtgtcttgagtgaatcagtgaccaaaatatctttccactccctccag
GTTTCAGACTAAATATTTCCAGGGGAAATACGGTGATTTAGACAGCTCTCTCATCTCCTT
TGGGCCGTGTCAGACTCCAACCCTGGGATTCTGTGTGGAGAGACATGATAAAATCCAGTC
CTTCAAACCAGAGACCTACTGGGTGCTGCAGGCCAAG
gttccttgcctttctctattcatgctggggctttctgggtttggggcatggattctgaga
gtcttccatcatcatcagccggcaggccccgggctgagggcagaagtgtggacggctgta
cctggaagtggtctgtggtgcctagggctgagggaccccagccttcatgggggcagtggg
EXON 8  114 bp
agagggccagatgtcagcttgcgtatctgcccacctgaacaggtacagctgtgagccatt
acagccagggctatttggctcccagacaaggaccagcttcatctgtcctggttcttcctg
gcgttgggctcacctggagactttttcttgtgcgttcaccctttatcctttttcctgcag
GTTAACACTGACAAAGACAGATCTCTCCTTTTGGACTGGGACCGAGTAAGAGTGTTTGAC
CGGGAGATCGCACAGATGTTTTTAAACATGACAAAGCTGGAGAAGGAAGCCCAG
gtgtgcctgctccacccacatctatcacagttgccttgggtgagggtggcccttggatgc
ctcccgctggaggaacagcctgtgatcctagtccacgtctttctccccctttctgaaaca
cagacatctttttggaaagctgaatggttactccctcatatactcctaagatatttctgc
EXON 9  91 bp
tctttttcctttcctggtcctgaataaatattcaatcaagtctttagactgttgggaaga
atgaattggagaaacagggagaccagatgaatgaaaccagacccttcgtccacacatctt
gattccctctatggtggtgtcttcctccttccccaaatcattgactgtcctgtcttccag
GTGGAGGCCACAAGCAGGAAAGAAAAGGCCAAGCAGAGGCCCCTGGCCCTGAACACTGTG
GAGATGCTGCGTGTGGCCAGCTCTTCTCTGG
gtatgtagggacatttctctcaagtcaccagaaggcttcctgaggcaggttcagcctgga
gcagcgagtgcccagggttgcaggatggtgcccaaggcttcaaggggatctgagcctcag
gaggatttcacttatccttaggttgtaaaggtggtaaagttggtcaccacctgaggggac
EXON 10  155 bp
actgtgtggcataggtgcccacccggccagcagctttgcactccagctgtgcctgctcag
agccaccgtcaccctccaggaggggccggccacaatgggggagcctgagtgcataggcca
gggcaggcagctggccatccccacgtacctggccctctgagaacctcctgtctctcgcag
GCATGGGGCCGCAGCACGCCATGCAGACGGCTGAGCGGCTCTACACGCAAGGCTACATCA
GCTACCCACGGACAGAGACCACCCACTACCCTGAGAACTTTGACCTGAAGGGCTCTCTGC
GGCAGCAGGCCAACCACCCCTACTGGGCCGACACG
gtgagtggagccgggccggcctcagcatgtgtgtgtgtcactgaggccttgggaccaggt
ctggtacgtcagccaaacccaggcaggcagccgagcccagccacagactctgctctgtct
tctctccctcaggtgaagcggttgttagcagaaggtatcaaccgcccgcggaaaggccat
EXON 11  106 bp
aagggctctctgcggcagcaggccaaccacccctactgggccgacacggtgagtggagcc
gggccggcctcagcatgtgtgtgtgtcactgaggccttgggaccaggtctggtacgtcag
ccaaacccaggcaggcagccgagcccagccacagactctgctctgtcttctctccctcag
GTGAAGCGGTTGTTAGCAGAAGGTATCAACCGCCCGCGGAAAGGCCATGACGCCGGCGAC
CATCCCCCCATCACCCCCATGAAGTCTGCCACAGAGGCCGAATTAG
gtaccgctctcatcccatacccggtgtgcttccagggagggaagggcgagctgcgacagt
gaaggttgcaggccctgttggcaatgtgggggctccttcagcctctgcctgccctggctg
tggggatggggggccacctggaagatgagctccattgctatgggaccaggacaggagtga
EXON 12  147 bp
gcatgagccaccacgcccggccttcctgcacattttctttcctccttccccaggatttgc
agtgtgtcctgcacagcggctctgtaagcaggagcttgctgctcgagcgagagtactggg
ggctcctcacggccagagcccccagctggctcccaactgactagccctggcctgttgcag
GGGGTGACGCGTGGCGGCTCTATGAGTACATCACCAGACACTTCATCGCCACGGTCAGCC
ATGACTGCAAGTACCTGCAGAGCACCATCTCCTTCAGAATTGGGCCCGAGCTCTTCACCT
GCTCCGGGAAGACCGTCCTCTCACCAG
gtcacaccacgggcccagccttcctcctctgtgccttcatgggcagacaaacattctaca
tcgtgtctggggatgggaggcccagggtctgaggccccggccacccaggctggggaccct
gagtggcggcgcatatctctccaggcttcacggaggtcatgccctggcagagcgtgcccc
EXON 13  174 bp
tcttcacctgctccgggaagaccgtcctctcaccaggtcacaccacgggcccagccttcc
tcctctgtgccttcatgggcagacaaacattctacatcgtgtctggggatgggaggccca
gggtctgaggccccggccacccaggctggggaccctgagtggcggcgcatatctctccag
GCTTCACGGAGGTCATGCCCTGGCAGAGCGTGCCCCTGGAGGAGAGCCTGCCCACTTGCC
AGCGGGGTGATGCCTTCCCTGTGGGCGAGGTGAAGATGCTGGAGAAGCAGACGAACCCAC
CCGACTACCTGACGGAGGCCGAGCTCATCACGCTCATGGAGAAGCATGGCATCG
gtgggtgcgcctgcccaggccccagagccggctccgtctccagtactcaggcttcgagtc
tactcacaaagctgccccgccagccctgtgtgcccagcccagcacccctccatgggctgg
tatctggaaactggtgacccagtgtgtggccagccaggcaggtccacagcgggcatcccc
EXON 14  129 bp
aatgcatgcagttggtgcccagcacagtgcagggggagctcagggcacagccctccctcc
tgtgaccgggagcagtgagagggcctgagcaccaggggccccgtgacaggtgatacagca
catggttcagtggggcatgtccaaggcaggccaggaaccctggggccttgtacattgcag
GCACGGATGCCAGCATCCCTGTGCATATCAACAACATCTGCCAGCGCAACTATGTCACGG
TGGAGAGCGGGCGCCGGCTCAAGCCCACCAACCTCGGCATCGTCCTGGTGCACGGCTACT
ATAAGATTG
gtgagttcctcagtcctgcccccagggcccaccgaggctccctggcttctccctggatgt
tggctctgctgcccgctccagacaggcccctgccctacagtgatcccccagccccacaca
cactccctcaacacccgctgaaggggtgctgccccaggacccccaggacctgcccagagc
EXON 15  150 bp
tctggggtcataagagccagcctggtaccatctgaggctgtggactggtgggtagggcag
aggccaggaggacgggccagagcgggaggggtgaacagggcagtatccctgcctgggaag
gggtggcatggccctgggtgcgagtgctcagggcaatatctgccccctgcccacttgcag
ATGCAGAGCTGGTGCTCCCCACCATCCGCAGTGCAGTGGAGAAGCAGCTGAACCTGATCG
CCCAGGGCAAGGCCGACTACCGCCAGGTCCTGGGCCACACCCTGGACGTGTTCAAGAGGA
AGTTCCACTACTTTGTCGACTCCATTGCTG
gtagagtctgcctctggcctgcccctcaccagaggggtgtctctctgtcagcaaggccag
tacctggggacccaggtccccacgtgggaccagctcccagatctgggcttcaggcctccg
taggccaggtcagtgacacctcctggctgggttgaaagagcaggtgcattaacaccacac
EXON 16  101 bp
ccacacatggccaggaacacgtgcctctgacgcacagggctgctgccctgccgtgctgcc
aggacagtagaaaccaccgcctatagggaccctttcacactcagacccttgaccacgtgt
tgcggagccttttgctggggactgggagggagatgactcctgcactctgcttgcccgcag
GCATGGATGAGTTGATGGAGGTGTCTTTCTCGCCCCTGGCGGCCACAGGCAAGCCCCTCT
CACGCTGTGGGAAGTGCCACCGCTTCATGAAGTACATCCAG
gtaggtgcagggaacactagctcaggcaagctgcctcacccctgtaggcctcagctttat
cgttgatcagcaggaatcatgttctttgtcctggttgtcacaaaagaatgatggaacata
aagaggccttgccaaaaaatacccagtgtccccacgtcccctagaatacacagccattag
EXON 17  202 bp
ttttagaactgccttttctgcacgcgtggagcaagagccagagactcatgctccttgcct
ggcagtgtgtcacaggttctgcatgacagattacatactttgtattatgagaggagtggg
ggtgggtgccaagtcggtggccccagtgaccctcacgccacctgcctggcattgccgcag
GCCAAGCCAAGCCGCCTGCACTGCTCCCACTGCGATGAGACCTACACGCTCCCCCAGAAC
GGCACCATCAAGCTCTACAAGGAGCTCCGCTGCCCTCTGGATGACTTCGAGCTGGTCCTG
TGGTCATCAGGCTCTCGGGGCAAGAGCTACCCGCTGTGCCCCTACTGCTACAACCACCCA
CCCTTCCGAGACATGAAGAAAG
gtgagtgcagccactccctcctgtccacaggtagctgcagtctcttttcagtgccaaccc
ctgccttgcaccaggctggactctgaggggacccctcaccctggcctttcctgcactcat
tggcactgagacgagagaccctggatgtagctggggcactgcttaggcctcagccagtgg
EXON 18  564 bp
aaaacaggggtaatggcagccaggagccgaaacatgagcaaggctgtccccaagagcaag
gccaagaagagttccttctgctgggacgagggatccaggagcttgaggcattgggagcag
gcagcagagggcaggtgggcacagtgggcgtgcctttacagggctcccttctcccgccag
GCATGGGCTGCAACGAGTGTACGCACCCCTCCTGCCAGCACTCGCTGAGCATGCTGGGCA
TCGGCCAGTGCGTGGAATGTGAGAGCGGGGTGCTGGTGCTGGACCCCACCTCGGGCCCCA
AGTGGAAGGTGGCCTGCAACAAGTGCAACGTGGTAGCGCACTGCTTCGAGAACGCCCACC
GCGTGCGGGTGTCCGCCGACACCTGCAGTGTCTGTGAGGCCGCCTTGCTTGATGTGGACT
TCAACAAGGCCAAGTCCCCACTCCCGGGCGATGAGACGCAGCACATGGGCTGCGTCTTTT
GTGACCCCGTCTTCCAGGAGCTGGTGGAGCTGAAGCATGCGGCCTCCTGCCACCCCATGC
ACCGCGGTGGACCAGGGAGAAGGCAGGGTCGAGGGCGGGGCCGGGCCAGGAGGCCCCCTG
GGAAGCCCAACCCCAGACGGCCCAAGGACAAGATGTCAGCCCTGGCCGCCTACTTTGTAT
GATGACCCTGTCCTCCCTCACCCAGGCTGCAGTGCCATGCAGACACCTCATGGCACTTCA
AACTATTAAAATGCATTTTATCTT
atccagagctggggcccctttgctggtgcagcgatgtcagagcgttaccgtgtccctggg
cacctgtggggccctctctccctctccgaaacccaatacgtctcccttcagcctgcatac
acgtgcccagagtgctccctgctatccctacaccctggcagtacgggcagggatgcccca