Gene TBX1 Variant 3
DNA : 10.63 KbNT_011519
mRNA : 2082 bp NM_080647
CDS : 1488 bp NP_542378
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  43 bp
atgggcgtcttgtcttcgctgcgcattgcatgcggaggagcagatgtctcagcccaggcc
ctagccttgcatcgagccctgaggaatcagaccctgcgacccctagccgcgcctcacctt
cctgatccacgcaagggagctcccagtcaggcctcctatcgcgcgggtgtggaggtgcgg
CCGGCAGGGGGAGCGAGGAGGAAGGGAACCGCGGCCGGGCCAG
gtgagggagggaggaacacttgccgcgggccgtgctgaggcgctgcgttcgcgtgcggaa
cccgcgtgtgccgggctagggccatccgacgggcgcgctccctccgggctgcgggagggc
acgacgggtggggtggcggcaggtgaagaggagtgtgggcgggtggcggggtggcggggc
EXON 2  120 bp
gcagtgagtggcaccacaggcccccgcccccggactccgtgggctgggctgggctgggcg
cggtgcggctgggcacacgcagtcggaggcggcgccggccaggccgccgggcgcctatgg
acgcgcggagcccgctgtctccccgagccagtgcgttcagcatcgcctctctggttgcag
CGGAGGCGGCGGAGCGCACCGCCCACCAGGGCTCAGGGTCCTCCGACCGGGTGAAGCTTC
GCTGGCTGCCAGGATCCCCGGCAGGGATGCACTTCAGCACCGTCACCAGGGACATGGAAG

gtgagcctccaggccgtgtctacactggcccgcccgccagaccccctgcctcagctgctg
tggggcccgggtgcaaagtaggtggaggcagctcttggtagcgtgggctccaggcttctg
gctgcgattctggggcagagaggaagagccggcatcccgcccacagcctgtcccctcacc
EXON 3  376 bp
ggcctgcggtgtggggctgcacggcccggggcgcacgcagcgcggcgcccgccactcggc
ccgcggcgcggggcagcgctcagcttggtggcgggggcggcggcggcggcccgcgggtca
tgatctccgccgtgtccagcccgtggctcacgcagctctcgcatttctgcgacgttgcag
CCTTCACGGCCAGCAGCCTGAGCAGCCTGGGGGCCGCGGGGGGCTTCCCGGGCGCCGCGT
CGCCCGGCGCCGACCCGTACGGCCCGCGCGAGCCCCCGCCGCCGCCGCCGCGCTACGACC
CGTGCGCCGCCGCCGCCCCCGGCGCCCCGGGCCCGCCGCCGCCGCCGCACGCCTACCCGT
TTGCGCCGGCCGCCGGGGCCGCCACCAGCGCCGCCGCCGAGCCCGAGGGCCCCGGGGCCA
GCTGCGCGGCCGCAGCCAAGGCGCCGGTGAAGAAGAACGCGAAGGTGGCCGGTGTGAGCG
TGCAGCTAGAGATGAAGGCGCTGTGGGACGAGTTCAACCAGCTGGGCACCGAGATGATCG
TCACCAAGGCCGGCAG
gtcagggcgcccctccccacgccgcgaccctccccacgtgctgccgccagggctgcgggc
ctccgcctgatccgcgcgagcggggccgaaagccgggtcgggggcgcggcctggccacct
gcgggcccctctgggccccgctgcctccttcgctgttcgccgtcccggctccggcgacag
EXON 4  102 bp
gtaggggcctgcccagattagagcagctaagccaggaaagatggagcccaagggctggga
cgacacagcagcccccagaggctggagggaggggccgagcagaggggccgccagccccag
gcaggtcaaggggggctgccttccaccagctagggtgacccaaggcctcatcacccccag
GCGGATGTTTCCCACCTTCCAAGTGAAGCTCTTCGGCATGGATCCCATGGCCGACTATAT
GCTGCTCATGGACTTCGTGCCGGTGGACGATAAGCGCTACCG
gtgagcgagtggttgtaagcgtgagggaccgggagggcaccctggaaagtggcgggtctc
cgcctggtgacccaactccaagggtcgtctgcaccatgaaactctttaggcacctgcgat
gctgcccgatcaacccgctccctcctccactcccatctgaccccagacccacaaccctac
EXON 5  172 bp
ggagttctctgtttagtccatagtcccccttggaaaagctcccagcacatgcggcagcag
agggttcaatctcacaggtggggaaacttctcaaaggcacttttagggttcgcccagcac
acgggtcaaggccctctgggttcacctccacatgcacgaccccaccccgtgccgctccag
GTACGCCTTCCACAGCTCCTCCTGGCTGGTGGCGGGGAAGGCCGACCCTGCCACGCCAGG
CCGCGTGCACTACCACCCGGACTCGCCTGCCAAGGGCGCGCAGTGGATGAAGCAAATCGT
GTCCTTCGACAAGCTCAAGCTGACCAACAACCTACTGGACGACAACGGCCAC
gtgagcgactgcctccccaggctccggtgtcccccaaggcctcgagtcccgaggcacccg
cctgtccctaagaggcctgtagaatccccaggcccccggctgtccccaggcggctctggg
ctgtccccgaggaggccctttagagtccctgcgaggctagaggctgaggcggagcttggg
EXON 6  156 bp
gccaatgggtcacagcctcctcttggcccagtgacccagcctcatcttggaattaagggt
tttgcccaactcatccaggaaactcattgccaactcagacctcagcccatttcctggctc
ccaccccagatcctcagcccagccccaccgctggagctgattccccaccttgtcttccag
ATTATTCTGAATTCCATGCACAGATACCAGCCCCGCTTCCACGTGGTCTATGTGGACCCA
CGCAAAGATAGCGAGAAATATGCCGAGGAGAACTTCAAAACCTTTGTGTTCGAGGAGACA
CGATTCACCGCGGTCACTGCCTACCAGAACCATCGG
gtgagggcctgtggggaggacctgagcggattcaacgcctctggaaaagcgggtgtaatt
ttcagttgccgtttggggacagtgggtccgcttagacctgcaggctgtggtcccagtgga
gcccaacccaactggagccccactcccaagggcctcaggcagccccctccctctcgaggc
EXON 7  68 bp
ccgcccccctgcaggagggagcaccagctccgtagaggaggggcagacgtggactggttc
ttgtcagggcagcagaaaggcccttggtgcgcttctcctaacactcccctatcctccgcc
gaggtcgggtggcccaggctgcagggctccagcggcttgctcacacccacctccctgcag
ATCACGCAGCTCAAGATTGCCAGCAATCCCTTCGCGAAAGGCTTCCGGGACTGTGACCCT
GAGGACTG
gtgagtgtcctcccccgagagagtgagcgccgggcgcctggcgcaggcgccgccctgatc
cgcctcccgcccgcaggccccggaaccaccggcccggcgcactgccgctcatgagcgcct
tcgcgcgctcgcggaaccccgtggcttccccgacgcagcccagcggcacggagaaaggta
EXON 8  101 bp
ggctccagcggcttgctcacacccacctccctgcagatcacgcagctcaagattgccagc
aatcccttcgcgaaaggcttccgggactgtgaccctgaggactggtgagtgtcctccccc
gagagagtgagcgccgggcgcctggcgcaggcgccgccctgatccgcctcccgcccgcag
GCCCCGGAACCACCGGCCCGGCGCACTGCCGCTCATGAGCGCCTTCGCGCGCTCGCGGAA
CCCCGTGGCTTCCCCGACGCAGCCCAGCGGCACGGAGAAAG
gtagggccggggtcgtgggatccgggttccggccctgtgcgcgctctaccccgggccggc
ggcctcgcccgacctcgcctgcgcccccggggcgctccaggctttcgcgccggttgcaca
acggccgcggcggcgggcaagcgcgcactcgcccgcccggcccgacggctgcgccccgcc
EXON 9  944 bp
cgcgggccccggggagggctcggggcgccggcgacttggggtctcgggcacgctggcacc
gactggtcggggaacaccgagggcggccaagagccttctctccgccagggcctcgcatgg
ggcgtcggagctcctcggcggccccggccggccgcgctcactcctcggccctctccgcag
ACGCGGCTGAGGCCCGGCGAGAATTCCAGCGCGACGCGGGCGGGCCAGCAGTGCTCGGGG
ACCCGGCGCATCCTCCGCAGCTGCTGGCCCGGGTGCTAAGCCCCTCGCTGCCCGGGGCCG
GCGGCGCCGGCGGCTTAGTCCCGCTGCCCGGCGCGCCCGGAGGCCGGCCCAGTCCCCCGA
ACCCCGAGCTGCGCCTGGAGGCGCCCGGCGCATCGGAGCCGCTGCACCACCACCCCTACA
AATATCCGGCCGCCGCCTACGACCACTATCTCGGGGCCAAGAGCCGGCCGGCGCCCTACC
CGCTGCCCGGCCTGCGTGGCCACGGCTACCACCCGCACGCGCATCCGCACCACCACCACC
ACCCCGTGAGTCCAGCCGCCGCGGCCGCCGCCGCCGCTGCCGCAGCTGCCGCGGCCGCCA
ACATGTACTCGTCGGCCGGAGCCGCGCCGCCCGGCTCCTACGACTATTGCCCCAGATAAC
ACGGGCCCTGTCGCGCTCCCGCCCCGGTCCTGCACAGCCCCGAAGTTCGCCGGGCCCGGC
CACCCTGCCCCAAGGGCAAGCAAGGAATACGTTCCCCCAGCCCCAGGGGCCACCGCGGCT
CTCCCCTTCCCCAGCCTCGAAGCCATGGGGGCCCCCTCGCCACCCCCAGCCCCTTGGGCT
ATCGAAGTATCCGGTTCCCCAGTCCCTGGAGCCACCGCGGGTCCTTCCCCGGCCCCGAGG
GCCAAGGGGGTCCCCGCCCGCCAGTGCCAAAGCGCCCGGTCGGAGGCGGAAGGAAGTGAT
ATTTATTGTTCTCCCCGAGACCGCGTCGCCCGCGGCCCGGCCGGCAGTTGCAGTGTAGAC
AGCCCGAGAGCCCCGCCTGCAGGCGGTGTAGATACATGTAGATACTGTAGATACTGTAGA
TACCGCCCCGGCGCCGACTTGATAAACGGTTTCGCCTCTTTTGG
aagccgcctgcgtgtccatttatttgtgcccagttagatcgcgttgggaatcttcgggac
agcgagcccggggtagctcagggccctcagggcctccccagccccaatccctgccgactg
taggtcggtcccggtcccacagcgccctgtccgccacgcctcctgccctctgcccgcccc